ID: 1029812705

View in Genome Browser
Species Human (GRCh38)
Location 7:103065477-103065499
Sequence TGGACTCTGAGTGATACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029812705 Original CRISPR TGGACTCTGAGTGATACAGG AGG (reversed) Intronic
900822573 1:4900558-4900580 TGGATGCTGAGGGATACAGGAGG - Intergenic
901322824 1:8349806-8349828 TGGGCTGTGGGAGATACAGGGGG + Intergenic
902288442 1:15421531-15421553 TGGCCTTTGATTGATAGAGGCGG + Intronic
902731139 1:18369623-18369645 TGCACTCTGGGTGAGACAGTGGG + Intronic
904597691 1:31657155-31657177 TGGCCTCTGGGTGGAACAGGGGG - Intronic
905000679 1:34666239-34666261 TGGACTCTGACTGATACATAGGG - Intergenic
906710012 1:47922406-47922428 AGGACTCTGAGTGGTCAAGGTGG + Intronic
907576118 1:55527438-55527460 TGGACTCTAACTTATACAGATGG + Intergenic
907974134 1:59414563-59414585 TGGATCCTGCGTGAAACAGGTGG + Intronic
908542523 1:65135356-65135378 TGTAGTCTCAGTGATTCAGGAGG + Intergenic
914094467 1:144532912-144532934 TGGACTCTGAGAGAAAGAGTTGG - Intergenic
914304056 1:146400975-146400997 TGGACTCTGAGAGAAACAGTTGG + Intergenic
914991315 1:152501797-152501819 TTGACTCAGTCTGATACAGGTGG - Intergenic
918703209 1:187631334-187631356 TGGACTCTCAGGAATGCAGGAGG + Intergenic
923361901 1:233219789-233219811 TGGACTTTGGGTGATACTGATGG - Intronic
924043878 1:240009206-240009228 TGGACTCTGGGTGCTCCAGCTGG - Intergenic
924167919 1:241304533-241304555 TGGGCTCTGGGTGCTACAGCTGG + Intronic
1063793642 10:9484834-9484856 TGGAGGCTGAGTGATCAAGGTGG - Intergenic
1067877509 10:50018936-50018958 TGGACTCTGGCTGTTACAAGAGG + Intergenic
1068820800 10:61376341-61376363 AGAACTCTGACTAATACAGGCGG + Intergenic
1070889648 10:79933324-79933346 TGTACTCTGAGTGATATTTGGGG - Intergenic
1071398794 10:85249154-85249176 AGGACTCTGAGTGATCAAAGAGG - Intergenic
1073063110 10:100743947-100743969 TGGGCTCTGGAGGATACAGGAGG + Intronic
1073650901 10:105357120-105357142 TGGAGACTGATTAATACAGGTGG - Intergenic
1076343310 10:129764697-129764719 TGGAGTCGGAGTGATACCCGGGG + Intronic
1078676680 11:13424922-13424944 TGGACTCTGAGTGAAAGACATGG + Intronic
1078971007 11:16411195-16411217 TGCACACTTAGTTATACAGGTGG - Intronic
1079759674 11:24312815-24312837 TGTACTCTGACTGATATAGGAGG + Intergenic
1080265042 11:30391438-30391460 TGGTCTCTGAATGAAACAGTTGG + Intronic
1081392441 11:42544821-42544843 TGGAGTCTGAGTGAAAGATGAGG - Intergenic
1082820900 11:57543961-57543983 TGGACGCTGAGGGAAGCAGGAGG - Intronic
1085323373 11:75588473-75588495 TGGACTCGGAGTCATCCAGTAGG + Intronic
1085775552 11:79363026-79363048 TGGACACTGACTCACACAGGTGG + Intronic
1087632839 11:100670703-100670725 AGGACTCTGAGTAATAGAGAGGG + Intergenic
1087985355 11:104671893-104671915 TGAACCCTGATAGATACAGGAGG + Intergenic
1089411015 11:118242907-118242929 GGGACACTGAGAGAAACAGGTGG + Intronic
1090037728 11:123263456-123263478 AGGACCCTGACTGATACAGGGGG - Intergenic
1091003827 11:131933920-131933942 GGGGCTCTGAGTGTTAAAGGAGG - Intronic
1093133754 12:15423822-15423844 TGGACTCTGAGTCATCTAAGTGG - Intronic
1094174633 12:27528867-27528889 TGGACTCTGAGTGGTCCAAGTGG + Intronic
1097101191 12:56590741-56590763 TGTACTCAGAGGGATTCAGGTGG + Exonic
1099492990 12:83308741-83308763 TGGACTTTCAGTTACACAGGAGG - Intergenic
1100605421 12:96148524-96148546 TGGACTCTGTGTGATCTTGGAGG + Intergenic
1104978374 12:132562073-132562095 AGGACTCCGAGAGAAACAGGAGG - Intronic
1105888426 13:24662952-24662974 TGCACTCTGAGAGATACAATTGG - Intergenic
1107806887 13:44161641-44161663 TGGACTCTTACTGATCCAAGTGG + Intergenic
1110597377 13:77334113-77334135 TGGACCCTGAATGGTACAGATGG + Intergenic
1111182606 13:84687990-84688012 TGGACTGAGAGTGATAGAGATGG + Intergenic
1111392025 13:87608858-87608880 TGGACTCTAACTGATATAGGTGG + Intergenic
1112203394 13:97300579-97300601 CGGACTCTGAGTTAGACAGAAGG - Intronic
1112367745 13:98770137-98770159 GGAACTGTGAGTGATCCAGGAGG + Intergenic
1113236860 13:108286157-108286179 TGGATCCAGAGTGAAACAGGTGG + Intronic
1114847610 14:26342942-26342964 TGGAATCTGACAGATACAGAAGG - Intergenic
1115382471 14:32756338-32756360 TGGAGTCTGAGTCATGGAGGTGG + Intronic
1115963816 14:38864814-38864836 TGGACCCTGACTGATACATGTGG - Intergenic
1116291864 14:43053504-43053526 TGGACTCTGAGTTACACCAGTGG - Intergenic
1117813126 14:59569729-59569751 TGGACCCTGACTGATAGAGTGGG - Intronic
1118755191 14:68837924-68837946 AGGAGACTGAGTGAGACAGGAGG + Intergenic
1119872994 14:78032772-78032794 TGCACTCTGAGAGATGCATGAGG + Intergenic
1123475684 15:20591508-20591530 TGGACGCTGTCTGATAGAGGAGG + Intergenic
1123642327 15:22408855-22408877 TGGACGCTGTCTGATAGAGGAGG - Intergenic
1127277668 15:57461494-57461516 TGGCCTCTGAGAAATGCAGGGGG + Intronic
1127389591 15:58494637-58494659 TTGGCACTGATTGATACAGGTGG - Intronic
1129073347 15:72970644-72970666 AGGAATCTGAGTCATAGAGGGGG - Intergenic
1129823039 15:78617558-78617580 TGGACTCTGAAAGATTCCGGGGG + Intronic
1131050138 15:89342289-89342311 TGAACTCTGAATGATACAATGGG - Intergenic
1132784173 16:1645527-1645549 TGGACTCTGAGTGATGAAGAAGG - Intronic
1133146112 16:3787915-3787937 GGGAGGCTGAGTGAGACAGGCGG - Intronic
1134689926 16:16184583-16184605 TGACCTCGGACTGATACAGGAGG + Intronic
1135143273 16:19939866-19939888 TGGACCCTGGCTGATCCAGGAGG - Intergenic
1138496579 16:57412680-57412702 TGGACTCTGATTGTGACATGGGG - Intronic
1139035301 16:62938527-62938549 GGCACTCTGAGTGATACAGATGG + Intergenic
1140830145 16:78743268-78743290 TGGTCTCTGAGGGATACACAGGG - Intronic
1141016231 16:80452692-80452714 TTTACTCTGTGTGAAACAGGAGG - Intergenic
1146503694 17:33386253-33386275 TGGACACCTAGGGATACAGGTGG - Intronic
1149887686 17:60357201-60357223 AGAACTCTGAGTGGTCCAGGTGG + Intronic
1150886174 17:69088706-69088728 TCTACTCTGAGTGATGGAGGAGG - Intronic
1152288947 17:79428026-79428048 TGGACATTCAGTTATACAGGAGG - Intronic
1153232301 18:2950463-2950485 TGGCCACTGAGTGCAACAGGTGG + Intronic
1157413895 18:47486145-47486167 TGGGCACTGAGTGTCACAGGAGG + Intergenic
1157578384 18:48758917-48758939 TGGCCTCTGGGTGATGAAGGCGG - Intronic
1159493280 18:69166490-69166512 TGTACACTGACTGATACAGGTGG + Intergenic
1159777403 18:72619594-72619616 TGGAATCTTAGCTATACAGGTGG - Intronic
1160146652 18:76371069-76371091 TGGACTCTGTGGGATACACCCGG - Intronic
1161612911 19:5253285-5253307 CTGACTCTGGGTGGTACAGGGGG - Intronic
1163922858 19:20309385-20309407 TGGACACTGAGTAACTCAGGGGG - Intergenic
1163946331 19:20538652-20538674 TGGACCCTGAGTAATTCAGGGGG + Intronic
1164480099 19:28604972-28604994 TGGACCCGGACTGACACAGGTGG - Intergenic
1164908409 19:31985991-31986013 TGTAATCTCAGTGATTCAGGAGG + Intergenic
1165778094 19:38416804-38416826 TGGACTGTGAGGGAGACAGATGG - Intronic
925504392 2:4544510-4544532 TGGGCTTTAAGTGATGCAGGAGG + Intergenic
926560740 2:14414815-14414837 TGGACTCTCAGTTCCACAGGAGG + Intergenic
927015221 2:18952335-18952357 TGGAATCAGGGTGATACATGTGG + Intergenic
928865214 2:35909666-35909688 TGGACTCTGTGTCAGACAAGGGG + Intergenic
929293409 2:40219003-40219025 TTGACTTTGAGTGTTACAGAGGG - Intronic
929551156 2:42893093-42893115 GGGCCTCTGAGTGACCCAGGAGG + Intergenic
931123700 2:59250064-59250086 TGTCCTCTGGGTGATAAAGGAGG + Intergenic
932074403 2:68649739-68649761 TGGCTTCTGAATGACACAGGGGG + Intronic
933970889 2:87468891-87468913 TGGACGCTGTGTGATTCAGGAGG + Intergenic
934035564 2:88086118-88086140 AGAAATCTGAATGATACAGGTGG + Intronic
935300252 2:101687687-101687709 TGTGCTCTGAGTGAAATAGGAGG + Intergenic
935922787 2:108033492-108033514 TGGGGTCTGAGTGATAGAAGAGG + Intergenic
936094895 2:109523987-109524009 AGGACTCTGAAGGATGCAGGTGG - Intergenic
936322837 2:111481298-111481320 TGGACGCTGTGTGATTCAGGAGG - Intergenic
937337962 2:121073227-121073249 TGAACTCTGACTGGTGCAGGTGG - Intergenic
937478849 2:122238953-122238975 TGGAATCAGATTGATACTGGAGG + Intergenic
941618988 2:167755709-167755731 TGTACTCTTAGTGACTCAGGAGG + Intergenic
942364493 2:175209231-175209253 TGGACTTTGGGTGATAATGGTGG - Intergenic
943487365 2:188502917-188502939 TGAACTCTGTGTGCTCCAGGAGG + Intronic
944323133 2:198372156-198372178 TGGACTCTCAGTGCAACATGAGG - Intronic
945958975 2:216112377-216112399 TGGGCACTGAGAGACACAGGAGG - Intronic
946922156 2:224591355-224591377 AGGACGCTGAGTGACACATGGGG - Intergenic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
947435858 2:230071544-230071566 TGGTCTCTCAGTGACACAGGTGG + Intergenic
948253107 2:236546353-236546375 TGGACTCAGAGAGACAGAGGGGG - Intergenic
948676314 2:239598923-239598945 TGGATTCTGGGTGATGCAGGAGG + Intergenic
1172643310 20:36454908-36454930 TGGAATCTGGGTCAGACAGGGGG - Intronic
1173950588 20:46990098-46990120 TGGACTCTGAGTGACAGACAAGG + Exonic
1174160897 20:48549725-48549747 AGGACTTTGAGTGATACAACTGG - Intergenic
1174313188 20:49675458-49675480 TGGCCTCTGAGTGAACTAGGAGG - Intronic
1175502916 20:59462967-59462989 TGGACTCTCAGCTATTCAGGAGG + Intergenic
1175886004 20:62291326-62291348 TGGGCTCTGAGTTGCACAGGTGG + Intronic
1176654319 21:9576305-9576327 TGGACTCTGATTGCAGCAGGTGG - Intergenic
1176967062 21:15223299-15223321 TGGACTCTGAATTATTTAGGTGG - Intergenic
1179069682 21:38059970-38059992 TGGGCTCTGTGTGGTTCAGGAGG - Intronic
1179416176 21:41200260-41200282 TGGACTCTGATAAATACAGCTGG + Intronic
1180004665 21:45014750-45014772 TGAACTCTGAGTGCAACAAGAGG + Intergenic
1183380611 22:37488860-37488882 TGGACCCTGAGTGGCAAAGGCGG - Intergenic
1185045485 22:48526451-48526473 GGGACTCTGAGGGCTCCAGGTGG - Intronic
949487748 3:4556304-4556326 TGGTCTCTGGGTGATACTGATGG - Intronic
951319668 3:21228943-21228965 TGGAATCCCAGTGACACAGGAGG + Intergenic
952874026 3:37926830-37926852 TGGACTGTGAGTGACCCAAGTGG - Intronic
954602334 3:51879061-51879083 TGGAGTCTGAGGGAGAAAGGGGG + Intergenic
958640250 3:96796154-96796176 TGTAGTCTTAGTTATACAGGAGG - Intergenic
959705360 3:109334288-109334310 TGTAGTCTGAGTGCTATAGGAGG + Intronic
960280100 3:115771734-115771756 TTAACTCTGACTGATACAGGTGG + Intergenic
960810746 3:121624933-121624955 GTGACTCTGATTGATACAGGAGG + Intronic
961469923 3:127105229-127105251 TGGACTCTGAGGGATGAAGGTGG + Intergenic
963105808 3:141646165-141646187 TGAACTCTGACTGATACAAAAGG - Intergenic
964664677 3:159159170-159159192 TGGACTCTGGGCTATAGAGGTGG + Intronic
967735416 3:192946692-192946714 TTGACTCTAAGTGCTAGAGGAGG - Intergenic
968257504 3:197290103-197290125 TGTGCTCTGAGTGATCCAGTGGG - Intronic
970187670 4:13478557-13478579 TGAAATGTGAGTGATACAGTGGG - Intronic
971145458 4:23971375-23971397 AGAACTCTGACTAATACAGGTGG - Intergenic
972233407 4:37101377-37101399 TGGAATCTGCGGGATACAGTGGG + Intergenic
972316863 4:37934777-37934799 CCCACTCTGACTGATACAGGTGG - Intronic
972353650 4:38260297-38260319 TGGACTCAGATGGATACAGAGGG + Intergenic
973704908 4:53571780-53571802 TGCAGTCTTAGTGATTCAGGGGG - Intronic
978044766 4:104113059-104113081 AGGACCCTGAGTAATACAGCTGG - Intergenic
978326284 4:107560894-107560916 TGGAATGTGAGTGAAACTGGAGG - Intergenic
979397515 4:120206542-120206564 TGGCTTCTGGGTGGTACAGGAGG - Intergenic
980721869 4:136708134-136708156 TGGACTCTGACCAATACAGGTGG - Intergenic
981570005 4:146141958-146141980 GGGACCCTGACTAATACAGGTGG - Intergenic
984239367 4:177199407-177199429 AGAACTCTGACTAATACAGGAGG - Intergenic
984735914 4:183107798-183107820 TGGACTCTGGGAGATAAAGATGG + Intronic
986231318 5:5867063-5867085 TGGCCACTGAGAGGTACAGGGGG - Intergenic
988158353 5:27485188-27485210 TGGAATCTTAATGTTACAGGTGG - Intergenic
988975751 5:36514448-36514470 TTGACTGTGAGTGAAACCGGAGG + Intergenic
990645913 5:57844429-57844451 TGGACCCTGACTGACACAGGAGG - Intergenic
993975610 5:94476183-94476205 TGGACCCTGACTGATACACTAGG - Intronic
999186582 5:149715142-149715164 TGGACTCTGGAGGATCCAGGGGG + Intergenic
1000251123 5:159496865-159496887 AGAACTCTGACTGATACAGAGGG + Intergenic
1000926680 5:167202738-167202760 TGCACTCTGAGTCACACGGGAGG + Intergenic
1001428270 5:171639185-171639207 GGGCCTGTGCGTGATACAGGGGG + Intergenic
1003415777 6:5906470-5906492 TGGACCATGGCTGATACAGGCGG + Intergenic
1004192837 6:13479092-13479114 TAGTCTCTGAGTCTTACAGGAGG + Intronic
1006943646 6:37769677-37769699 AGAACCCTGAGTCATACAGGTGG + Intergenic
1008872741 6:56291066-56291088 TTGACCCTGAGTGATGCAGTAGG - Intronic
1010028459 6:71246126-71246148 TTGATTCATAGTGATACAGGAGG - Intergenic
1011292984 6:85795773-85795795 TGGACTCTGAGTGAGAGAGGTGG + Intergenic
1012984791 6:105864336-105864358 TTTAATCTGAGTGATATAGGTGG - Intergenic
1013879561 6:114879509-114879531 TGGACACTTGGTGATCCAGGAGG - Intergenic
1014296487 6:119624957-119624979 AGGACTTTGATAGATACAGGAGG - Intergenic
1015303039 6:131675919-131675941 TTTACTCTGAGTGACACAGGGGG - Intronic
1015705469 6:136083074-136083096 TGGAGTCTGGGTGAGAAAGGTGG + Intronic
1015960440 6:138643383-138643405 TGGACTCTGGGTGATAATGACGG - Intronic
1016490169 6:144591592-144591614 TTTACTGTGAGTGATACAGGAGG + Intronic
1016731548 6:147433040-147433062 TGGGCTCCAAGTGATAGAGGAGG - Intergenic
1019483824 7:1278691-1278713 TGGACTCTGAGTGAAGCAGACGG + Intergenic
1019988922 7:4678993-4679015 GGAACTCTGTGTGATACAGAAGG - Intergenic
1020467943 7:8502477-8502499 TGGACTCTGACTGATGTAAGAGG - Intronic
1020649812 7:10860693-10860715 TGGCCTCTGAGTGATAGTGACGG - Intergenic
1021335421 7:19395527-19395549 TGAACCCTGGTTGATACAGGAGG - Intergenic
1021399260 7:20191093-20191115 TGGACTCGGAGTGATAGAGTAGG - Intronic
1021877247 7:25060204-25060226 TGTACTCAGAATGACACAGGAGG + Intergenic
1024027477 7:45425017-45425039 TGGGCTCTGACTGACATAGGAGG + Intergenic
1029812705 7:103065477-103065499 TGGACTCTGAGTGATACAGGAGG - Intronic
1031707285 7:124996727-124996749 TGCAGTCTGGGTGATAGAGGGGG + Intergenic
1032482314 7:132256838-132256860 TGGAATCTGAGTGATACGGCAGG + Intronic
1033420939 7:141204149-141204171 GGGACTCTGAGGGAAGCAGGTGG + Intronic
1037643157 8:20767021-20767043 TGGAATCTGACTGGTACAGTAGG - Intergenic
1042333217 8:67604613-67604635 TGGATGCTGAGGGATACAGCAGG - Intronic
1046653054 8:116860494-116860516 TGGCTGCTGACTGATACAGGTGG - Intronic
1050009234 9:1169362-1169384 TGGCCACAGAGTGAAACAGGAGG + Intergenic
1051167136 9:14275200-14275222 TGGTCTCTGAGTGCTCCAAGGGG + Intronic
1052166570 9:25337724-25337746 TGGGCTCTGGGTGATAAAGTTGG + Intergenic
1054343425 9:63890371-63890393 TGGACTCAGATTGAGCCAGGAGG - Intergenic
1056753775 9:89369678-89369700 TGTATTCTGAGTGATCCATGAGG + Intronic
1059216075 9:112563768-112563790 TTGAATAAGAGTGATACAGGTGG + Intronic
1059880994 9:118688582-118688604 AGAACTCTGATTAATACAGGAGG + Intergenic
1060693278 9:125684025-125684047 TGGACTCTGGGTGATATAGAAGG - Intronic
1062445241 9:136590963-136590985 TGGACACTGGGTGATAAATGGGG + Intergenic
1203632040 Un_KI270750v1:79763-79785 TGGACTCTGATTGCAGCAGGTGG - Intergenic
1186718610 X:12279222-12279244 TGGACTCTGAATGTTACGGTGGG - Intronic
1188262984 X:28039882-28039904 TGGAGTCTGAATCATTCAGGTGG + Intergenic
1190088319 X:47415551-47415573 TGGGCTCTGATTGATACAGAAGG + Intergenic
1190297614 X:49037791-49037813 TAGACTGTGAGAGATACAGGTGG - Intronic
1190873479 X:54444078-54444100 TTTTCTCTGAGTGATGCAGGAGG - Exonic
1192940832 X:75910031-75910053 TGAACCCTGACTAATACAGGGGG + Intergenic
1195270813 X:103228886-103228908 AGAACTCTGACTAATACAGGCGG - Intergenic
1195529884 X:105941923-105941945 AGGACTGTGAGTGGTAGAGGGGG - Intronic
1195959737 X:110373459-110373481 TGGACTCTGAGTTATGGAGGTGG - Intronic
1196187131 X:112756378-112756400 TGGACATAAAGTGATACAGGAGG + Intergenic