ID: 1029810797

View in Genome Browser
Species Human (GRCh38)
Location 7:103046421-103046443
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 14, 1: 31, 2: 46, 3: 37, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029810795_1029810797 2 Left 1029810795 7:103046396-103046418 CCATGGAAAAAGGACCTAACAAA 0: 39
1: 40
2: 27
3: 29
4: 254
Right 1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG 0: 14
1: 31
2: 46
3: 37
4: 217
1029810793_1029810797 18 Left 1029810793 7:103046380-103046402 CCTCTTTTATTCTAAACCATGGA 0: 17
1: 21
2: 24
3: 47
4: 248
Right 1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG 0: 14
1: 31
2: 46
3: 37
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901225136 1:7608930-7608952 ATGTCCTTCTAGAAAAGGCCAGG - Intronic
902499774 1:16902390-16902412 ATCTGATTCTAGAAGAGTAAGGG + Intronic
904579468 1:31530516-31530538 ATTTCCTTGCAGAAGAGTCATGG - Intergenic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
906951753 1:50340708-50340730 CTGTGATTCTAGAAGAGGGATGG - Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
916402952 1:164468723-164468745 ATGACCTTCTATTAGAGTGTAGG - Intergenic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919458246 1:197845791-197845813 GTGTCATTCTAGAACAGTAAGGG - Intergenic
921587755 1:216967447-216967469 ATGTCTTTCTAGAAAAGGCAGGG - Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
923127589 1:231046074-231046096 TTGTCCTGCTACAAGAGTGGTGG - Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1067360628 10:45574878-45574900 TAGTCCTTTTGGAAGAGTGAGGG - Intronic
1068170338 10:53384606-53384628 ATATCCTTCTAAACAAGTGAGGG - Intergenic
1068401266 10:56530710-56530732 ATGACTTTCTTGAAGACTGAGGG + Intergenic
1070951481 10:80434910-80434932 ATGTCCTCTAAGAAGAGGGAGGG + Exonic
1070996564 10:80788729-80788751 AGTTTCTTCTAGAAGAATGAGGG + Intergenic
1071971478 10:90912068-90912090 AAGTCCTTCTATAAGTGTGGTGG - Intergenic
1073515012 10:104068530-104068552 TTGGCCTTCTAGAAGCTTGAGGG - Intronic
1074492360 10:113950005-113950027 ATGTCTTTCTAGAACTGTAAAGG + Intergenic
1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG + Intronic
1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080604001 11:33848949-33848971 ATGTCGTTTTAGAGGAGGGAGGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083376656 11:62228828-62228850 ATACCCTTCTGGAAGTGTGAAGG - Intergenic
1084697735 11:70765830-70765852 ATGTCATTCAAGAAAAGTGTTGG - Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086133372 11:83422771-83422793 CAGTCCTTTTGGAAGAGTGAGGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088104394 11:106189638-106189660 ATGTCCTTATGAAAAAGTGAAGG - Intergenic
1088536245 11:110865339-110865361 ATCTCCTTCTAAAAGAATAAGGG - Intergenic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1091049596 11:132355437-132355459 ATGTCCTCCTGGAAGGATGATGG + Intergenic
1093225643 12:16479998-16480020 GTTTCCTTCTAGAAGTGTTATGG - Intronic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1093358773 12:18199450-18199472 TAGTCCTTTTACAAGAGTGAGGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097892842 12:64795244-64795266 ATCTCCTGCTCGAAGGGTGAAGG + Intronic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1099046697 12:77729361-77729383 ATTTCATACTTGAAGAGTGAAGG + Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1100645313 12:96523087-96523109 ATATCCATCTAGAACAGTCAGGG - Intronic
1101071900 12:101084473-101084495 ATGTCATTTTAGAACAGTAAAGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1105286694 13:19009936-19009958 ATGTCTTTTTAGGAGAGTGTTGG - Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG + Intergenic
1108702991 13:52959523-52959545 ATGTCCCTTTGCAAGAGTGAGGG + Intergenic
1109157788 13:58932654-58932676 AAGTTCTTCTAGAAAAGTTAAGG - Intergenic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1109860162 13:68187779-68187801 ATGTCATTCTAGAGGAGAGAAGG + Intergenic
1110050158 13:70886918-70886940 ATGTCCTTTTAATAGAATGAAGG - Intergenic
1110232069 13:73177519-73177541 TTGTTTTTCTAGTAGAGTGATGG - Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1116802884 14:49461809-49461831 ATGTGCTTCTGGAAGGCTGAAGG - Intergenic
1116858052 14:49971124-49971146 GTGTCTTTGGAGAAGAGTGATGG + Intergenic
1118285466 14:64466595-64466617 AAGTCATTCTAGAACAATGACGG - Intronic
1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG + Intergenic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121427407 14:93862347-93862369 ATCTCCTTCTAGAGAGGTGATGG + Intergenic
1121440978 14:93949121-93949143 ATGTCCTTCCAGAACAAGGAAGG - Intronic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1122758664 14:104003473-104003495 ATATCTATCTAGAAGGGTGAAGG - Intronic
1125414938 15:39442479-39442501 AATTCCATCTAGCAGAGTGAAGG - Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1130730996 15:86492070-86492092 AAGTGCTCCTAGAATAGTGAGGG + Intronic
1131484892 15:92812009-92812031 ATATCAATTTAGAAGAGTGAGGG - Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG + Intergenic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1145231157 17:21174317-21174339 TTGTCCTTGTAGAATAGTGTGGG + Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1147620024 17:41860068-41860090 ATGTTCTCTTAAAAGAGTGAAGG - Intronic
1149779161 17:59382476-59382498 ATGTCATTTTAAAAGTGTGAAGG - Intronic
1149973487 17:61242545-61242567 ATGTCCTTCTAAATGGGAGAAGG - Intronic
1150119346 17:62586907-62586929 ATTTCCTTCTAGAAGAGACTGGG + Intronic
1151909697 17:77073924-77073946 CTGTCATTCTAGTAGAGGGAGGG - Intergenic
1153232026 18:2947373-2947395 TTGTCCTTCTAGAGGATGGATGG - Intronic
1153881650 18:9426461-9426483 TTGTACTTTTAGAAGAGTCAGGG - Intergenic
1153965039 18:10172148-10172170 ATGTCTATCTAGAAAGGTGAAGG + Intergenic
1154352150 18:13593138-13593160 ATGTACTTTTAGTAGAGTCAGGG - Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1156567687 18:38214237-38214259 ATTTTCTTCTAGAAGATTTATGG - Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1158690175 18:59653178-59653200 ATGTCCTTCTTGGAGAGGGCTGG - Intronic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1162229779 19:9256542-9256564 ACATCCTTCTAGAATAGTGATGG - Intergenic
1162329457 19:10018674-10018696 AAGTAATGCTAGAAGAGTGAGGG + Intronic
1164422102 19:28103446-28103468 ATGTCCTTCTAGAGCTGAGATGG + Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1165026069 19:32962504-32962526 ATTTTCTTCTAGAAGTGTTATGG - Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG + Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
928847087 2:35689267-35689289 ATGGTCTTCTGGAAGAGAGAGGG - Intergenic
929197822 2:39204734-39204756 AAGTTCTTTTAGAAAAGTGAAGG - Intronic
929305684 2:40358856-40358878 ATATGCTTCTACAAGACTGAAGG + Intronic
929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG + Intergenic
929442404 2:41974240-41974262 ATGACCAACTGGAAGAGTGAGGG + Intergenic
929823293 2:45290492-45290514 ATGACCTGCTAGATGAGAGAGGG + Intergenic
929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG + Exonic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
939036618 2:137139293-137139315 ATGTCCATCTAAAAGAATGGAGG - Intronic
939882202 2:147643216-147643238 ATATCCTTCTAGAAGAGGAGGGG - Intergenic
940442698 2:153736973-153736995 CTGCCCTCCCAGAAGAGTGATGG - Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944606331 2:201354818-201354840 CTGGCCTTCAAGAAGAGAGAAGG - Intronic
944996519 2:205300968-205300990 TGGTCCTTGTAGAAAAGTGAAGG - Intronic
945811826 2:214558266-214558288 ATGTCCTGCAAGAAGAAAGAGGG - Intronic
945858461 2:215094089-215094111 CAGTCCTTCTGAAAGAGTGAGGG - Intronic
945983241 2:216333043-216333065 GTTTTCTTCTAGAAGAGTTATGG - Intronic
947004971 2:225500754-225500776 TTGACCTTCTAGCAGAGAGATGG - Intronic
1169773388 20:9225753-9225775 ATCTGCTTCTATAAGAGAGAGGG + Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171325062 20:24283931-24283953 ATGTCTTTATAGCAGTGTGAGGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1175055913 20:56198012-56198034 GTTTCCTTCTAGTTGAGTGAGGG + Intergenic
1175757363 20:61538286-61538308 GTGTCCTTCTCCCAGAGTGACGG - Intronic
1176737111 21:10560503-10560525 GGGTGCTTCTAGCAGAGTGATGG - Intronic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177411374 21:20734352-20734374 ATGGCTTTCTAGTCGAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1179381601 21:40904196-40904218 AGGTCCTGCTAGAAAAGGGAGGG - Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1180563109 22:16638025-16638047 GGGTGCTTCTAGCAGAGTGATGG - Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1182959936 22:34462724-34462746 ATGTCCAACTAGCAGGGTGAAGG - Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
950447103 3:13044694-13044716 ATGTCCTTCTCCAGGAGTGTGGG - Intronic
950604780 3:14068932-14068954 ATGTCCTTCCTATAGAGTGAAGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951762472 3:26161754-26161776 TTGTCCTTTTGCAAGAGTGAGGG + Intergenic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
952042348 3:29276477-29276499 ATGTCCTTCTTAAAGATAGAAGG + Intergenic
957724799 3:84050001-84050023 ATGTCATTTTAGAAAAGCGAAGG - Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
959132634 3:102376317-102376339 ATGTACTTTTAGAAGATTGCTGG - Intronic
962146686 3:132847029-132847051 ATGTCCTTGTAGAGGTATGATGG - Intergenic
962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG + Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG + Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965157995 3:165089200-165089222 ATGTCCTTCTAGAATTCAGACGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG + Intronic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
969603996 4:8193168-8193190 AGGTCGTTCTAGAAGAGGGGAGG - Intronic
970761851 4:19498972-19498994 ATGACCATCTGGAAGACTGAAGG - Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973813874 4:54600250-54600272 ATATCCTTCTACAGGACTGAAGG + Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974449556 4:62035434-62035456 ATTTCCTTCTAGATGAGAAAGGG - Intronic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
977782173 4:100993456-100993478 AAGTCCTTTTGCAAGAGTGAAGG + Intergenic
978211486 4:106142772-106142794 ATTTTCTTCATGAAGAGTGATGG - Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
982149449 4:152436593-152436615 CTGTCCAGCTAGAAGAGTCATGG - Intronic
982378018 4:154715973-154715995 ATTTCCTTCTGTAAGAGTGGAGG - Intronic
984553528 4:181187452-181187474 TTGTACTTCTAGAAAACTGAAGG + Intergenic
987682177 5:21151221-21151243 ATGTCCTTCTTTATGAGGGATGG + Intergenic
988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG + Intergenic
988945646 5:36195141-36195163 CTGTGCTTCTTGAACAGTGAAGG - Exonic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991114011 5:62932984-62933006 ATGTCCTTCAAAAAGAGACAAGG + Intergenic
991764664 5:69961967-69961989 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991782660 5:70156186-70156208 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
991843896 5:70837038-70837060 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991875103 5:71156500-71156522 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993468312 5:88274725-88274747 ATGTCCTTCAAGAAGAAATAAGG - Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998682618 5:144487200-144487222 ATGTCATTCTGGAACAGTGGAGG - Intergenic
999924069 5:156355964-156355986 TTTTTCTTCTAGAAGTGTGAGGG + Intronic
1002418445 5:179132932-179132954 ACGTCCTGCTAGTAGAGTCAGGG + Intronic
1003785893 6:9486677-9486699 TTGACCTTCCAGCAGAGTGAGGG + Intergenic
1005162842 6:22884348-22884370 ATTTACTTATGGAAGAGTGAAGG - Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006506575 6:34492802-34492824 ATGGACTTCTAGAGGAGGGAAGG + Intronic
1006562615 6:34926705-34926727 TTCTCCTCCTGGAAGAGTGAGGG - Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1007847120 6:44768498-44768520 AACTCTTTCTTGAAGAGTGAGGG - Intergenic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1010038194 6:71350978-71351000 CTTTCCTTGTAGAAGAGTTAGGG - Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012807387 6:103911658-103911680 CTTTCCTTCTAGTAGAGGGAGGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG + Intergenic
1016187666 6:141217954-141217976 ATTTCCTTCTAGTATAGGGAGGG + Intergenic
1016813946 6:148286664-148286686 GTGTCCTTCTAGAAGAGGAGGGG - Intronic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1019140948 6:169942041-169942063 ACGTCCTTCCAGAAAAGTGAGGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020027199 7:4907520-4907542 ATGGTCTTCTTCAAGAGTGACGG - Exonic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021115600 7:16743211-16743233 ATTTCCTGCTAGAAGTTTGAGGG - Intergenic
1021362210 7:19729578-19729600 ATCTCATTCTAGAATAGTAAAGG + Intronic
1022617966 7:31951876-31951898 ATCTCCTTGTGGAAGAGGGAAGG - Intronic
1022914865 7:34938011-34938033 ATTACATTCTAGAAGAGTCATGG - Exonic
1023824845 7:44002133-44002155 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1023876757 7:44290377-44290399 AGGTCCTTCTGGAAGAGTCTGGG + Intronic
1026088394 7:67280907-67280929 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG + Intergenic
1027117996 7:75496212-75496234 TTGTGCTTCTAGAAGAGACAGGG - Intergenic
1027273809 7:76539248-76539270 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027327256 7:77058302-77058324 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028042604 7:86073912-86073934 GAATCCTTCTATAAGAGTGAGGG - Intergenic
1028140771 7:87272807-87272829 CTGGCCTTGTAGAAGAGTAAAGG + Intergenic
1029424597 7:100488054-100488076 ATGTCCTTGCAGAAGGGTCAAGG + Intronic
1029719507 7:102353834-102353856 TTGTGCTTCTAGAAGAGACAGGG + Intergenic
1029753108 7:102555438-102555460 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029771059 7:102654521-102654543 TTGTGCTTCTAGAAGAGACAGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1031459593 7:122030472-122030494 AGATCCTTCTATAAGTGTGAAGG + Intronic
1031742511 7:125452683-125452705 GTATCCTCCTAGAACAGTGAAGG + Intergenic
1031846980 7:126817359-126817381 AGCTCCTTCTAGTACAGTGAAGG + Intronic
1033056298 7:138058079-138058101 ATGTCTTTATATAAGAGAGAGGG - Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033822237 7:145148490-145148512 ATGTGGTTCTAGAAAAGTAAGGG - Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1038905157 8:31893372-31893394 TTCTCCTTATAGTAGAGTGAAGG + Intronic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG + Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1045533099 8:103002750-103002772 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047097974 8:121644036-121644058 AAGTCAATCTAAAAGAGTGAAGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG + Intergenic
1051119509 9:13736716-13736738 GTGTCCTTCTAGAGCACTGAAGG + Intergenic
1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG + Intronic
1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG + Intronic
1055685828 9:78773693-78773715 ATCTCTTTTTAGAGGAGTGAGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1058866309 9:109165346-109165368 ATGTCCTTGTTCAAGATTGAGGG - Intronic
1058895368 9:109396285-109396307 ATGTCTTTCTGGAAGGGTCAGGG + Intronic
1059610420 9:115886544-115886566 ATGTCCTTTTTGAACAGTGGTGG + Intergenic
1060623866 9:125092637-125092659 ATGTCCTTGAATAACAGTGAGGG - Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186219531 X:7334620-7334642 GTGGCTTGCTAGAAGAGTGAGGG - Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187180244 X:16937082-16937104 CTTTCCTTAGAGAAGAGTGAGGG + Intergenic
1187829331 X:23364988-23365010 AAGTACTTCTTGAAGAGTTACGG + Intronic
1188563160 X:31493244-31493266 ATGTCCTTCAAGAAGATTTTTGG - Intronic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG + Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193365714 X:80629857-80629879 ATCTCCTTCTTGAGGAGTCAAGG - Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1194515516 X:94847092-94847114 ATGTTCCTCTAGAAGATTAATGG - Intergenic
1194546897 X:95247242-95247264 ATATACTTCTAAAAGAATGAAGG - Intergenic
1195426325 X:104736016-104736038 GTGTGCTTCTAGAATAATGAAGG - Intronic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195558720 X:106258133-106258155 ATGCCCGTCTAGAATAGCGAAGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196973469 X:121134227-121134249 AGGCCCTTTTGGAAGAGTGAAGG + Intergenic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1197500029 X:127230922-127230944 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198531892 X:137556004-137556026 ACCTCCTTCTAGAAGAAAGAAGG - Intergenic
1200271409 X:154688048-154688070 ATTTCCTTCTAAAAGAATTATGG - Intronic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic
1201713125 Y:17013858-17013880 ATATCCTCCAAGAAGAGAGAAGG + Intergenic
1202595366 Y:26533767-26533789 GGGTGCTTCTAGCAGAGTGATGG - Intergenic