ID: 1029813087

View in Genome Browser
Species Human (GRCh38)
Location 7:103068946-103068968
Sequence CCACGGCCACCACGCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1659
Summary {0: 1, 1: 0, 2: 1, 3: 132, 4: 1525}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029813079_1029813087 13 Left 1029813079 7:103068910-103068932 CCTTCAATGTACTTGCCAGATTT 0: 1
1: 0
2: 2
3: 26
4: 192
Right 1029813087 7:103068946-103068968 CCACGGCCACCACGCCATCTGGG 0: 1
1: 0
2: 1
3: 132
4: 1525
1029813078_1029813087 22 Left 1029813078 7:103068901-103068923 CCAGCATAACCTTCAATGTACTT 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1029813087 7:103068946-103068968 CCACGGCCACCACGCCATCTGGG 0: 1
1: 0
2: 1
3: 132
4: 1525
1029813082_1029813087 -2 Left 1029813082 7:103068925-103068947 CCAGATTTTAAAGTTGAGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1029813087 7:103068946-103068968 CCACGGCCACCACGCCATCTGGG 0: 1
1: 0
2: 1
3: 132
4: 1525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029813087 Original CRISPR CCACGGCCACCACGCCATCT GGG Intronic
901030814 1:6305775-6305797 GCCCGGCCACCACCCCGTCTGGG - Intronic
901100332 1:6715030-6715052 GCCCGGCCACCACCCCGTCTGGG - Intergenic
901223897 1:7601005-7601027 GCCCAGCCACCACCCCATCTGGG - Intronic
901555513 1:10028751-10028773 GCCCGGCCACCACCCCGTCTGGG + Intergenic
901726922 1:11249941-11249963 GCCCGGCCACCACCCCGTCTGGG - Intronic
901849793 1:12008271-12008293 GCCCGGCCACCACCCCGTCTGGG - Intronic
902027460 1:13394799-13394821 GCCCGGCCACCACCCCGTCTGGG - Intergenic
903081844 1:20816714-20816736 GCCCGGCCACCACCCCGTCTGGG + Intronic
903100329 1:21023939-21023961 GCCCGGCCACGACCCCATCTGGG + Intronic
903103644 1:21053941-21053963 GCCCGGCCACCACCCCGTCTGGG + Intronic
903148622 1:21389226-21389248 GCCCGGCCACCACCCCGTCTGGG + Intergenic
903485955 1:23689224-23689246 GCCCGGCCACCACCCCGTCTGGG + Intergenic
903525011 1:23987058-23987080 GCCCGGCCACCACCCCGTCTGGG - Intergenic
903525820 1:23993242-23993264 GCCCGGCCACCACCCCGTCTGGG - Intergenic
903531153 1:24031949-24031971 GCCCGGCCACCACCCCATCTGGG - Intergenic
903633829 1:24799054-24799076 GCCCGGCCGCCACCCCATCTGGG + Intronic
903748628 1:25604418-25604440 GCCCGGCCACCACCCCGTCTGGG + Intergenic
903894660 1:26595886-26595908 GCCCGGCCACCACCCCGTCTGGG + Intergenic
903921336 1:26803403-26803425 GCCCGGCCACCACCCCGTCTGGG - Intergenic
903924082 1:26819135-26819157 GCCCGGCCACCACCCCGTCTGGG + Intergenic
904074392 1:27829246-27829268 GCCCGGCCACCACCCCATCTGGG + Intergenic
904322094 1:29704369-29704391 CCACCTCCACCTGGCCATCTAGG + Intergenic
904369894 1:30041859-30041881 CCACAGCCATCAGGCCACCTTGG + Intergenic
904498885 1:30902729-30902751 GCACTGCCACCACCACATCTGGG - Intronic
904795445 1:33052938-33052960 GCCCGGCCACCACCCCGTCTGGG + Intronic
904857246 1:33509168-33509190 GCCCGGCCACCACCCCGTCTGGG - Intergenic
905039943 1:34947836-34947858 GCCCGGCCGCCACCCCATCTGGG + Intergenic
905427258 1:37895922-37895944 GCCCGGCCACCACCCCGTCTGGG + Intronic
905427700 1:37897205-37897227 GCCCGGCCACCACCCCGTCTGGG + Intronic
905527164 1:38647784-38647806 GCCCGGCCACCACCCCGTCTGGG + Intergenic
905599005 1:39234312-39234334 GCCCGGCCACCACCCCGTCTGGG - Intronic
905686540 1:39912998-39913020 GCCCGGCCACCACCCCGTCTGGG - Intergenic
905699431 1:40000096-40000118 GCCCGGCCACCACCCCGTCTGGG + Intergenic
906136319 1:43502432-43502454 GCCCGGCCACCACCCCGTCTGGG + Intergenic
906353320 1:45081799-45081821 GCCCGGCCACCACCCCGTCTGGG + Intronic
906370403 1:45248345-45248367 GCCCGGCCGCCACCCCATCTGGG + Intronic
906400036 1:45497852-45497874 GCCCGGCCACCACCCCGTCTGGG + Intronic
906487408 1:46242406-46242428 GCCCGGCCACCACCCCGTCTGGG + Intergenic
906741863 1:48192150-48192172 GCCCGGCCACCACCCCGTCTGGG + Intergenic
906742189 1:48193100-48193122 GCCCGGCCACCACCCCGTCTGGG + Intergenic
907089487 1:51711229-51711251 GCCCGGCCACCACCCCGTCTGGG - Intronic
907089729 1:51711999-51712021 GCCCGGCCACCACCCCGTCTGGG - Intronic
907091637 1:51730184-51730206 CCTCAGCCTCCACCCCATCTAGG - Intronic
907140710 1:52182221-52182243 GCCCGGCCACCACCCCGTCTGGG + Intronic
907202912 1:52743028-52743050 GCCCGGCCGCCACCCCATCTGGG + Intronic
907402636 1:54233821-54233843 GCCCGGCCACCACCCCGTCTGGG + Intronic
907871581 1:58448555-58448577 CCAGGGCCAGCCCCCCATCTTGG - Intronic
908467803 1:64414814-64414836 TCCCGGCCGCCACCCCATCTGGG + Intergenic
908468245 1:64415993-64416015 GCCCGGCCACCACCCCGTCTGGG + Intergenic
909478776 1:76111961-76111983 GCCCGGCCACCACCCCGTCTGGG - Intronic
909623103 1:77687535-77687557 GCTCGGCCCCCACCCCATCTGGG + Intergenic
910344158 1:86216789-86216811 GCCCGGCCACCACCCCGTCTGGG + Intergenic
910406756 1:86899308-86899330 GCCCGGCCACCACCCCATCTGGG - Intronic
910673679 1:89797726-89797748 GCCCGGCCACCACCCCGTCTGGG - Intronic
910891750 1:92026472-92026494 GCCCGGCCCCCACCCCATCTGGG - Intergenic
911351565 1:96762252-96762274 GCCCGGCCACCACCCCGTCTGGG - Intronic
911598656 1:99823883-99823905 GCCCGGCCACCACCCCGTCTGGG + Intergenic
912116225 1:106412245-106412267 ACCCGGCCACCACCCCGTCTGGG + Intergenic
912116404 1:106412819-106412841 GCCCGGCCACCACCCCATCTGGG + Intergenic
912266107 1:108159988-108160010 GCCCGGCCACCACCCCATCTGGG - Intronic
912298031 1:108488868-108488890 GCCCGGCCACCACCCCGTCTGGG - Intergenic
912317115 1:108676171-108676193 GCCCGGCCACCACCCCGTCTGGG + Intergenic
912629383 1:111233663-111233685 GCCCGGCCACCACCCCGTCTGGG + Intronic
912690304 1:111800013-111800035 GCCCGGCCACCACCCCGTCTGGG + Intronic
912808387 1:112774432-112774454 GCCCGGCCACCACCCCGTCTGGG + Intergenic
912845370 1:113070604-113070626 GCCCGGCCACCACCCCGTCTGGG + Intergenic
912966698 1:114242617-114242639 GCCCGGCCGCCACCCCATCTGGG + Intergenic
912966735 1:114242734-114242756 GCCCGGCCACCAACCCATCTGGG + Intergenic
913021069 1:114790484-114790506 GCCCGGCCACCACCCCGTCTGGG - Intergenic
913078585 1:115360985-115361007 GCCCGGCCGCCACCCCATCTAGG - Intergenic
913305742 1:117429325-117429347 GCCCGGCCACCACCCCGTCTGGG - Intronic
914002439 1:143703610-143703632 GCCCGGCCACCACCCCGTCTGGG + Intergenic
914231076 1:145764893-145764915 GCCCGGCCACCACCCCGTCTAGG + Intronic
914231253 1:145766517-145766539 GCCCGGCCACCACCCCGTCTGGG - Intronic
914231619 1:145767559-145767581 GCCCGGCCACCACCCCTTCTGGG - Intronic
914392309 1:147233567-147233589 GCCCGGCCACCACCCCGTCTGGG + Intronic
914774973 1:150728471-150728493 GCCCGGCCACCACCCCGTCTGGG - Intergenic
914893710 1:151651124-151651146 GCCCGGCCACCACCCCGTCTGGG - Intronic
914909063 1:151769661-151769683 GCCCGGCCACCACCCCGTCTGGG - Intronic
914954031 1:152145224-152145246 GCCCGGCCGCCACCCCATCTGGG - Intergenic
914959735 1:152195996-152196018 GCCCGGCCACCACCCCGTCTGGG - Intergenic
914965900 1:152256735-152256757 GCTCGGCCACCACCCCGTCTGGG - Intergenic
915112870 1:153575439-153575461 CCCCGGCCGCCACCCCGTCTGGG + Intergenic
915208461 1:154287883-154287905 GCCCGGCCACCACCCCGTCTGGG + Intergenic
915411079 1:155701150-155701172 GCCCGGCCACCACCCCGTCTGGG + Intronic
915426951 1:155834949-155834971 GCCCGGCCACCACCCCGTCTGGG + Intronic
915992593 1:160532127-160532149 GCCCAGCCACCACCCCATCTGGG + Intergenic
916087374 1:161281364-161281386 GCCCGGCCACCACCCCATCTGGG - Intronic
916105082 1:161423771-161423793 GCCCGGCCACCACCCCGTCTGGG + Intergenic
916223484 1:162466288-162466310 GCCCGGCCACCACCCCGTCTGGG + Intergenic
916320510 1:163499043-163499065 GCCCGGCCGCCACCCCATCTGGG - Intergenic
916756076 1:167771596-167771618 GCCCGGCCACCACCCCGTCTGGG - Intronic
917006309 1:170419351-170419373 GCCCGGCCACCACCCCGTCTGGG + Intergenic
917126534 1:171693660-171693682 GCCCGGCCACCACCCCATCTGGG - Intergenic
917304768 1:173613741-173613763 ACCCGGCCACCACCCCGTCTGGG + Intronic
917375530 1:174348981-174349003 GCCCGGCCACCACCCCGTCTGGG - Intronic
917553398 1:176058239-176058261 GCCCGGCCACCACCCCGTCTGGG + Intronic
917582726 1:176395795-176395817 GCCCGGCCACCACCCCGTCTGGG - Intergenic
917848198 1:179040255-179040277 GCCCGGCCACCACCCCGTCTGGG - Intronic
917860162 1:179136181-179136203 GCCCGGCCACCACCCCGTCTGGG + Intronic
917889015 1:179418512-179418534 GCCCGGCCACCACCCCGTCTGGG - Intronic
918221362 1:182439780-182439802 GCCCGGCCACCACCCCGTCTGGG - Intergenic
918228499 1:182509209-182509231 GCCCGGCCACCACCCCGTCTGGG - Intronic
918254991 1:182741077-182741099 GCCCGGCCACCACCCCGTCTGGG - Intergenic
919079891 1:192856754-192856776 GCCCGGCCGCCACCCCATCTGGG + Intergenic
919080290 1:192857856-192857878 GCCCGGCCACCACCCCGTCTGGG + Intergenic
919423976 1:197406047-197406069 GCCCGGCCACCACCCCGTCTGGG + Intronic
919959361 1:202451693-202451715 GCCCGGCCACCACCCCGTCTGGG - Intronic
919994864 1:202739997-202740019 GCCCGGCCACCACCCCGTCTGGG - Intronic
920152129 1:203919088-203919110 GCCCGGCCACCACCCCGTCTGGG - Intergenic
921060904 1:211583747-211583769 CCACCACCCCCACGCCATCACGG + Intergenic
921192696 1:212724654-212724676 GCCCGGCCGCCACCCCATCTGGG + Intergenic
921198059 1:212779043-212779065 GCCCGGCCACGACCCCATCTAGG + Intronic
921237684 1:213150836-213150858 GCCCGGCCACCACCCCGTCTGGG - Intronic
921413972 1:214869123-214869145 GCCCGGCCACCACCCCGTCTGGG - Intergenic
921638273 1:217523696-217523718 GCCCGGCCACCACCCCGTCTGGG - Intronic
921813960 1:219545412-219545434 GCCCGGCCGCCACCCCATCTGGG + Intergenic
921902582 1:220466206-220466228 GCCCGGCCACCACCCCGTCTGGG - Intergenic
922102368 1:222487408-222487430 GCCCGGCCACCACCCCGTCTGGG + Intergenic
922503704 1:226114822-226114844 GCCCGGCCACCACCCCGTCTGGG - Intergenic
922633007 1:227133435-227133457 GCCCGGCCACGACCCCATCTGGG + Intronic
922692964 1:227710525-227710547 GCCCGGCCACCACCCCGTCTGGG - Intergenic
922992994 1:229931839-229931861 GCCCGGCCACCACCCCGTCTGGG - Intergenic
923267929 1:232331827-232331849 GCCCGGCCACCATCCCATCTAGG + Intergenic
923793118 1:237127971-237127993 GCCCGGCCGCCACCCCATCTGGG - Intronic
924178313 1:241415710-241415732 GCCCGGCCACCACCCCGTCTGGG + Intergenic
924692347 1:246363392-246363414 GCCCGGCCACCACCCCGTCTGGG + Intronic
924766156 1:247032761-247032783 GCCCGGCCACCACCCCGTCTGGG + Intergenic
924943750 1:248830452-248830474 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1063160109 10:3412759-3412781 CCACGGCAGCCACACCACCTCGG - Intergenic
1063438818 10:6055726-6055748 GCCCGGCCACCACCCCGTCTGGG - Intronic
1063459513 10:6206475-6206497 GCCCGGCCACCACCCCGTCTGGG - Intronic
1063459668 10:6207024-6207046 GCCCGGCCGCCACCCCATCTGGG - Intronic
1063547104 10:6992018-6992040 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1064108183 10:12519010-12519032 GCCCGGCCACCACCCCGTCTGGG - Intronic
1064108986 10:12522720-12522742 GCCCGGCCACCACCCCGTCTGGG - Intronic
1065012303 10:21430671-21430693 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1065336467 10:24657522-24657544 GCCCGGCCACCACCCCGTCTGGG + Intronic
1065724309 10:28655119-28655141 GCCCGGCCACCACCCCGTCTTGG + Intergenic
1065840315 10:29696517-29696539 TCCCGGCCACCATCCCATCTAGG + Intronic
1065840588 10:29697288-29697310 GCCCGGCCACCACCCCGTCTGGG + Intronic
1065960700 10:30732053-30732075 CCAAGGCCACCACCCCATCACGG - Intergenic
1066026253 10:31362634-31362656 GCCCGGCCACCGCACCATCTGGG - Intronic
1066088664 10:31996198-31996220 ACAAGGCCACAAGGCCATCTGGG - Intergenic
1066140447 10:32500124-32500146 GCCCGGCCACCACCCCATCTGGG - Intronic
1066140533 10:32500361-32500383 GCCCCGCCACCACCCCATCTGGG - Intronic
1066140601 10:32500633-32500655 GCCCGGCCGCCACCCCATCTTGG - Intronic
1066141230 10:32506058-32506080 GCCCGGCCGCCACCCCATCTAGG - Intronic
1066141298 10:32506325-32506347 GCCCGGCCACCACCCCATCTAGG - Intronic
1066437322 10:35406752-35406774 GCCCGGCCACCACCCCGTCTGGG - Intronic
1066952855 10:42138108-42138130 TCCCGGCCACCATCCCATCTAGG + Intergenic
1066952974 10:42138472-42138494 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1067026613 10:42847807-42847829 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1067086587 10:43243474-43243496 ACCCGGCCGCCACCCCATCTGGG + Intronic
1067117360 10:43446200-43446222 GCCCGGCCACCACCCCGTCTGGG - Intronic
1067117443 10:43446471-43446493 GCCCGGCCACCACCCCATCTGGG - Intronic
1067119852 10:43464892-43464914 GCCCGGCCACCACCCCGTCTGGG - Intronic
1067325128 10:45259839-45259861 TCCCGGCCACCATCCCATCTAGG + Intergenic
1067325352 10:45260467-45260489 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1067333977 10:45346818-45346840 GCCCGGCCACCACCCCATCTGGG + Intergenic
1067334295 10:45348003-45348025 GCCTGGCCACCACCCCATCTGGG + Intergenic
1067334472 10:45348611-45348633 GCCCAGCCACCACCCCATCTGGG + Intergenic
1067339898 10:45392179-45392201 GCCTGGCCACCACCCCATCTGGG + Intronic
1067354654 10:45512696-45512718 GCCCGGCCACCACCCCGTCTGGG + Intronic
1067448428 10:46367069-46367091 CCAGGCCCACCACGGCCTCTGGG - Intergenic
1067636073 10:48001788-48001810 CCAGGCCCACCACGGCCTCTGGG + Intergenic
1067717055 10:48697876-48697898 CCACGGCCCCCATGTCACCTTGG + Intronic
1067872151 10:49970801-49970823 GCCCGGCCGCCACCCCATCTGGG + Intronic
1068536209 10:58243893-58243915 GCCCGGCCACCACCCCGTCTAGG + Intronic
1068668122 10:59697204-59697226 GCCCGGCCACCACCCCGTCTGGG + Intronic
1068969933 10:62948564-62948586 GCCCGGCCACGACCCCATCTGGG + Intergenic
1069052793 10:63812050-63812072 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1069365868 10:67692211-67692233 GCCCGGCCACCACCCCGTCTGGG + Intronic
1069674623 10:70238827-70238849 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1069674855 10:70239664-70239686 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1069674919 10:70239894-70239916 GCCCGGCCACCACCCCATCTGGG - Intergenic
1069675011 10:70240241-70240263 GCCCAGCCACCACCCCATCTGGG - Intergenic
1069698881 10:70407637-70407659 GCCCGGCCACCACCCCATCTGGG - Intronic
1069733066 10:70631470-70631492 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1069928748 10:71869181-71869203 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1069929064 10:71870031-71870053 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1070135574 10:73690079-73690101 TCCCGGCCACCACCCCGTCTGGG + Intronic
1070317825 10:75332998-75333020 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1070544577 10:77442352-77442374 CCCCCGCCACCTCCCCATCTAGG + Intronic
1070629622 10:78075822-78075844 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1070683969 10:78468451-78468473 GCCCGGCCACCACCCCATCTGGG - Intergenic
1070807541 10:79279278-79279300 GCCCCGCCACCACCCCATCTGGG - Intronic
1070966830 10:80535035-80535057 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1071311567 10:84348039-84348061 GCCCGGCCGCCACCCCATCTGGG - Intronic
1071616737 10:87081418-87081440 GCCCAGCCACCACCCCATCTGGG + Intronic
1072013258 10:91323011-91323033 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1072117368 10:92376904-92376926 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1072149483 10:92674253-92674275 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1072180245 10:92975091-92975113 GCCCGGCCACCATCCCATCTAGG + Intronic
1072291695 10:93970722-93970744 ACCCGGCCACGACCCCATCTGGG + Intergenic
1072481221 10:95810511-95810533 GCCCGGCCACCACCCCATCTGGG - Intronic
1072684180 10:97527970-97527992 GCCCGGCCACCACCCCGTCTGGG - Intronic
1072772530 10:98153084-98153106 ACCCGGCCACCACCCCATCTGGG + Intronic
1072949253 10:99837995-99838017 GCCCGGCCACCACCCCGTCTGGG - Intronic
1072956603 10:99892229-99892251 GCCCGGCCACCACCCCGTCTGGG + Intronic
1072980615 10:100094016-100094038 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1073000133 10:100278304-100278326 GCCCGGCCACCACCCCGTCTGGG + Intronic
1073238331 10:102036347-102036369 GCCCGGCCACCACCCCGTCTGGG + Intronic
1073385956 10:103128475-103128497 GCCCGGCCACCACCCCGTCTGGG + Intronic
1073450806 10:103607623-103607645 GCCCGGCCACCACCCCGTCTGGG + Intronic
1073594295 10:104784969-104784991 GCCCGGCCACCACCCCGTCTGGG - Intronic
1073865667 10:107801004-107801026 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1074151887 10:110766848-110766870 GCCCGGCCACCACCCCGTCTGGG - Intronic
1074367868 10:112874623-112874645 CCACCACCACCATGGCATCTTGG + Intergenic
1074981062 10:118620297-118620319 CCCCAGCCACCACCCCACCTGGG + Intergenic
1075050761 10:119181828-119181850 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1075061585 10:119260928-119260950 GCCCGGCCACCACCCCGTCTGGG - Intronic
1075128982 10:119722547-119722569 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1075136871 10:119794542-119794564 GCCCGGCCACCACCCCGTCTGGG - Intronic
1075181350 10:120214988-120215010 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1075243309 10:120798351-120798373 GCCCGGCCACCACCCCATCTAGG + Intergenic
1075407200 10:122203182-122203204 GCCCGGCCACCACCCCGTCTGGG - Intronic
1075893007 10:125970416-125970438 GCCCGGCCACCACCCCGTCTAGG - Intronic
1076314110 10:129528656-129528678 CCACGGCCACTCCGCCACCACGG - Intronic
1076914339 10:133414438-133414460 GCCCGGCCACCACCCCGTCTGGG - Intronic
1076914424 10:133414752-133414774 GCCCGGCCGCCACCCCATCTGGG - Intronic
1077577783 11:3397545-3397567 GCCCGGCCACCACGCCGTCTGGG + Intergenic
1077680682 11:4237580-4237602 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1077837050 11:5934687-5934709 GCCCGGCCACCACCCCGTCTGGG + Intronic
1077839755 11:5961224-5961246 CCCCGGCCGCCACCCCATCTGGG + Intergenic
1079020855 11:16907735-16907757 GCCCGGCCACCACCCCGTCTGGG + Intronic
1079039625 11:17050124-17050146 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1079371770 11:19859663-19859685 GCCCGGCCACCACCCCGTCTGGG - Intronic
1079479178 11:20863122-20863144 GCCCGGCCACCACCCCATCTAGG - Intronic
1080860391 11:36145477-36145499 GCCCGGCCACCACCCCGTCTGGG + Intronic
1081288569 11:41303496-41303518 GCCCGGCCGCCACCCCATCTGGG + Intronic
1081289305 11:41305375-41305397 GCCCGGCCACCACCCCGTCTGGG + Intronic
1081627508 11:44664095-44664117 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1081784559 11:45738049-45738071 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1081950103 11:47037909-47037931 GCCCGGCCACCACCCCATCTGGG - Intronic
1081956581 11:47097778-47097800 GCCCGGCCACCACCCCGTCTGGG + Intronic
1082065036 11:47892814-47892836 TCCCGGCCGCCACGCCGTCTAGG + Intergenic
1082233596 11:49798064-49798086 GCCCGGCCACCACCCCATCTGGG - Intergenic
1082258951 11:50063074-50063096 GCCCGGCCACGACCCCATCTGGG - Intergenic
1082678894 11:56144030-56144052 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1083090993 11:60200813-60200835 GCCCGGCCACCACCCCATCTGGG - Intergenic
1083091281 11:60201581-60201603 TCCCGGCCACCATCCCATCTGGG - Intronic
1083115146 11:60451869-60451891 GCCCGGCCACCACCCCGTCTGGG + Intronic
1083131097 11:60623117-60623139 GCCCGGCCACCACCCCATCTGGG + Intergenic
1083154822 11:60815828-60815850 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1083208187 11:61166280-61166302 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1083832192 11:65239774-65239796 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1083865366 11:65450804-65450826 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1083865786 11:65451943-65451965 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1083918093 11:65763255-65763277 GCCCGGCTGCCACGCCATCTGGG - Intergenic
1084049245 11:66588566-66588588 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1084140191 11:67222596-67222618 GCCCGGCCACCACCCCGTCTGGG - Intronic
1084186904 11:67477953-67477975 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1084206525 11:67598000-67598022 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1084388714 11:68861259-68861281 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1084624115 11:70295077-70295099 GCCCGGCCACCACCCCGTCTGGG - Intronic
1084745450 11:71167310-71167332 GCCCGGCCACCACCCCGTCTGGG - Intronic
1084924519 11:72502036-72502058 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1084924906 11:72503127-72503149 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1085097719 11:73774830-73774852 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1085111836 11:73896820-73896842 GCCCGGCCACCACCCCGTCTGGG - Intronic
1085116404 11:73936109-73936131 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1085116809 11:73937259-73937281 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1085288325 11:75378885-75378907 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1085448857 11:76619315-76619337 GCCTGGCCACCACCCCATCTGGG + Intergenic
1085512989 11:77097993-77098015 GCCCGGCCACCACCCCGTCTGGG - Intronic
1085563102 11:77489858-77489880 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1085716807 11:78879800-78879822 GCCCGGACACCACCCCATCTGGG + Intronic
1085754621 11:79192238-79192260 GCCCGGCCACCACCCCGTCTGGG + Intronic
1086017340 11:82182335-82182357 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1086122252 11:83316129-83316151 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1086122703 11:83317383-83317405 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1086446771 11:86878788-86878810 GCCCGGCCACCATCCCATCTAGG + Intronic
1086447145 11:86879917-86879939 GCCCGGCCACCACCCCGTCTGGG + Intronic
1086697355 11:89861070-89861092 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1086708804 11:89983417-89983439 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1086792957 11:91063960-91063982 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1086881428 11:92157452-92157474 TCCCGGCCACCATCCCATCTGGG + Intergenic
1087057023 11:93946610-93946632 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1087198106 11:95320752-95320774 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1087214694 11:95482383-95482405 TCCCGGCCACCATCCCATCTAGG + Intergenic
1088257066 11:107912370-107912392 TCCCGGCCACCATCCCATCTAGG + Intronic
1088818110 11:113435044-113435066 CCAGGGCCACCTGGCCACCTTGG - Intronic
1089420637 11:118330808-118330830 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1089520357 11:119059137-119059159 GCCCGGCCACCACCCCGTCTAGG - Intergenic
1089585406 11:119507512-119507534 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1089975766 11:122730233-122730255 CCACAGCCACCAAGCCATCTCGG - Intronic
1090181638 11:124704801-124704823 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1090323408 11:125864142-125864164 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1090327542 11:125902359-125902381 CCCCCGCCACCACCCCGTCTTGG - Intronic
1090785456 11:130044149-130044171 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1090790665 11:130090786-130090808 GCCCGGCCACCACCCCGTCTGGG - Intronic
1091586113 12:1817893-1817915 GCCCGGCCACCACCCCGTCTGGG + Intronic
1091747841 12:3003912-3003934 CCACCGCCACCACCTCAGCTGGG + Intronic
1091762245 12:3095393-3095415 GCCCGGCCACCACCCCGTCTGGG - Intronic
1092185396 12:6475328-6475350 ACCCGGCCACCACCCCGTCTGGG - Intergenic
1092331221 12:7589700-7589722 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1092591260 12:9953681-9953703 GCCCGGCCACCACCCCGTCTGGG + Intronic
1092843736 12:12565819-12565841 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1093453384 12:19340424-19340446 GCCCGGCCACCACCCCGTCTGGG + Intronic
1093927751 12:24925999-24926021 GCCCGGCCGCCACCCCATCTGGG + Intronic
1094209495 12:27874333-27874355 GCCCGGCCACCACTCCGTCTGGG + Intergenic
1094238897 12:28200797-28200819 GCCCGGCCACCACCCCGTCTGGG - Intronic
1094520384 12:31180766-31180788 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1094670241 12:32562936-32562958 GCCCGGCCACCACCCCGTCTGGG - Intronic
1094717045 12:33023215-33023237 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1095439991 12:42228883-42228905 GCCCGGCCACCACCCCGTCTGGG + Intronic
1095452848 12:42350240-42350262 GCCCGGCCACCACCCCGTCTGGG - Intronic
1095452924 12:42350551-42350573 GCCCGGCCACCACCCCGTCTAGG - Intronic
1095571330 12:43685801-43685823 GCCCGGCCACCACACCGTCTGGG + Intergenic
1095931837 12:47635452-47635474 CCTCAGACACCACCCCATCTGGG - Intergenic
1095978345 12:47955125-47955147 CCATGGCTACAACGCCATCAGGG + Intergenic
1096021892 12:48332224-48332246 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1096039251 12:48500247-48500269 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1096054744 12:48641889-48641911 TCCCGGCCGCCACCCCATCTAGG + Intergenic
1096054880 12:48642388-48642410 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1096054940 12:48642583-48642605 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1096063874 12:48724475-48724497 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1096064053 12:48725037-48725059 GCCCGGCCACCACCCCATCTGGG + Intergenic
1096092944 12:48915634-48915656 GCCCGGCCACCACCCCGTCTGGG - Intronic
1096146659 12:49283508-49283530 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1096167202 12:49436165-49436187 GCCCGGCCACCACCCCGTCTGGG - Intronic
1096167661 12:49437415-49437437 GCCCGGCCACCACCCCGTCTGGG - Intronic
1096225154 12:49861456-49861478 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1096557139 12:52410162-52410184 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1096660756 12:53122855-53122877 GCCCGGCCACCACCCCGTCTGGG - Intronic
1096856481 12:54488004-54488026 GCCCGGCCACCACCCCATCTGGG - Intergenic
1096951501 12:55478985-55479007 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1096968754 12:55648745-55648767 GCCCGGCCGCCACCCCATCTAGG - Intergenic
1097028412 12:56075618-56075640 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1097089687 12:56494950-56494972 GCCCAGCCACCACCCCATCTAGG - Intergenic
1097126806 12:56783164-56783186 GCCCGGCCACCACCCCGTCTGGG - Intronic
1097127761 12:56788979-56789001 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1097149016 12:56963256-56963278 GCCCGGCCACCACCCCATCTGGG + Intergenic
1097149254 12:56963995-56964017 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1097228519 12:57495028-57495050 GCCCGGCCGCCACCCCATCTGGG - Intronic
1097254703 12:57664880-57664902 GCCCGGCCGCCACCCCATCTAGG + Intergenic
1097254797 12:57665262-57665284 GCCCGGCCACCACCCCCTCTGGG + Intergenic
1097779469 12:63686567-63686589 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1097779616 12:63687059-63687081 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1098370836 12:69759506-69759528 GCCCGGCCACCACCCCGTCTGGG - Intronic
1099255189 12:80307330-80307352 GCCCGGCCACCACCCCGTCTGGG - Intronic
1099971424 12:89504078-89504100 GCCCGGCCACCACCCCATCTGGG + Intronic
1100507353 12:95235180-95235202 GCCCGGCCACCACCCCGTCTGGG - Intronic
1100577498 12:95907346-95907368 GCCCGGCCACCACCCCGTCTGGG - Intronic
1100606817 12:96158373-96158395 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1100845644 12:98655352-98655374 GCCCGGCCACCACCCCGTCTGGG - Intronic
1100994900 12:100294051-100294073 GCCCGGCCACCACCCCGTCTGGG - Intronic
1101393322 12:104323326-104323348 GCCCGGCCACCACCCCTTCTGGG - Intronic
1101885314 12:108656445-108656467 ACCCGGCCACCACCCCATCCGGG + Intronic
1102174549 12:110866841-110866863 GCCCGGCCACCACCCCGTCTGGG - Intronic
1102268379 12:111507632-111507654 GCCCGGCCACCACCCCGTCTGGG + Intronic
1102293788 12:111722908-111722930 GCCCGGCCACCACCCCGTCTGGG - Intronic
1102323228 12:111957037-111957059 TCCCGGCCACCACCCCGTCTAGG + Intronic
1102323463 12:111957747-111957769 GCCCGGCCACCACCCCGTCTGGG + Intronic
1102459771 12:113093303-113093325 CCACGCTCACCAGCCCATCTCGG - Intronic
1102496305 12:113321451-113321473 CCAAGGCCACCATACCCTCTGGG + Intronic
1102578861 12:113873151-113873173 GCCCGGCCACCACCCCGTCTGGG + Intronic
1102656230 12:114484781-114484803 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1103234363 12:119360056-119360078 GCCCGGCCACCACCCCGTCTGGG - Intronic
1103299639 12:119918328-119918350 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1103350176 12:120278366-120278388 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1103350199 12:120278446-120278468 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1103413966 12:120732158-120732180 GCCCGGCCACCACCCCGTCTGGG - Intronic
1103457452 12:121077097-121077119 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1103535977 12:121634213-121634235 GCCCGGCCACCACCCCGTCTGGG - Intronic
1103591559 12:121994429-121994451 GCCCGGCCACCACCCCGTCTGGG + Intronic
1103641893 12:122357910-122357932 GCCCGGCCACCACCCCGTCTGGG + Intronic
1103682880 12:122708778-122708800 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1103872742 12:124102529-124102551 GCCCGGCCACCACCCCGTCTGGG - Intronic
1104029343 12:125053450-125053472 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1104712417 12:130996299-130996321 GCCCGGCCACCACCCCGTCTGGG - Intronic
1104861397 12:131926257-131926279 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1104943375 12:132405077-132405099 CCACGGCCATCGCGGCATCATGG - Intergenic
1105248564 13:18674178-18674200 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1105408528 13:20151057-20151079 CCACCCACACCACCCCATCTGGG - Intronic
1105526908 13:21186239-21186261 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1105556212 13:21448689-21448711 GCCCGGCCACCACCCCGTCTGGG + Intronic
1105692762 13:22858930-22858952 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1105921677 13:24970196-24970218 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1105980254 13:25512403-25512425 GCCCGGCCACCACCCCGTCTGGG - Intronic
1106104906 13:26724287-26724309 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1106495461 13:30270393-30270415 GCCCGGCCACCACCCCGTCTGGG + Intronic
1106559900 13:30839106-30839128 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1106680061 13:31999929-31999951 GCACGGCCGCCATCCCATCTAGG + Intergenic
1106680291 13:32000595-32000617 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1106746714 13:32716069-32716091 GCCCGGCCACCACCCCGTCTGGG + Intronic
1106747101 13:32717162-32717184 GCCAGGCCACCACCCCATCTGGG + Intronic
1106747551 13:32721164-32721186 GCCCAGCCACCACGCCGTCTGGG - Intronic
1106747691 13:32721558-32721580 ACCCGGCCGCCACCCCATCTGGG - Intronic
1106885659 13:34181597-34181619 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1106918925 13:34541440-34541462 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1107042866 13:35967299-35967321 GCCCGGCCGCCACCCCATCTGGG + Intronic
1107165798 13:37280294-37280316 GCCCGGCCACGACCCCATCTGGG + Intergenic
1107166027 13:37280859-37280881 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1107493451 13:40901367-40901389 GCACGGCCACCACCCCGTCTGGG + Intergenic
1107499202 13:40956044-40956066 GCCCGGCCACCACCCCGTCTGGG + Intronic
1107562679 13:41572029-41572051 GCCCGACCACCACCCCATCTGGG + Intronic
1107692536 13:42966750-42966772 GCCCGGCCACCACCCCGTCTGGG + Intronic
1107737807 13:43416797-43416819 GCCCGGCCGCCACCCCATCTAGG - Intronic
1107863394 13:44682286-44682308 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1108330653 13:49379167-49379189 GCCCGGCCACCACCCCGTCTGGG + Intronic
1108341843 13:49504686-49504708 GCCCGGCCACCACCCCGTCTGGG + Intronic
1108348091 13:49565540-49565562 TCCCGGCCGCCACCCCATCTAGG + Intronic
1108351638 13:49593695-49593717 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1108370463 13:49762337-49762359 GCCCGGCCACCACTCCGTCTGGG + Intronic
1108610638 13:52080363-52080385 GCCCGGCCACCACCCCGTCTGGG + Intronic
1110269698 13:73575678-73575700 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1110922248 13:81102481-81102503 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1111079177 13:83279560-83279582 CTACGGCCACCAGGTTATCTGGG + Intergenic
1111418110 13:87976133-87976155 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1112055874 13:95690508-95690530 GCCCGGCCACCACCCCGTCTGGG - Intronic
1112056268 13:95691641-95691663 GCCCGGCCACCACCCCGTCTGGG - Intronic
1112420254 13:99242260-99242282 GCCCGGCCACCACCCCGTCTGGG - Intronic
1112590789 13:100762033-100762055 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1113194208 13:107783334-107783356 GCCCGGCCACCACCCCGTCTGGG + Intronic
1113478870 13:110606181-110606203 GCCTGGCCACCACCCCATCTGGG - Intergenic
1113678254 13:112223054-112223076 CCAAGCCCACCACGTCCTCTGGG - Intergenic
1114165403 14:20213243-20213265 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1114428353 14:22639456-22639478 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1114492010 14:23108452-23108474 GCCCGGCCACCACCCCGTCTAGG - Intergenic
1114508082 14:23232880-23232902 GCCCGGCCACCACCCCATCTGGG + Intronic
1114578668 14:23736738-23736760 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1114594338 14:23898556-23898578 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1115259280 14:31436932-31436954 GCCCGGCCACCACCCCGTCTGGG - Intronic
1115324984 14:32128267-32128289 GCCCGGCCGCCACCCCATCTAGG - Intronic
1115540118 14:34411982-34412004 GCCCGGCCACCACCCCATCTGGG + Intronic
1115609990 14:35039730-35039752 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1115688817 14:35824477-35824499 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1116191406 14:41673238-41673260 GCCCGGCCACCACCCCGTCTGGG - Intronic
1116409201 14:44601705-44601727 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1116480813 14:45390301-45390323 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1116871754 14:50074383-50074405 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1117010655 14:51467642-51467664 GCCCCGCCACCACCCCATCTGGG - Intergenic
1117277462 14:54204374-54204396 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1117411616 14:55456218-55456240 GCCCGGCCACCACCCCGTCTGGG - Intronic
1117597077 14:57334268-57334290 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1117716708 14:58588620-58588642 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1117763625 14:59058812-59058834 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1118148871 14:63166289-63166311 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1118184348 14:63523180-63523202 GCCCGGCCACCACCCCATCTGGG + Intronic
1118209183 14:63750941-63750963 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1118341346 14:64896270-64896292 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1118423483 14:65633545-65633567 TCCCGGCCACCATCCCATCTAGG + Intronic
1118428679 14:65692937-65692959 TCCCGGCCACCATCCCATCTAGG - Intronic
1118517367 14:66545101-66545123 GCCCGGCCACCACCCCGTCTGGG - Intronic
1118584796 14:67341656-67341678 GCCCGGCCACCACCCCGTCTGGG + Intronic
1119254150 14:73183820-73183842 GCCCGGCCACCACCCCGTCTGGG - Intronic
1119434341 14:74587956-74587978 CCACAGCCAGCAGGCCAGCTCGG - Intronic
1119700472 14:76750844-76750866 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1119722055 14:76898223-76898245 ACCCGGCCGCCACCCCATCTGGG - Intergenic
1119722112 14:76898455-76898477 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1119868444 14:77993547-77993569 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1120309737 14:82814142-82814164 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1120892786 14:89505684-89505706 GCCCGGCCACCACCCCGTCTGGG + Intronic
1120892812 14:89505800-89505822 TCCCGGCCACCATCCCATCTAGG + Intronic
1121208289 14:92187698-92187720 GCCCGGCCACCACCCCATCTGGG - Intergenic
1121306524 14:92911235-92911257 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1121531500 14:94657833-94657855 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1121531662 14:94658355-94658377 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1122212459 14:100181401-100181423 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1122238326 14:100345143-100345165 GCCCGGCCACCACCCCGTCTGGG + Intronic
1122497819 14:102172430-102172452 GCCCGGCCACCACCCCGTCTGGG - Intronic
1122591755 14:102857594-102857616 CCAGGAACCCCACGCCATCTTGG - Intronic
1122957699 14:105079122-105079144 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1122963505 14:105111305-105111327 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1202917512 14_GL000194v1_random:190391-190413 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1202917672 14_GL000194v1_random:190947-190969 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1123736999 15:23195336-23195358 CCACGGCACCCAGGCCATTTGGG - Intergenic
1124245986 15:28070634-28070656 GCCCGGCCACCACCCCGTCTGGG + Intronic
1124287697 15:28418312-28418334 CCACGGCGCCCAGGCCATTTGGG - Intergenic
1124288218 15:28424013-28424035 CCACGGCGCCCAGGCCATTTGGG - Intergenic
1124295007 15:28493314-28493336 CCACGGCGCCCAGGCCATTTGGG + Intergenic
1125017071 15:34946982-34947004 GCCCGGCCACCACCCCGTCTGGG + Intronic
1125031824 15:35082170-35082192 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1125079093 15:35655754-35655776 CCCCGGCCGCCATCCCATCTAGG + Intergenic
1125459321 15:39893626-39893648 GCCCGGCCACCACCCCGTCTGGG - Intronic
1125459758 15:39894806-39894828 GCCCGGCCACCACCCCGTCTGGG - Intronic
1125566925 15:40683719-40683741 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1125659601 15:41383506-41383528 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1125861720 15:43005563-43005585 GCCCGGCCACCACCCCGTCTGGG + Intronic
1125862985 15:43015114-43015136 GCCCGGCCACCACCCCGTCTGGG + Intronic
1125868397 15:43076389-43076411 GCACGGCCGCCACCCCGTCTGGG + Intronic
1125877911 15:43167058-43167080 GCCCGGCCACCACCCCGTCTGGG - Intronic
1126125631 15:45292932-45292954 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1126516924 15:49549842-49549864 GCCCGGCCACCACCCCGTCTGGG - Intronic
1126571680 15:50158576-50158598 GCCCGGCCACCACCCCGTCTGGG + Intronic
1126573100 15:50172552-50172574 GCCCGGCCGCCACCCCATCTGGG + Intronic
1126691806 15:51294238-51294260 TCCCGGCCACCATCCCATCTAGG + Intronic
1126691999 15:51294793-51294815 GCCCGGCCACCACCCCGTCTGGG + Intronic
1126799348 15:52285878-52285900 GCCCGGCCGCCACCCCATCTGGG + Intronic
1126799524 15:52286412-52286434 GCCCGGCCACCACCCCGTCTGGG + Intronic
1127023836 15:54781411-54781433 GCCCGGCCACGACCCCATCTGGG - Intergenic
1127072835 15:55302599-55302621 GCCCGGCCACCATCCCATCTAGG + Intronic
1127088426 15:55445800-55445822 GCCCGGCCGCCACCCCATCTGGG - Intronic
1127088502 15:55446062-55446084 GCCCGGCCGCCACCCCATCTGGG - Intronic
1127088663 15:55446638-55446660 GCCCGGCCGCCACCCCATCTGGG - Intronic
1127154635 15:56111119-56111141 GCCCGGCCACCACCCCGTCTGGG + Intronic
1127782807 15:62332097-62332119 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1128071240 15:64798943-64798965 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1128489581 15:68134257-68134279 GCCCGGCCACCACCCCGTCTGGG - Intronic
1128490295 15:68135992-68136014 TCCCGGCCACCATCCCATCTAGG - Intronic
1128500050 15:68221639-68221661 GCCCGGCCGCCACCCCATCTAGG + Intronic
1128597256 15:68964198-68964220 GCCCGGCCACCACCCCGTCTGGG - Intronic
1128970649 15:72101960-72101982 GCCCGGCCACCACCCCGTCTGGG + Intronic
1129008926 15:72397116-72397138 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1129053982 15:72806849-72806871 GCCCGGCCACCACCCCATCTGGG - Intergenic
1129313879 15:74729291-74729313 GCCCGGCCACCACCCCATCTGGG + Intergenic
1129341253 15:74888323-74888345 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1129428674 15:75481929-75481951 GCCCGGCCACCACCCCGTCTGGG + Intronic
1129431127 15:75503045-75503067 GCCCGGCCACCACCCCGTCTGGG + Intronic
1129438240 15:75559244-75559266 GCCCGGCCACCACCCCGTCTGGG + Intronic
1129812267 15:78520761-78520783 GCCCGGCCACCACCCCATCTGGG - Intronic
1130340572 15:82997725-82997747 GCCCGGCCACCACCCCGTCTGGG - Intronic
1130428131 15:83821765-83821787 GCCCGGCCACCACCCCGTCTGGG - Intronic
1130428425 15:83822625-83822647 TCCCGGCCACCATCCCATCTAGG - Intronic
1130428462 15:83822781-83822803 GCCCGGCCGCCACCCCATCTGGG - Intronic
1130946106 15:88552246-88552268 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1130946825 15:88554065-88554087 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1131001137 15:88941271-88941293 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1131056766 15:89379448-89379470 CCACGGCCCGCTCGCCATTTTGG - Intergenic
1131125692 15:89854998-89855020 GCCCGGCCACCACCCCGTCTGGG + Intronic
1131127675 15:89869042-89869064 GCCCGGCCACCACCCCGTCTGGG + Intronic
1131479195 15:92767995-92768017 GCCCGGCCACCACCCCGTCTGGG - Intronic
1132777035 16:1599924-1599946 GCCCGGCCACCACCCCGTCTGGG + Intronic
1132894115 16:2219858-2219880 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1132921764 16:2399834-2399856 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1132992164 16:2801863-2801885 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1133659572 16:7903277-7903299 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1133680483 16:8115394-8115416 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1133751936 16:8732744-8732766 GCCCGGCCACCACCCCGTCTGGG - Intronic
1133787130 16:8982194-8982216 GCCCGGCCGCCACGCCGTCTGGG + Intergenic
1134082610 16:11335607-11335629 GCCCGGCCACCACCCCGTCTGGG - Intronic
1134750077 16:16618916-16618938 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1134995398 16:18734723-18734745 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1135026588 16:19003503-19003525 GCCCGGCCACCACCCCGTCTGGG + Intronic
1135639511 16:24108875-24108897 GCCCGGCCACCACCCCGTCTGGG - Intronic
1136426399 16:30170384-30170406 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1136583680 16:31169774-31169796 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1136593786 16:31232891-31232913 GCCCGGCCACCACTCCGTCTGGG + Intergenic
1136611454 16:31369130-31369152 GCCCGGCCACCACCCCGTCTGGG - Intronic
1136668696 16:31836869-31836891 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1137240714 16:46653183-46653205 GCCCAGCCACCACCCCATCTGGG - Intergenic
1137244855 16:46694382-46694404 GCCCGGCCACCACCCCGTCTGGG - Intronic
1137284076 16:47000762-47000784 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1137304079 16:47181654-47181676 GCCCGGCCACCACCCCATCTGGG + Intronic
1137493639 16:48952216-48952238 GCCCGGCCACCACCCCTTCTGGG + Intergenic
1137523044 16:49210517-49210539 GCCCGGCCACGACCCCATCTGGG - Intergenic
1137732257 16:50697598-50697620 CCTCGGCCACCCCACCCTCTTGG + Intronic
1138028370 16:53539731-53539753 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1138307362 16:55989542-55989564 GCCCCGCCACCACCCCATCTGGG + Intergenic
1138400140 16:56739238-56739260 GCCCGGCCACCACCCCGTCTGGG - Intronic
1138466983 16:57200428-57200450 GCCCGGCCACCACCCCGTCTGGG - Intronic
1138642089 16:58395854-58395876 GCCCGGCCACCACCCCGTCTGGG - Intronic
1138699221 16:58846021-58846043 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1138829226 16:60358165-60358187 GCCCGGCCTCCACCCCATCTGGG - Intergenic
1139378326 16:66514643-66514665 GCCCGGCCACCACCCCGTCTGGG + Intronic
1139623083 16:68163260-68163282 GCCCGGCCACCACCCCGTCTGGG - Intronic
1139887944 16:70224691-70224713 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1140063265 16:71589480-71589502 GCCCGGCCACGACCCCATCTGGG + Intergenic
1140063344 16:71589720-71589742 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1140092579 16:71850345-71850367 CCTCTGCCACCTCCCCATCTGGG + Exonic
1140882592 16:79212161-79212183 CCACGGCCACCACTGCAGCCGGG + Exonic
1140994497 16:80244280-80244302 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141728822 16:85808561-85808583 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1141785018 16:86193649-86193671 CCTCAGCCACCTCGCCATCCAGG + Intergenic
1141943256 16:87292662-87292684 CCAAGGACACCATCCCATCTGGG + Intronic
1142332460 16:89463145-89463167 GCCCGGCCACCACCCCGTCTGGG + Intronic
1142391913 16:89806872-89806894 ACCCGGCCACCACCCCGTCTGGG - Intronic
1142533520 17:598370-598392 GCCCGGCCACCACCCCGTCTGGG + Intronic
1142634204 17:1247046-1247068 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1142704931 17:1689098-1689120 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1142825554 17:2507598-2507620 GCCCGGCCACCACCCCGTCTGGG + Intronic
1142913054 17:3112360-3112382 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1142949405 17:3465250-3465272 GCCCGGCCACCACCCCGTCTGGG + Intronic
1142963170 17:3564202-3564224 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1142974193 17:3633739-3633761 GCCCGGCCACCACCCCGTCTGGG + Intronic
1142978004 17:3656615-3656637 GCCGGGCCACCACGCCATGTGGG - Intronic
1143115232 17:4578330-4578352 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1143136651 17:4716142-4716164 CCACAAGCACCACGCCATCTAGG - Exonic
1143206449 17:5143226-5143248 GCCCGGCCACCACCCCGTCTGGG + Intronic
1143277257 17:5721368-5721390 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1143342722 17:6226153-6226175 TCCCGGCCACCATCCCATCTAGG + Intergenic
1143342843 17:6226550-6226572 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1143689718 17:8550612-8550634 GCCCGGCCACCACCCCGTCTGGG + Intronic
1144482225 17:15637719-15637741 GCCCGGCCACCACCCCGTCTGGG + Intronic
1144524555 17:15979511-15979533 GCCCGGCCACCACCCCGTCTGGG - Intronic
1144536571 17:16095797-16095819 GCCCGGCCACCACCCCGTCTGGG + Intronic
1144541255 17:16145308-16145330 GCCCGGCCACCACCCCATCTGGG + Intronic
1144559706 17:16311980-16312002 GCCCGGCCACCACCCCGTCTGGG - Intronic
1144716825 17:17442182-17442204 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1144798907 17:17912177-17912199 GCCCGGCCACCACCCCGTCTGGG - Intronic
1144860320 17:18297832-18297854 GCCCGGCCGCCACCCCATCTGGG + Intronic
1144934649 17:18888369-18888391 GCCCGGCCACCACCCCGTCTGGG - Intronic
1145022385 17:19441880-19441902 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1145027129 17:19476173-19476195 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1145158368 17:20557493-20557515 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1145174294 17:20685561-20685583 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1145206308 17:20985670-20985692 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1145418267 17:22741659-22741681 GCCCGGCCACCACCCCATCTGGG + Intergenic
1145684633 17:26639318-26639340 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1145863193 17:28224750-28224772 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1145895578 17:28455933-28455955 GCCCGGCCACCACCCCGTCTGGG - Intronic
1145896243 17:28459236-28459258 GCCCGGCCACCACCCCGTCTGGG + Intronic
1145920312 17:28604685-28604707 TCCCGGCCACCATCCCATCTAGG - Intronic
1145927579 17:28659389-28659411 GCCCGGCCGCCACCCCATCTGGG - Intronic
1146048785 17:29532868-29532890 GCCCGGCCACCACCCCGTCTGGG - Intronic
1146048963 17:29533427-29533449 GCCCGGCCGCCACCCCATCTGGG - Intronic
1146155967 17:30523688-30523710 GCCTGGCCACCACCCCATCTGGG + Exonic
1146157636 17:30536936-30536958 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1146187713 17:30736250-30736272 TCCCGGCCACCACCCCATCTGGG - Intergenic
1146361202 17:32178866-32178888 GCCCGGCCGCCACCCCATCTGGG + Intronic
1146695707 17:34907743-34907765 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1146731198 17:35194999-35195021 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1147109790 17:38253492-38253514 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1147172931 17:38631741-38631763 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1147220955 17:38930529-38930551 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1147277806 17:39333554-39333576 GCCCGGCCGCCACCCCATCTAGG + Intronic
1147278332 17:39337395-39337417 GCCCGGCCGCCACCCCATCTGGG + Intronic
1147278534 17:39338009-39338031 GCCCGGCCACCACCCCGTCTGGG + Intronic
1147709141 17:42449503-42449525 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1147851996 17:43450875-43450897 TCCCGGCCACCATCCCATCTAGG + Intergenic
1147963658 17:44181298-44181320 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1147974108 17:44237938-44237960 TCCCGGCCACCATCCCATCTAGG + Intergenic
1147974546 17:44239058-44239080 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1148267472 17:46238101-46238123 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1148277370 17:46317134-46317156 GCCCGGCCGCCACCCCATCTGGG - Intronic
1148404482 17:47398333-47398355 GCCCGGCCACCACCCCGTCTGGG + Intronic
1148406617 17:47421116-47421138 GCCCGGCCACCACCCCGTCTGGG + Intronic
1148672201 17:49419610-49419632 GCCCGGCCACCACCCCATCTGGG - Intronic
1148672261 17:49419801-49419823 GCCCGGCCGCCACCCCATCTGGG - Intronic
1148672325 17:49420030-49420052 GCCCGGCCACCACCCCGTCTAGG - Intronic
1149593082 17:57846388-57846410 GCCCGGCCGCCACCCCATCTGGG + Intronic
1149632934 17:58142238-58142260 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1149793751 17:59500621-59500643 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1149909283 17:60552344-60552366 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1150056396 17:62021211-62021233 GCCCGGCCACCACCCCGTCTGGG - Intronic
1150380651 17:64716822-64716844 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1150403028 17:64874569-64874591 GCCCGGCCGCCACCCCATCTGGG + Intronic
1150477153 17:65484232-65484254 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1150477291 17:65484707-65484729 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1150527483 17:65937889-65937911 GCCCGGCCACCACCCCATCTGGG + Intronic
1150557847 17:66269443-66269465 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1150703924 17:67470674-67470696 GCCCGGCCACCACCCCGTCTGGG + Intronic
1150894719 17:69196599-69196621 GCCCGGCCGCCACCCCATCTGGG - Intronic
1151814209 17:76463142-76463164 CCACGGCCCCCACCCCATCCCGG - Intronic
1151843793 17:76636742-76636764 GCCCGGCCGCCACCCCATCTGGG + Intronic
1152129219 17:78465902-78465924 GCCCGGCCACCACCCCGTCTGGG + Intronic
1152430792 17:80247365-80247387 GCCCGGCCACCACCCCGTCTGGG - Intronic
1152478922 17:80537371-80537393 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1152672791 17:81618676-81618698 GCCCGGCCACCACCCCGTCTGGG + Intronic
1152810033 17:82376936-82376958 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1153243245 18:3049888-3049910 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1153634185 18:7098939-7098961 GCCCGGCCACCACCCCGTCTGGG + Intronic
1153843051 18:9024141-9024163 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1154115922 18:11613405-11613427 GCCCGGCCGCCACCCCATCTAGG + Intergenic
1154116048 18:11613879-11613901 GCCCGGCCGCCACCCCATCTAGG + Intergenic
1154120458 18:11647911-11647933 GCCCAGCCACCACCCCATCTTGG + Intergenic
1154398103 18:14010480-14010502 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1154398428 18:14011437-14011459 GCCCGGCCACCACCGCATCTGGG - Intergenic
1154420273 18:14223044-14223066 GCCTGGCCACCACCCCATCTAGG + Intergenic
1154943499 18:21137795-21137817 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1154990057 18:21592193-21592215 GCCCGGCCACCACCCCGTCTGGG - Intronic
1155956783 18:31961108-31961130 GCCCGGCCACCACCCCATCTGGG + Intergenic
1157629157 18:49079927-49079949 GCCCGGCCACCACCCCGTCTGGG - Intronic
1157640049 18:49203325-49203347 GCCCGGCCACCACCCCGTCTGGG + Intronic
1157677148 18:49577540-49577562 GCCCGGCCACCACCCCGTCTGGG - Intronic
1157677537 18:49578609-49578631 GCCCGGCCGCCACCCCATCTGGG - Intronic
1157705210 18:49800053-49800075 GCCCGGCAACCACGCCATCCGGG + Intronic
1157705351 18:49800368-49800390 GCCCGGCCACCACCCCGTCTGGG + Intronic
1158148882 18:54344045-54344067 GCCCGGCCACCACCCCGTCTGGG + Intronic
1158459152 18:57632601-57632623 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1159157994 18:64608850-64608872 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1159324273 18:66894392-66894414 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1159340378 18:67126709-67126731 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1160108361 18:76001383-76001405 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1160182277 18:76645925-76645947 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1160228324 18:77028513-77028535 GCCCGGCCACCACCCCGTCTGGG - Intronic
1160465535 18:79073099-79073121 TCCCGGCCGCCACCCCATCTAGG - Intronic
1160508854 18:79442180-79442202 CCACGGCAAGCACGGCCTCTGGG + Intronic
1161790153 19:6355348-6355370 GCCTGGCCACCACCCCATCTAGG + Intergenic
1162255266 19:9483765-9483787 GCCCGGCCGCCACCCCATCTGGG + Intronic
1162279074 19:9680396-9680418 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1162602184 19:11677347-11677369 TCCCGGCCACCATCCCATCTAGG - Intergenic
1162695185 19:12468165-12468187 GCCCGGCCACCACCCCGTCTGGG + Intronic
1162714560 19:12621827-12621849 GCCCGGCCACCACCCCGTCTGGG + Intronic
1163469028 19:17486302-17486324 CCAGGGCCACCAAGCCAGCTGGG + Intronic
1163482069 19:17562736-17562758 CCACGGCCCCCACCCCATGCAGG - Intronic
1163542464 19:17918962-17918984 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1163558373 19:18005513-18005535 GCCCGGCCACCACCCCGTCTGGG - Intronic
1163896424 19:20064363-20064385 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1163904238 19:20137687-20137709 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1163904354 19:20138080-20138102 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1163905561 19:20149296-20149318 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1163906394 19:20152554-20152576 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1163909346 19:20175854-20175876 GCCCGGCCACCACCCCATCTGGG - Intronic
1163921835 19:20296686-20296708 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1163945133 19:20529605-20529627 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1164012230 19:21213027-21213049 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1164016400 19:21259493-21259515 GCCCGGCCGCCACCCCATCTGGG - Intronic
1164016545 19:21260061-21260083 GCCTGGCCACCACCCCATCTGGG - Intronic
1164016756 19:21260901-21260923 GCCCGGCCGCCACCCCATCTGGG - Intronic
1164016781 19:21260978-21261000 GCCCGGCCGCCACCCCATCTGGG - Intronic
1164040153 19:21486848-21486870 GCCCGGCCACCACCCCGTCTGGG - Intronic
1164043118 19:21511103-21511125 GCCCGGCCACCACCCCGTCTGGG - Intronic
1164046878 19:21551179-21551201 GCCCGGCCACCACCCCATCTGGG - Intronic
1164054016 19:21607040-21607062 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1164065084 19:21708164-21708186 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1164071745 19:21775603-21775625 ACCCGGCCACCACCCCGTCTGGG + Intergenic
1164071888 19:21776121-21776143 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1164081480 19:21865268-21865290 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1164081919 19:21866454-21866476 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1164105558 19:22106631-22106653 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1164168209 19:22700875-22700897 GCCCGGCCGCCACGCCGTCTGGG - Intergenic
1164186087 19:22871374-22871396 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1164217319 19:23161237-23161259 TCCCGGCCACCACCCCGTCTAGG - Intergenic
1164218719 19:23173489-23173511 GCCCGGCCACCACCCCATCTGGG + Intergenic
1164238885 19:23366090-23366112 GCCCGGCCACCACCCCGTCTGGG - Intronic
1164239297 19:23369478-23369500 GCCCGGCCACCACCCCGTCTGGG + Intronic
1164244808 19:23419707-23419729 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1164264038 19:23595180-23595202 GCCCGGCCACCACCCCGTCTGGG + Intronic
1164298344 19:23936980-23937002 GCCCGGCCACCACCCCGTCTGGG - Intronic
1164298596 19:23937731-23937753 GCCCGGCCACCACCCCATCTGGG - Intronic
1164301062 19:23963813-23963835 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1164652166 19:29898862-29898884 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1165192749 19:34079011-34079033 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1165199608 19:34133191-34133213 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1165295320 19:34921954-34921976 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1165481758 19:36068878-36068900 GCCCGGCCACCACCCCGTCTGGG - Intronic
1165768229 19:38363987-38364009 GCCCGGCCACCACCCCGTCTGGG - Intronic
1165842492 19:38797650-38797672 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1165842709 19:38798246-38798268 TCCCGGCCACCATCCCATCTAGG - Intergenic
1165852002 19:38855491-38855513 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1166114837 19:40647890-40647912 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1166163160 19:40966854-40966876 TCCCGGCCACCATCCCATCTAGG - Intergenic
1166191513 19:41179921-41179943 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1166261823 19:41645329-41645351 GCCCGGCCACCACCCCGTCTGGG + Intronic
1166421298 19:42639326-42639348 GCCCGGCCACCACCCCGTCTGGG - Intronic
1166425663 19:42676315-42676337 GCCCGGCCACCACCCCGTCTGGG - Intronic
1166640302 19:44489210-44489232 GCCCGGCCACCACCCCGTCTGGG + Intronic
1166832912 19:45648681-45648703 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1167540991 19:50086802-50086824 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1167548180 19:50141335-50141357 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1167823780 19:51953119-51953141 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1167897597 19:52593904-52593926 GCCCGGCCACCACCCCATCTGGG - Intergenic
1167913325 19:52721151-52721173 GCACGGCCGCCATCCCATCTAGG - Intronic
1167913351 19:52721267-52721289 GCCCGGCCACCACCCCATCTAGG - Intronic
1167975421 19:53222679-53222701 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1167975545 19:53223114-53223136 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1167980253 19:53269910-53269932 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1168017744 19:53587085-53587107 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1168349160 19:55666191-55666213 CCATGGTGACCAGGCCATCTTGG - Intronic
1168572766 19:57483688-57483710 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1168695918 19:58404756-58404778 GCCCGGCCACCACCCCATCTGGG - Intronic
925400559 2:3569466-3569488 GCCCGGCCACCATCCCATCTAGG - Intergenic
925400583 2:3569582-3569604 GCCCGGCCACCACCCCGTCTGGG - Intergenic
925776166 2:7338229-7338251 GCCAGGCCACCACCCCATCTGGG - Intergenic
926153753 2:10439193-10439215 CCACTGCCACTAAGCGATCTCGG + Intergenic
926215265 2:10902472-10902494 GCCCGGCCACCACCCCGTCTGGG - Intergenic
926674703 2:15611407-15611429 GCCCGGCCACCACCCCGTCTGGG - Intronic
926675111 2:15612437-15612459 TCCCGGCCACCATCCCATCTAGG - Intronic
926683264 2:15680060-15680082 GCCCGGCCACCACCCCGTCTGGG - Intergenic
927596257 2:24400674-24400696 CCTCGGCCGCCACCCCGTCTGGG - Intergenic
927737583 2:25536174-25536196 GCCCGGCCGCCACCCCATCTAGG - Intronic
927747472 2:25634528-25634550 GCCCGGCCACCACCCCGTCTGGG + Intronic
927757755 2:25723147-25723169 GCCCGGCCACCACCCCGTCTGGG - Intergenic
927833012 2:26370381-26370403 GCCCGGCCACCACCCCGTCTGGG - Intronic
927833425 2:26371447-26371469 GCCCGGCCGCCACCCCATCTGGG - Intronic
927897676 2:26795222-26795244 GCCCAGCCACCACCCCATCTGGG - Intronic
927978803 2:27359711-27359733 GCCCGGCCACCACCCCGTCTGGG + Intergenic
928009449 2:27594248-27594270 GCCCGGCCACCACCCCGTCTGGG - Intronic
928009580 2:27594717-27594739 GCCCGGCCGCCACCCCATCTAGG - Intronic
928597506 2:32870004-32870026 GCCCGGCCACCACCCCGTCTGGG + Intergenic
928687235 2:33761657-33761679 TCCCGGCCACCACCCCGTCTAGG - Intergenic
928889016 2:36180632-36180654 GCCCGGCCACCACCCCGTCTGGG + Intergenic
929061870 2:37932585-37932607 GCCCGGCCACCACCCCGTCTGGG - Intronic
929066034 2:37977362-37977384 GCCCGGCCACCACCCCGTCTGGG - Intronic
929066197 2:37977907-37977929 GCCCGGCCGCCACCCCATCTAGG - Intronic
929151838 2:38755776-38755798 GCCCGGCCACCACCCCGTCTGGG - Intronic
929416556 2:41748168-41748190 GCCCGGCCACCACCCCGTCTGGG + Intergenic
929445201 2:41995650-41995672 GCCCGGCCACCACCCCGTCTGGG + Intergenic
929515765 2:42605106-42605128 GCCCGGCCACCACCCCATCTGGG - Intronic
929577693 2:43063040-43063062 GCCCGGCCACCACCCCGTCTGGG - Intergenic
929614812 2:43298069-43298091 GCCCGGCCACCACCCCGTCTGGG + Intronic
929650708 2:43677721-43677743 GCCCGGCCACCACCCCGTCTTGG - Intronic
929690031 2:44066869-44066891 GCCCGGCCACCACCCCATCTGGG - Intergenic
930079054 2:47432937-47432959 GCCCGGCCACCACCCCGTCTGGG - Intronic
930208699 2:48614357-48614379 GCCCGGCCACCACCCCGTCTGGG - Intronic
930363542 2:50411435-50411457 GCCCGGCCACCACCCCGTCTAGG + Intronic
930396249 2:50828128-50828150 GCCCGGCCACCACCCCGTCTGGG - Intronic
930665294 2:54095407-54095429 GCCCGGCCACCACCCCGTCTGGG - Intronic
930703863 2:54485600-54485622 GCCCGGCCGCCACCCCATCTGGG + Intronic
930727943 2:54699286-54699308 TCCCGGCCACCACCCCATCTGGG + Intergenic
930821582 2:55651246-55651268 GCCCGGCCACCACCCCGTCTGGG + Intronic
930834051 2:55774328-55774350 GCCCGGCCACCACCCCGTCTGGG - Intergenic
931479875 2:62630221-62630243 TCCCGGCCACCATCCCATCTAGG + Intergenic
931604789 2:64041852-64041874 GCCCGGCCACCACCCCGTCTGGG - Intergenic
931604799 2:64041892-64041914 TCCCGGCCACCATCCCATCTAGG - Intergenic
932063020 2:68527444-68527466 GCCCGGCCTCCACCCCATCTGGG - Intronic
932367392 2:71161551-71161573 GCCCGGCCACCACCCCGTCTGGG + Intergenic
932571833 2:72942321-72942343 CCACGGCCAGCTTGACATCTTGG + Exonic
932710563 2:74061037-74061059 GCCCGGCCACCACCCCGTCTGGG - Intronic
932718845 2:74123666-74123688 GCCCGGCCACCACCCCGTCTGGG + Intergenic
932903390 2:75724988-75725010 GCCCGGCCGCCACGCCGTCTGGG + Intergenic
932903455 2:75725260-75725282 GCCCGGCCACCACCCCATCTGGG + Intergenic
933735246 2:85488523-85488545 GCCCGGCCACCACCCCGTCTGGG + Intergenic
933868909 2:86548836-86548858 GCCCGGCCACCACCCCATCTGGG - Intronic
933869161 2:86549666-86549688 GCCCGGCCGCCACCCCATCTGGG - Intronic
934309896 2:91852456-91852478 GCCCGGCCACCACCCCATCTGGG + Intergenic
934549146 2:95243814-95243836 GCCCGGCCACCACCCCGTCTGGG + Intronic
934703873 2:96462573-96462595 GCCCGGCCACCACCCCGTCTGGG + Intergenic
934752964 2:96805970-96805992 GCCCGGCCACCACCCCGTCTGGG - Intronic
935991959 2:108727156-108727178 GCCCGGCCACCACCCCGTCTGGG - Intronic
936504685 2:113096383-113096405 GCCCGGCCACCACCCCGTCTGGG - Intergenic
936546623 2:113395476-113395498 GCCCGGCCACCACCCCGTCTGGG + Intergenic
937168364 2:119843512-119843534 GCCCGGCCACCACCCCGTCTGGG - Intronic
937734867 2:125277097-125277119 GCCCGGCCGCCACCCCATCTGGG - Intergenic
937919326 2:127119423-127119445 GCCCGGCCACCACCCCGTCTGGG - Intergenic
937919670 2:127120425-127120447 GCCCGGCCACCACCCCGTCTGGG - Intergenic
937947579 2:127353714-127353736 GCCCGGCCACCACCCCGTCTGGG + Intronic
938005522 2:127787380-127787402 GCCCGGCCACCACCCCGTCTGGG - Intronic
938253461 2:129833785-129833807 GCCCGGCCACCACCCCGTCTGGG + Intergenic
938720768 2:134064439-134064461 GCCCGGCCACCACCCCGTCTGGG + Intergenic
938821885 2:134968382-134968404 GCCCGGCCACCACCCCGTCTGGG - Intronic
938828761 2:135033136-135033158 GCCCGGCCACCACCCCGTCTGGG - Intronic
938829160 2:135034198-135034220 TCCCGGCCACCATCCCATCTAGG - Intronic
938836137 2:135105641-135105663 GCCCGGCCGCCACCCCATCTGGG + Intronic
938891153 2:135706900-135706922 GCCCGGCCACCACCCCGTCTGGG - Intronic
939186944 2:138872228-138872250 GCCCGGCCACCACCCCGTCTGGG - Intergenic
939477334 2:142702771-142702793 GCCCGGCCACCACCCCGTCTGGG + Intergenic
939578354 2:143921831-143921853 GCCCGGCCACCACCCCATCTGGG - Intergenic
939578682 2:143922682-143922704 GCCCGGCCACCATCCCATCTAGG - Intergenic
939821241 2:146959281-146959303 CCCCAGCCCCCACCCCATCTTGG - Intergenic
940269483 2:151875516-151875538 GCCCGGCCACCACCCCGTCTGGG - Intronic
940299341 2:152160969-152160991 GCCCGGCCACCACCCCGTCTGGG + Intronic
940635649 2:156293787-156293809 GCCCGGCCACCACCCCGTCTGGG + Intergenic
940652162 2:156451186-156451208 GCCCGGCCACCACCCCGTCTGGG - Intronic
940817279 2:158310676-158310698 GCCCGGCCGCCACCCCATCTGGG - Intronic
941023815 2:160438782-160438804 GCCCGGCCACCACCCCGTCTGGG - Intronic
941025196 2:160449299-160449321 GCCCGGCCGCCACCCCATCTGGG + Intronic
941197670 2:162470717-162470739 GCTCGGCCACCACCCCGTCTGGG + Intronic
941768634 2:169326625-169326647 GCCCGGCCACCACCCCGTCTGGG + Intronic
941786841 2:169506273-169506295 GCCCGGCCACCACCCCGTCTGGG + Exonic
941793172 2:169575033-169575055 GCCCGGCCACCACCCCGTCTGGG - Intergenic
941814375 2:169785549-169785571 GCCCGGCCACCACCCCGTCTGGG - Intergenic
941847672 2:170149447-170149469 GCCCGGCCGCCACCCCATCTGGG + Intergenic
941847957 2:170150376-170150398 GCCCGGCCACCACCCCGTCTGGG + Intergenic
942020817 2:171866355-171866377 GCCCGGCCACCACCCCGTCTGGG - Intronic
942024868 2:171900428-171900450 GCCCGGCCACCACCCCGTCTGGG + Intronic
942096407 2:172538533-172538555 GCCCGGCCACCACCCCATCTGGG + Intergenic
942355804 2:175108648-175108670 GCCTGGCCACCACCCCATCTGGG + Intronic
942464026 2:176189191-176189213 TCACGTCCACTACGCCACCTCGG + Exonic
942620968 2:177845061-177845083 GCCCGGCCACCACCCCGTCTGGG - Intronic
942630858 2:177947238-177947260 GCCCGGCCACCACCCCGTCTGGG + Intronic
943297044 2:186153853-186153875 GCCCGGCCACCACCCCGTCTGGG - Intergenic
943323419 2:186472930-186472952 GCCCGGCCGCCACCCCATCTGGG + Intergenic
943323707 2:186473667-186473689 GCCCGGCCACCACCCCGTCTGGG + Intergenic
943412000 2:187557382-187557404 GCCCGGCCACCACCCCGTCTGGG + Intronic
943648385 2:190431175-190431197 TCCCGGCCACCATCCCATCTGGG - Intronic
944255264 2:197618611-197618633 GCCCGGCCACCATCCCATCTAGG + Intronic
944255463 2:197619214-197619236 GCCCGGCCACCACCCCGTCTGGG + Intronic
944262876 2:197695954-197695976 GCCCGGCCACCACCCCGTCTGGG - Intronic
944283225 2:197922535-197922557 GCCCGGCCACCACCCCGTCTGGG - Intronic
944532719 2:200683149-200683171 GCCCGGCCACCACCCCGTCTGGG - Intergenic
944570760 2:201042365-201042387 GCCCGGCCGCCACCCCATCTAGG + Intronic
944593407 2:201239290-201239312 GCCCGGCCACCACCCCGTCTGGG - Intronic
944598969 2:201284265-201284287 GCCCGGCCGCCACGCCGTCTGGG - Intronic
944625191 2:201563038-201563060 GCCCGGCCACCACCCCGTCTGGG - Intronic
944732844 2:202534783-202534805 GCCCGGCCACCACCCCGTCTGGG - Intronic
944751670 2:202715668-202715690 GCCCGGCCGCCATGCCATCTGGG - Intronic
944798017 2:203207383-203207405 GCCCGGCCACCACCCCGTCTGGG + Intronic
944815489 2:203372451-203372473 GCCCGGCCACCACCCCGTCTGGG - Intronic
944815673 2:203373049-203373071 GCCCGGCCGCCACCCCATCTGGG - Intronic
945090245 2:206171486-206171508 GCCCGGCCACCACCCCGTCTGGG - Intergenic
945110255 2:206356072-206356094 GCCCGGCCACCACCCCGTCTGGG - Intergenic
945114772 2:206400532-206400554 GCCCGGCCACCACCCCGTCTGGG - Intergenic
945316568 2:208377394-208377416 GCCCGGCCACCACCCCGTCTGGG - Intronic
945530882 2:210951061-210951083 GCCCGGCCACCACCCCGTCTGGG + Intergenic
945864893 2:215163730-215163752 TCCCGGCCACCATCCCATCTAGG - Intergenic
946304335 2:218847049-218847071 GCCCGGCCACCACCCCGTCTGGG + Intergenic
946318329 2:218932072-218932094 GCCCGGCCACCACCCCGTCTGGG + Intergenic
946651049 2:221892504-221892526 GCCCGGCCACCACCCCGTCTGGG + Intergenic
946742888 2:222817064-222817086 GCCCGGCCACCACCCCGTCTGGG + Intergenic
947402630 2:229743609-229743631 GCCCGGCCACCACCCCGTCTGGG + Intergenic
947418713 2:229922509-229922531 CGGCAGCCACGACGCCATCTTGG - Exonic
947798145 2:232906653-232906675 GCCCGGCCACCACCCCATCTGGG + Intronic
947901250 2:233724053-233724075 GCCCGGCCACCACCCCGTCTGGG - Intronic
948706470 2:239796089-239796111 GCCCAGCCACCACCCCATCTGGG + Intronic
948836235 2:240627254-240627276 CCAGGGGCCCCATGCCATCTGGG + Intronic
948999287 2:241603121-241603143 CCACGCAGCCCACGCCATCTTGG - Intronic
1169108631 20:3018747-3018769 GCCCGGCCACCACCCCGTCTGGG - Intronic
1169125483 20:3124532-3124554 GCCCGGCCGCCACCCCATCTAGG + Intronic
1169167963 20:3440955-3440977 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1169207852 20:3749973-3749995 CCACGCCCACCGCGCCATAAGGG - Exonic
1169370936 20:5027908-5027930 GCCCGGCCACCACCCCATCTGGG + Intergenic
1169371026 20:5028125-5028147 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1169718190 20:8644204-8644226 GCCCGGCCACCACCCCGTCTGGG + Intronic
1169718363 20:8644799-8644821 GCTCGGCCACCACCCCGTCTGGG + Intronic
1169788480 20:9385611-9385633 GCCCGGCCGCCACCCCATCTGGG - Intronic
1169788493 20:9385651-9385673 GCCCGGCCACCACCCCATCTGGG - Intronic
1169885542 20:10394824-10394846 GCCCGGCCACCACCCCATCTGGG - Intergenic
1169991859 20:11513330-11513352 GCCCGGCCACCACCCCATCTGGG - Intergenic
1170202642 20:13760852-13760874 CCCCGGCCACCACCCCGTCTGGG + Intronic
1170384441 20:15800660-15800682 GCCCGGCCACCACCCCGTCTGGG + Intronic
1170424682 20:16227060-16227082 GCCCGGCCACCACCCCTTCTGGG - Intergenic
1170622888 20:18010112-18010134 GCCCGGCCACCACCCCGTCTGGG - Intronic
1170811426 20:19678230-19678252 GCCCGGCCACCACCCCGTCTGGG - Intronic
1171496771 20:25561598-25561620 TCCCGGCCACCATCCCATCTAGG + Intronic
1171497009 20:25562266-25562288 GCCCGGCCACCACCCCGTCTGGG + Intronic
1171848337 20:30291505-30291527 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1171848543 20:30292082-30292104 TCCCGGCCACCATCCCATCTAGG - Intergenic
1171951966 20:31427892-31427914 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1171956792 20:31469971-31469993 GCCCGGCCACCACCCCGTCTGGG - Intronic
1172051341 20:32121725-32121747 GCCCGGCCACCACCCCGTCTGGG - Intronic
1172059581 20:32177393-32177415 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1172141376 20:32724412-32724434 GCCCGGCCACCACCCCGTCTGGG + Intronic
1172199690 20:33115932-33115954 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1172209055 20:33185035-33185057 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1172257934 20:33536192-33536214 GCCCGGCCACCACCCCGTCTGGG - Intronic
1172258207 20:33537074-33537096 GCCCGGCCACCACCCCGTCTAGG - Intronic
1172279685 20:33700178-33700200 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1172337866 20:34132486-34132508 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1172348658 20:34223690-34223712 GCCCGGCCACCACCCCGTCTGGG + Intronic
1172465453 20:35153272-35153294 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1172465933 20:35154519-35154541 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1172574910 20:36001260-36001282 GCCCGGCCACCACCCCGTCTGGG - Intronic
1172717494 20:36976250-36976272 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1172721373 20:37001232-37001254 GCCCGGCCACCACCCCGTCTGGG + Intronic
1172722959 20:37013059-37013081 GCCCGGCCACCACCCCGTCTGGG + Intronic
1172729007 20:37069941-37069963 GCCCGGCCACCACCCCGTCTGGG + Intronic
1172736069 20:37126606-37126628 GCCCGGCCACCACCCCGTCTGGG + Intronic
1172738958 20:37150812-37150834 TCCCGGCCACCACCCCGTCTAGG + Intronic
1172797412 20:37550660-37550682 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1172819274 20:37718130-37718152 GCCCAGCCACCACCCCATCTGGG - Intronic
1172907174 20:38378695-38378717 GCCCGGCCACCATCCCATCTAGG + Intergenic
1172918325 20:38461168-38461190 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1173472324 20:43333329-43333351 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1173517867 20:43677776-43677798 GCCCGGCCACCACCCCGTCTGGG + Intronic
1174020421 20:47525456-47525478 GCCCGGCCACCACCCCGTCTGGG - Intronic
1174020717 20:47526231-47526253 GCCCGGCCACCATGCCATCTAGG - Intronic
1174345002 20:49922591-49922613 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1174835880 20:53854692-53854714 GCCCGGCCACCACCCCATCTGGG + Intergenic
1176656775 21:9594113-9594135 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1176797128 21:13379219-13379241 GTCCGGCCACCACCCCATCTGGG + Intergenic
1177134089 21:17292033-17292055 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1177177878 21:17719167-17719189 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1178034477 21:28564260-28564282 GCCCGGCCACCACCCCCTCTGGG + Intergenic
1178786366 21:35657338-35657360 CCACTGCCAACATGACATCTGGG + Intronic
1178812727 21:35898080-35898102 GCCCGGCCACCACCCCGTCTGGG + Intronic
1179969394 21:44825407-44825429 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1180039397 21:45268392-45268414 GCCCGGCCGCCACCCCATCTGGG + Intronic
1180039693 21:45269259-45269281 GCCCGGCCACCACCCCGTCTGGG + Intronic
1180125246 21:45785605-45785627 GCCCGGCCACCACCCCGTCTGGG + Intronic
1180672161 22:17561502-17561524 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1180829947 22:18900220-18900242 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1180861195 22:19084129-19084151 GCCCGGCCACCACCCCGTCTGGG + Intronic
1180861455 22:19084901-19084923 GCCCGGCCACCACCCCATCTGGG + Intronic
1181096921 22:20511712-20511734 CCACTGCCTCCACCTCATCTGGG + Intronic
1181136191 22:20768162-20768184 CATTGGCCACCACCCCATCTGGG - Intronic
1181296945 22:21847637-21847659 GCCCGGCCGCCACCCCATCTGGG + Intronic
1181538562 22:23561000-23561022 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1181598953 22:23937365-23937387 GCCCGGCCACCACCCCCTCTGGG + Intergenic
1181617489 22:24065039-24065061 GCCCGGCCACCACCCCCTCTGGG - Intronic
1181657632 22:24316801-24316823 GCCCGGCCACCACCCCGTCTGGG - Intronic
1181792252 22:25277656-25277678 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1181981855 22:26772671-26772693 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1182343500 22:29643813-29643835 GCCCGGCCACCACCCCGTCTGGG - Intronic
1182377219 22:29857772-29857794 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1182377448 22:29858401-29858423 TCCCGGCCACCATCCCATCTAGG - Intergenic
1182564098 22:31184502-31184524 GCCCGGCCGCCACCCCATCTAGG - Intronic
1182616096 22:31591490-31591512 GCCCGGCCACCACCCCGTCTGGG - Intronic
1182976400 22:34626561-34626583 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1182982336 22:34684213-34684235 GCCCGGCCACCATGCCGTCTGGG - Intergenic
1183185688 22:36290556-36290578 TCCCGGCCGCCACCCCATCTGGG + Intronic
1183595150 22:38806820-38806842 GCCCGGCCACCATCCCATCTAGG + Intergenic
1183595595 22:38808010-38808032 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1183840966 22:40500916-40500938 GCCCGGCCACCACCCCGTCTGGG - Intronic
1183845697 22:40538039-40538061 GCCCGGCCACCACCCCGTCTGGG + Intronic
1183941092 22:41295170-41295192 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1184169427 22:42750474-42750496 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1184201273 22:42971494-42971516 GCCCGGCCGCCACCCCATCTGGG + Intronic
1203280038 22_KI270734v1_random:125491-125513 GCCCGGCCACCACCCCGTCTGGG - Intergenic
949569917 3:5283745-5283767 GCCCGGCCACCACCCCGTCTGGG - Intergenic
949853276 3:8439617-8439639 TCCCGGCCACCATCCCATCTAGG + Intergenic
949853305 3:8439737-8439759 TCCCGGCCACCATCCCATCTAGG + Intergenic
949853335 3:8439857-8439879 TCCCGGCCACCATCCCATCTAGG + Intergenic
949853644 3:8440694-8440716 GCCCGGCCACCACCCCGTCTGGG + Intergenic
949989927 3:9570208-9570230 GCCCGGCCGCCACCCCATCTGGG + Intergenic
949992628 3:9591936-9591958 GCCCGGCCACCATCCCATCTAGG + Intergenic
949992716 3:9592216-9592238 GCCCGGCCACCACCCCGTCTGGG + Intergenic
950044227 3:9939855-9939877 GCCCGGCCACCACCCCGTCTGGG - Intronic
950044343 3:9940254-9940276 GCCCGGCCACCACCCCGTCTGGG - Intronic
950060963 3:10070600-10070622 GCCCGGCCACCACCCCGTCTGGG + Intronic
950253555 3:11487357-11487379 GCCCGGCCACCACCCCGTCTGGG - Intronic
950412645 3:12849550-12849572 GCCCGGCCACCACCCCGTCTGGG - Intronic
950742305 3:15061625-15061647 GCCCGGCCACCACCCCGTCTGGG + Intronic
950742628 3:15062540-15062562 GCCCGGCCACCACCCCATCTGGG + Intronic
950754580 3:15162554-15162576 GCCCGGCCACCACCCCGTCTGGG - Intergenic
950948983 3:16979860-16979882 GCCCGGCCACCACCCCGTCTGGG - Intronic
951013187 3:17704444-17704466 GCCCGGCCACCACCCCGTCTGGG - Intronic
951264220 3:20548047-20548069 GCCCGGCCACGACCCCATCTGGG - Intergenic
951550393 3:23871200-23871222 GCCCGGCCACCACCCCGTCTGGG - Intronic
952308787 3:32169500-32169522 GCCCGGCCGCCACCCCATCTGGG + Intergenic
952308975 3:32170070-32170092 GCCCGGCCACCACCCCGTCTGGG + Intergenic
952364753 3:32664356-32664378 GCCCGGCCACCACCCCGTCTGGG + Intergenic
952864852 3:37848033-37848055 CCACGGTCCCCTAGCCATCTTGG - Intergenic
952894084 3:38064925-38064947 GCCCGGCCGCCACCCCATCTAGG - Intronic
952896293 3:38081338-38081360 GCCCGGCCACCACCCCGTCTGGG - Intronic
952934848 3:38389467-38389489 GCCCGGCCACCACCCCATCTGGG - Intronic
953037738 3:39227623-39227645 TCCCGGCCACCATCCCATCTAGG + Intergenic
953037884 3:39228068-39228090 GCCCGGCCACCACCCCGTCTGGG + Intergenic
953257836 3:41306618-41306640 GCCCGGCCACCACCCCGTCTGGG + Intronic
953426438 3:42798759-42798781 GCCCGGCCACCACCCCGTCTGGG + Intronic
953440176 3:42909783-42909805 GCCCCGCCGCCACGCCATCTGGG - Intronic
953652562 3:44820873-44820895 GCCCGGCCACCACCCCGTCTGGG - Intronic
953855054 3:46494479-46494501 TCCCGGCCACCATCCCATCTAGG + Intergenic
953855297 3:46495153-46495175 GCCCGGCCACCACCCCGTCTGGG + Intergenic
953922730 3:46963865-46963887 GCTCGGCCGCCACCCCATCTGGG + Intronic
953959577 3:47256614-47256636 GCCCGGCCACCACCCCGTCTGGG + Intronic
954059767 3:48057081-48057103 GCCCGGCCACCACCCCGTCTGGG + Intronic
954081171 3:48212551-48212573 GCCCGGCCACCACCCCGTCTGGG + Intergenic
954118896 3:48483611-48483633 GCCCGGCCACCACCCCGTCTGGG - Intronic
954162991 3:48734909-48734931 GCCCGGCCACCACCCCGTCTGGG + Intronic
954274615 3:49534056-49534078 CCACAGCCACCACTGCCTCTTGG - Exonic
954399152 3:50311123-50311145 GCCCGGCCACCACCCCGTCTGGG - Intronic
954483457 3:50823688-50823710 GCCCGGCCACCACCCCGTCTGGG - Intronic
954523655 3:51249746-51249768 GCCCGGCCACCACCCCGTCTGGG + Intronic
954529756 3:51308741-51308763 GCCCGGCCACCACCCCGTCTGGG - Intronic
954566953 3:51607782-51607804 GCCCGGCCGCCACCCCATCTGGG - Intronic
955256619 3:57338582-57338604 GCCCGGCCACCACCCCGTCTGGG + Intronic
955363197 3:58290965-58290987 GCCCGGCCGCCACCCCATCTAGG - Intronic
955394612 3:58549593-58549615 GCCCGGCCACCACCCCGTCTGGG - Intergenic
955434711 3:58890075-58890097 GCCCGGCCACCACCCCGTCTGGG - Intronic
955674298 3:61434316-61434338 GCCCGGCCACCACCCCGTCTGGG - Intergenic
956270844 3:67445090-67445112 GCCCGGCCACCACCCCGTCTGGG + Intronic
956697250 3:71929017-71929039 GCCCGGCCACCACCCCGTCTGGG + Intergenic
957035633 3:75289934-75289956 GCCCGGCCACCACCCCGTCTGGG + Intergenic
957203448 3:77165033-77165055 GCCCGGCCACCACCCCGTCTGGG + Intronic
958406293 3:93761402-93761424 GCCCGGCCGCCACCCCATCTGGG - Intergenic
958406784 3:93763087-93763109 GCCCGGCCACCACCCCATCTGGG - Intergenic
958406938 3:93763616-93763638 GCCCGGCCACCACCCCGTCTGGG - Intergenic
958560793 3:95744906-95744928 GCCCGGCCGCCACCCCATCTGGG + Intergenic
958957547 3:100478410-100478432 TCCCGGCCACCATCCCATCTAGG - Intergenic
959042919 3:101440043-101440065 GCCCGGCCACCACCCCGTCTGGG + Intronic
959054170 3:101551755-101551777 GCCCGGCCACCACCCCGTCTGGG + Intergenic
959201608 3:103254847-103254869 GCCAGGCCACCACCCCATCTGGG - Intergenic
959419014 3:106111055-106111077 GCCCGGCCACCACCCCGTCTGGG - Intergenic
959683681 3:109123782-109123804 GCCCGGCCGCCACCCCATCTGGG + Intergenic
959984352 3:112556497-112556519 GCCCGGCCACCACCCCGTCTGGG + Intronic
960526564 3:118718272-118718294 GCCCGGCCACCACCCCGTCTGGG - Intergenic
960624996 3:119673969-119673991 GCCTGGCCACCACCCCATCTGGG + Intronic
960698043 3:120414462-120414484 GCCCGGCCACCACCCCGTCTGGG + Intronic
960770700 3:121190576-121190598 GCCCGGCCGCCACCCCATCTGGG - Intronic
960862367 3:122165375-122165397 GCCCGGCCACCACCCCGTCTGGG + Intergenic
960918832 3:122725325-122725347 GCCCGGCCGCCACCCCATCTGGG - Intronic
960920902 3:122747062-122747084 GCCCGGCCGCCACCCCATCTGGG + Intronic
961120086 3:124366727-124366749 GCCCGGCCACCACCCCGTCTGGG - Intronic
961163613 3:124749916-124749938 GCCCGGCCACCACCCCGTCTGGG - Intergenic
961541800 3:127605110-127605132 CCACGGCCACAACGTCTTCAAGG + Exonic
961704330 3:128772999-128773021 GCCCGGCCACCACCCCGTCTGGG + Intronic
961704510 3:128773563-128773585 GCCCGGCCACCACCCCGTCTGGG + Intronic
961784068 3:129338982-129339004 GCCCGGCCACCACCCCGTCTGGG - Intergenic
961962746 3:130868897-130868919 GCCCGGCCACCACCCCGTCTGGG + Intronic
962063332 3:131952713-131952735 GCCCGGCCACCACCCCGTCTGGG + Intronic
962112669 3:132470509-132470531 GCCCGGCCACCACCCCGTCTGGG - Intronic
962572420 3:136724074-136724096 GCCCGGCCACCACCCCGTCTGGG + Intronic
962623004 3:137198385-137198407 GCCCGGCCACCACCCCATCTGGG - Intergenic
962761733 3:138521217-138521239 GCCCGGCCACCACCCCATCTAGG + Intronic
963244354 3:143046841-143046863 ACCCGGCCACCACCCCGTCTGGG - Intronic
963247154 3:143073849-143073871 GCCCGGCCACCACCCCGTCTGGG + Intergenic
963248822 3:143086138-143086160 ACCCGGCCACCACCCCGTCTGGG - Intergenic
963451101 3:145482774-145482796 GCCCGGCCACCACCCCGTCTGGG - Intergenic
963770390 3:149380871-149380893 GCCCGGCCACCACCCCGTCTGGG + Intergenic
964766061 3:160179054-160179076 GCCCGGCCACCACCCCGTCTGGG + Intergenic
965136871 3:164784342-164784364 GCCCGGCCGCCACCCCATCTAGG + Intergenic
965650150 3:170923981-170924003 GCCCGGCCGCCACCCCATCTGGG + Intergenic
966015020 3:175131665-175131687 GCCCGGCCACCACCCCATCTGGG - Intronic
966206599 3:177412728-177412750 GCCTGGCCACCACCCCATCTGGG - Intergenic
966253379 3:177891601-177891623 GCCCGGCCACCACCCCGTCTGGG - Intergenic
966351072 3:179032959-179032981 GCCCGGCCGCCACCCCATCTGGG + Intronic
966360253 3:179121552-179121574 GCCCGGCCACCACCCCGTCTGGG + Intergenic
966375325 3:179290820-179290842 GCCCGGCCACCACCCCGTCTGGG - Intergenic
966966905 3:185003676-185003698 GCCCGGCCACCACACCGTCTGGG - Intronic
967169259 3:186811391-186811413 GCCCGGCCACCACCCCGTCTGGG - Intergenic
967177705 3:186874534-186874556 GCCCGGCCACCACCCCGTCTGGG + Intergenic
967524349 3:190473671-190473693 GCCCGGCCACCACCCCGTCTGGG + Intergenic
967719422 3:192799561-192799583 CCAGGTCCACCACGCCTTCCCGG + Exonic
968139534 3:196244564-196244586 GCCCGGCCACCACCCCGTCTGGG + Intronic
968156603 3:196385850-196385872 GCCCGGCCGCCACCCCATCTGGG + Intronic
968175129 3:196543105-196543127 GCCCGGCCACCACCCCGTCTGGG - Intergenic
968201735 3:196761679-196761701 GCCCGGCCACCACCCCGTCTGGG - Intronic
968201896 3:196762167-196762189 GCCCGGCCACCATCCCATCTAGG - Intronic
968299475 3:197602258-197602280 GCCCGGCCACCACCCCGTCTGGG - Intergenic
968411590 4:395515-395537 GCCCGGCCACCATCCCATCTAGG + Intergenic
968411854 4:396242-396264 GCCCGGCCACCACCCCGTCTGGG + Intergenic
968666944 4:1827811-1827833 GCCCGGCCACCACCCCGTCTGGG - Intronic
968852667 4:3094437-3094459 GCCCGGCCGCCACCCCATCTGGG - Intronic
968924069 4:3538371-3538393 GCCCGGCCACCACCCCGTCTGGG - Intergenic
969374854 4:6756130-6756152 GCCCGGCCACCACCCCGTCTGGG + Intergenic
969404269 4:6978212-6978234 GCCCGGCCACCACCCCGTCTGGG + Intronic
969636204 4:8370655-8370677 GCAGTGCCACCACCCCATCTCGG + Intronic
970215981 4:13760992-13761014 GCCCGGCCACCACCCCGTCTGGG - Intergenic
970472531 4:16393054-16393076 GCCCGGCCACCACCCCGTCTGGG - Intergenic
970472830 4:16393887-16393909 GCCCGGCCGCCACCCCATCTAGG - Intergenic
971773285 4:30927328-30927350 GCCCGGCCACCACCCCGTCTGGG + Intronic
972288226 4:37668781-37668803 TCCCGGCCGCCACCCCATCTAGG + Intronic
972551701 4:40141112-40141134 GCCCGGCCACCACTCCATCTGGG - Intronic
972552521 4:40147435-40147457 GCCCGGCCACCACCCCGTCTGGG - Intronic
972654236 4:41049605-41049627 GCCCGGCCACCACCCCGTCTGGG + Intronic
972939656 4:44181656-44181678 CCCCGGCCGCCACCCCGTCTGGG + Intronic
972939847 4:44182261-44182283 GCCCGGCCACCACCCCATCTGGG + Intronic
973109339 4:46378130-46378152 GCCCGGCCACCACCCCGTCTGGG + Intronic
973281186 4:48363284-48363306 GCCCGGCCACCACCCCGTCTGGG - Intronic
973593911 4:52466058-52466080 GCCCGGCCACCACCCCGTCTGGG + Intergenic
973664159 4:53139679-53139701 GCCCGGCCGCCACCCCATCTGGG + Intronic
973672658 4:53237362-53237384 GCCCGGCCACCACCCCGTCTGGG - Intronic
973675074 4:53255735-53255757 GCCCGGCCACCACCCCGTCTGGG - Intronic
974076698 4:57173559-57173581 GCCCGGCCACCACCCCGTCTGGG + Intergenic
974588821 4:63918468-63918490 GCCCGGCCACCACCCCGTCTGGG - Intergenic
974848561 4:67380584-67380606 GCCCGGCCGCCACCCCATCTAGG + Intergenic
974848590 4:67380700-67380722 GCCCGGCCACCACCCCATCTAGG + Intergenic
974848656 4:67380964-67380986 GCCCGGCCACCACCCCATCTGGG + Intergenic
974848869 4:67381759-67381781 GCCCGGCCGCCACCCCATCTGGG + Intergenic
975042592 4:69762459-69762481 GCCCGGCCACCACCCCGTCTGGG + Intronic
975685514 4:76916577-76916599 GCCCGGCCACCATCCCATCTAGG + Intergenic
975793790 4:77984350-77984372 GCCCGGCCACCACCCCGTCTGGG - Intergenic
975908806 4:79245464-79245486 ACCCGGCCGCCACCCCATCTGGG + Intronic
975908829 4:79245544-79245566 ACCCGGCCGCCACCCCATCTGGG + Intronic
976149335 4:82077527-82077549 GCCCGGCCACCACCCCGTCTGGG + Intergenic
976149357 4:82077604-82077626 TCCCGGCCACCATCCCATCTAGG + Intergenic
976149497 4:82078043-82078065 GCCCGGCCGCCACCCCATCTGGG + Intergenic
976264985 4:83181886-83181908 GCCCGGCCACCACCCCGTCTGGG + Intergenic
976340670 4:83943352-83943374 GCCCGGCCACCACCCCGTCTGGG - Intergenic
976976064 4:91167940-91167962 GCCCGGCCACCACCCCGTCTGGG + Intronic
977205206 4:94158318-94158340 GCCCGGCCACCACCCCGTCTGGG + Intergenic
977542138 4:98330499-98330521 ACCCGGCCACCACCCCGTCTGGG - Intronic
977542211 4:98330768-98330790 TCCCAGCCACCACCCCATCTAGG - Intronic
978014196 4:103723112-103723134 GCCCGGCCGCCACCCCATCTGGG + Intergenic
978157021 4:105500797-105500819 GCCCGGCCGCCACCCCATCTAGG - Intergenic
978519745 4:109603624-109603646 GCCCGGCCACCACCCCGTCTGGG + Intronic
978519757 4:109603664-109603686 GCCCGGCCACCACCCCGTCTGGG + Intronic
978527139 4:109678504-109678526 GCCCGGCCACCGCCCCATCTGGG - Intronic
978820153 4:112957537-112957559 GCCCGGCCACCACCCCGTCTGGG - Intronic
978820313 4:112958025-112958047 TCCCGGCCACCAACCCATCTAGG - Intronic
978947607 4:114516874-114516896 GCCCGGCCACCACCCCGTCTGGG + Intergenic
979622318 4:122811757-122811779 TCCCGGCCACCATCCCATCTAGG + Intergenic
979641371 4:123015707-123015729 GCCCAGCCACCACCCCATCTGGG - Intronic
980056317 4:128083339-128083361 GCCCGGCCACCACCCCGTCTGGG - Intronic
980895354 4:138854737-138854759 GCCCGGCCACCACCCCGTCTGGG + Intergenic
981523932 4:145693555-145693577 GCCCGGCCACCACCCCATCTGGG - Intronic
982022062 4:151214391-151214413 GCCCGGCCACCACCCCGTCTGGG - Intronic
982026011 4:151254844-151254866 GCCCGGCCACCACCCCGTCTGGG - Intronic
982053439 4:151526280-151526302 GCCCGGCCACCACCCCGTCTGGG - Intronic
982182953 4:152765707-152765729 GCGCGGCCACCACCCCGTCTGGG - Intronic
982709538 4:158746308-158746330 GCCCGGCCACCACCCCGTCTGGG - Intergenic
982709776 4:158746947-158746969 GCCCGGCCACCATCCCATCTAGG - Intergenic
982784832 4:159524746-159524768 GCCCGGCCACCACCCCGTCTGGG + Intergenic
982821023 4:159940241-159940263 GCCCGGCCGCCACCCCATCTGGG - Intergenic
983217978 4:165019732-165019754 GCCCGGCCACCACCCCGTCTGGG - Intergenic
983604708 4:169570649-169570671 GCCCGGCCACCACCCCATCTGGG + Intronic
983652440 4:170047036-170047058 TCCCGGCCACCACCCCGTCTGGG + Intergenic
984037793 4:174691801-174691823 GCCCGGCCGCCACCCCATCTGGG + Intronic
984037851 4:174692033-174692055 ACCCGGCCACCACCCCGTCTGGG + Intronic
984037978 4:174692411-174692433 TCCCGGCCACCACCCCATCTGGG + Intronic
984533703 4:180945408-180945430 GCCCGGCCACCACCCCGTCTGGG + Intergenic
984977035 4:185240289-185240311 GCCCGGCCACCACCCCATCTGGG - Intronic
985216436 4:187658337-187658359 GCCCGGCCACCACCCCGTCTGGG + Intergenic
985247285 4:187991455-187991477 GCCCGGCCACCACCCCGTCTGGG - Intergenic
985255706 4:188068195-188068217 GCCCGGCCACCACCCCGTCTGGG + Intergenic
985736675 5:1586775-1586797 GCCCGGCCACCACCCCGTCTGGG + Intergenic
985928413 5:3035610-3035632 CCCCAGCCACCACGCCAGCCTGG + Intergenic
985971389 5:3381213-3381235 CCATGGCCTCCAAGCCAGCTAGG - Intergenic
987267847 5:16276701-16276723 GCCCGGCCACCACCCCGTCTGGG - Intergenic
988532671 5:32040276-32040298 GCACGGCCACCACCCCGTCTGGG + Intronic
988544545 5:32142922-32142944 GCCCGGCCACCACCCCGTCTGGG + Intronic
988552438 5:32209107-32209129 GCCCGGCCACCACCCCGTCTGGG + Intergenic
988760090 5:34305537-34305559 GCCCGGCCACCACCCCGTCTGGG - Intergenic
989021345 5:37012988-37013010 GCCCGGCCACCACCCCGTCTGGG - Intronic
989048584 5:37296148-37296170 GCCCGGCCACCACCCCATCTGGG + Intronic
989061398 5:37415304-37415326 GCCCGGCCACCACCCCGTCTGGG - Intronic
989075680 5:37562970-37562992 GCCCGGCCACCACCCCGTCTGGG - Intronic
989211236 5:38861641-38861663 GCCCGGCCACCACCCCGTCTGGG - Intronic
989247777 5:39273114-39273136 GCCCGGCCACCACCCCGTCTGGG + Intronic
989252812 5:39334789-39334811 GCCCGGCCGCCACCCCATCTGGG + Intronic
989575130 5:42980847-42980869 GCCCGGCCACCACCCCGTCTGGG + Intergenic
989634969 5:43522550-43522572 ACCCGGCCACCACCCCGTCTGGG + Intergenic
989640370 5:43578135-43578157 GCCCGGCCACCACCCCGTCTGGG - Intergenic
989648732 5:43665751-43665773 GCCCGGCCACCACCCCGTCTGGG - Intronic
989655748 5:43745772-43745794 GCCTGGCCACCACCCCATCTGGG - Intergenic
989663397 5:43824401-43824423 GCCCGGCCGCCACCCCATCTGGG - Intergenic
989663557 5:43824952-43824974 GCCCGGCCGCCACCCCATCTAGG - Intergenic
989991772 5:50774836-50774858 GCCTGGCCACCACCCCATCTAGG - Intronic
990293975 5:54381704-54381726 GCCAGGCCACCACCCCATCTGGG + Intergenic
990426596 5:55695790-55695812 GCCCGGCCACCACCCCGTCTGGG - Intronic
990459190 5:56015559-56015581 GCCCGGCCACCACCCCGTCTGGG - Intergenic
990461956 5:56038764-56038786 GCCCGGCCACCACCCCATCTGGG - Intergenic
990870948 5:60431065-60431087 GCCCGGCCACCACCCCATCTGGG - Intronic
991073526 5:62513107-62513129 GCCCGGCCACCACCCCGTCTGGG - Intronic
991127321 5:63083738-63083760 GCCCGGCCACCACCCCGTCTGGG - Intergenic
991375175 5:65958206-65958228 GCCCGGCCGCCACCCCATCTGGG - Intronic
991377106 5:65977627-65977649 GCCCGGCCACCATCCCATCTAGG - Intronic
991723720 5:69515927-69515949 TCCCGGCCCCCATGCCATCTAGG - Intronic
991909942 5:71551632-71551654 GCCCGGCCACCACCCCGTCTGGG - Intronic
991910177 5:71552290-71552312 TCCCGGCCACCATCCCATCTAGG - Intronic
991935211 5:71794041-71794063 GCCCGGCCGCCACCCCATCTGGG - Intergenic
992290157 5:75271628-75271650 GCCCGGCCACCACCCCGTCTGGG + Intergenic
992374249 5:76172518-76172540 GCCCGGCCACCACCCCGTCTGGG + Intronic
992443284 5:76813140-76813162 GCCCGGCCACCACCCCGTCTGGG + Intergenic
992463464 5:76984366-76984388 GCCCGGCCACCACCCCGTCTGGG - Intergenic
992469472 5:77042333-77042355 GCCCGGCCACCACCCCGTCTGGG - Intronic
992544171 5:77794833-77794855 GCCCGGCCACCACCCCGTCTGGG - Intronic
992574395 5:78096536-78096558 GCCCGGCCACCATCCCATCTAGG + Intronic
992574881 5:78097750-78097772 GCCCGGCCACCACCCCGTCTGGG + Intronic
992600111 5:78391175-78391197 GCCCGGCCACCACCCCGTCTGGG - Intronic
992789278 5:80198984-80199006 CCACTGCCACCACTACCTCTAGG + Intronic
992864527 5:80943858-80943880 GCCCGGCCACCACCCCGTCTGGG - Intergenic
992978466 5:82140695-82140717 GCCCGGCCACCACCCCGTCTGGG + Intronic
993496727 5:88616287-88616309 GCCCGGCCACCACCCCGTCTGGG + Intergenic
993657463 5:90595007-90595029 GCCCGGCCACCACCCCGTCTGGG - Intronic
993657912 5:90596104-90596126 GCCCGGCCGCCACCCCATCTGGG - Intronic
993832807 5:92780306-92780328 CCGCTGCCACCACGTCCTCTTGG + Intergenic
993872323 5:93267598-93267620 CCAAGACCAGCACGTCATCTGGG - Intergenic
994517154 5:100785693-100785715 GCCCGGCCGCCACCCCATCTGGG + Intergenic
995123438 5:108558898-108558920 GCCCGGCCACCACCCCGTCTGGG - Intergenic
995193981 5:109342978-109343000 GCCCGGCCACCACCCCGTCTGGG + Intronic
995516077 5:112955264-112955286 GCCCGGCCACCACCCCGTCTGGG + Intergenic
995772851 5:115690716-115690738 GCCCGGCCACCACCCCGTCTGGG + Intergenic
995994581 5:118283013-118283035 GCCCGGCCACCACCCCGTCTGGG + Intergenic
996054035 5:118964849-118964871 GCCCGGCCACCACCCCGTCTGGG + Intronic
996069771 5:119121804-119121826 GCCCGGCCACCACCCCGTCTGGG - Intronic
996070159 5:119122890-119122912 GCCCGGCCGCCACCCCATCTGGG - Intronic
996386214 5:122913236-122913258 GCCCGGCCACCACCCCATCTGGG - Intronic
997321549 5:132982915-132982937 GCCCGGCCACCACCCCGTCTGGG - Intergenic
997336048 5:133109246-133109268 GCCCGGCCACCACCCCGTCTGGG + Intergenic
997433573 5:133858151-133858173 GCCCGGCCGCCACCCCATCTGGG - Intergenic
997565176 5:134881710-134881732 GCCCGGCCACCACCCCGTCTGGG - Intronic
997930943 5:138070816-138070838 GCCCGGCCACCACCCCGTCTGGG + Intergenic
998021652 5:138776567-138776589 GCTCGGCCACCACCCCGTCTGGG - Intronic
998053786 5:139056789-139056811 GCCCGGCCACCACCCCGTCTGGG + Intronic
998060148 5:139112770-139112792 GCCCGGCCACCACCCCGTCTGGG + Intronic
998067641 5:139171172-139171194 GCCCGGCCACCACCCCATCTGGG + Intronic
998074502 5:139224761-139224783 GCCCGGCCACCACCCCGTCTGGG + Intronic
998239141 5:140427039-140427061 GCCCGGCCACCACCCCGTCTGGG - Intronic
998431582 5:142075172-142075194 GCCCGGCCACCACCCCGTCTGGG - Intergenic
999180893 5:149670041-149670063 GCCCGGCCACCACCCCGTCTGGG - Intergenic
999580873 5:153036755-153036777 GCCCGGCCACCACCCCGTCTGGG + Intergenic
999978972 5:156940365-156940387 GCCCGGCCGCCACCCCATCTAGG + Intronic
999979047 5:156940634-156940656 ACCCGGCCACCACCCCATCTGGG + Intronic
999987114 5:157014555-157014577 GCCCGGCCACCACCCCATCTGGG + Intergenic
1000033110 5:157420102-157420124 GCCCGGCCACCACCCCGTCTGGG + Intronic
1000103471 5:158037352-158037374 GCCCGGCCACGACCCCATCTGGG - Intergenic
1000985892 5:167860514-167860536 GCCCGGCCACCACCCCTTCTGGG + Intronic
1001366660 5:171147861-171147883 GCCCGGCCACCACCCCGTCTGGG + Intronic
1001393906 5:171403529-171403551 GCCCGGCCACCACCCCGTCTGGG - Intronic
1002007942 5:176252104-176252126 GCCCGGCCACCACCCCATCTGGG - Intronic
1002008124 5:176252726-176252748 GCCCGGCCGCCACCCCATCTGGG - Intronic
1002031687 5:176434287-176434309 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1002116267 5:176962619-176962641 GCCCGGCCACCACCCCGTCTGGG + Intronic
1002118509 5:176983875-176983897 GCCCGGCCGCCACCCCATCTGGG + Intronic
1002205436 5:177559989-177560011 GCCCGGCCACCACCCCATCTGGG - Intergenic
1002341308 5:178518419-178518441 GCCCGGCCACCACCCCGTCTGGG - Intronic
1002501486 5:179650343-179650365 GCCCGGCCACCACCCCATCTGGG - Intergenic
1002529378 5:179834926-179834948 GCCCGGCCACCACCCCGTCTGGG - Intronic
1002626117 5:180531088-180531110 GCCCGGCCGCCACCCCATCTGGG - Intronic
1002658251 5:180771198-180771220 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1003407236 6:5835405-5835427 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1004388547 6:15190042-15190064 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1004448649 6:15726080-15726102 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1004448916 6:15726903-15726925 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1004874285 6:19939225-19939247 GCCCGGCCGCCACCCCATCTAGG + Intergenic
1004874812 6:19940623-19940645 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1005158691 6:22836299-22836321 TCCCGGCCACCATCCCATCTAGG + Intergenic
1005159088 6:22837351-22837373 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1005606610 6:27484624-27484646 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1005624976 6:27653865-27653887 GCCCGGCCGCCACGCCGTCTGGG + Intergenic
1005710987 6:28502589-28502611 GCTCGGCCGCCACGCCGTCTGGG + Intergenic
1005865515 6:29933212-29933234 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1005929735 6:30474891-30474913 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1005929902 6:30475457-30475479 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1005933254 6:30499069-30499091 GCCCGGCCACCACCCCATCTAGG - Intergenic
1006040045 6:31244774-31244796 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1006128203 6:31853806-31853828 GCGCGGCCACCACCCCGTCTGGG - Intergenic
1006141291 6:31931786-31931808 GCCCGGCCACCACCCCGTCTGGG - Intronic
1006148839 6:31975802-31975824 GCCCGGCCACCACCCCATCTGGG - Intronic
1006209651 6:32384708-32384730 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1006209968 6:32385523-32385545 TCCCGGCCACCATCCCATCTAGG - Intergenic
1006225277 6:32531952-32531974 GCCCGGCCGCCACCCCATCTAGG + Intergenic
1006346229 6:33485588-33485610 GCCCGGCCACCACCCCATCTGGG - Intergenic
1006351725 6:33525620-33525642 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1006403721 6:33832463-33832485 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1006492727 6:34398598-34398620 GCCCGGCCACCACCCCGTCTGGG + Intronic
1006546815 6:34787011-34787033 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1006617661 6:35340787-35340809 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1006624092 6:35385107-35385129 GCCCGGCCACCACCCCGTCTGGG + Intronic
1007063359 6:38964219-38964241 GCCCGGCCACCACCCCGTCTGGG - Intronic
1007403270 6:41616664-41616686 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1007651553 6:43425466-43425488 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1007674042 6:43580432-43580454 GCCCGGCCACCACCCCGTCTGGG - Intronic
1008184271 6:48371187-48371209 GCCCGGCCACCACCCCATCTGGG - Intergenic
1008377603 6:50809966-50809988 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1008553491 6:52655503-52655525 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1008572007 6:52825435-52825457 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1008624549 6:53304948-53304970 GCCCGGCCACCACCCCGTCTGGG - Intronic
1008841598 6:55910183-55910205 GCCCGGCAACCACACCATCTGGG - Intergenic
1008919174 6:56824531-56824553 GCCCGGCCACCATCCCATCTAGG + Intronic
1008965635 6:57311084-57311106 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1009049144 6:58258052-58258074 GCCTGGCCACCACCCCATCTGGG + Intergenic
1009392942 6:63164626-63164648 GCCCAGCCACCACCCCATCTGGG + Intergenic
1009622756 6:66097170-66097192 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1009844755 6:69121691-69121713 GCCCGGCCGCCACCCCATCTGGG - Intronic
1009844846 6:69122043-69122065 GCCCGGCCACCACCCCGTCTGGG - Intronic
1009868921 6:69432474-69432496 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1009868934 6:69432514-69432536 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1010030211 6:71265932-71265954 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1010239493 6:73601910-73601932 GCCCGGCCACCACCCCGTCTGGG + Intronic
1010245759 6:73660365-73660387 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1010264328 6:73850951-73850973 GCCCAGCCACCACCCCATCTGGG - Intergenic
1010264461 6:73851325-73851347 GCCCGGCCACGACCCCATCTGGG - Intergenic
1010264490 6:73851433-73851455 GCCCGGCCACCATCCCATCTAGG - Intergenic
1010270822 6:73914810-73914832 GCCCGGCCACCACCCCATCTGGG - Intergenic
1010300657 6:74255319-74255341 GCCCGGCCACGACTCCATCTGGG - Intergenic
1010400393 6:75441503-75441525 ACCCGGCCACCACCCCGTCTGGG - Intronic
1010400667 6:75442224-75442246 GCCCGGCCACCATCCCATCTAGG - Intronic
1010513361 6:76744969-76744991 GCCCAGCCACCACCCCATCTGGG + Intergenic
1011148412 6:84244283-84244305 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1011297149 6:85838358-85838380 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1011404967 6:87009584-87009606 GCCCGGCCACCACCCCGTCTGGG - Intronic
1011474298 6:87736407-87736429 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1011475949 6:87750894-87750916 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1011588513 6:88948583-88948605 GCCCGGCCACCACCCCGTCTGGG + Intronic
1012428604 6:99141786-99141808 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1012428762 6:99142338-99142360 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1012479281 6:99650053-99650075 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1012899684 6:104991599-104991621 GCCCGGCCACCACCCCATCTGGG - Intronic
1012983495 6:105853627-105853649 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1013077648 6:106785450-106785472 CCACAGCCACCACCCCACGTAGG - Intergenic
1013190822 6:107803152-107803174 GCCCGGCCGCCACCCCATCTGGG + Intronic
1013190943 6:107803521-107803543 GCCCGGCCACCACCCCGTCTGGG + Intronic
1013204872 6:107935262-107935284 GCCCGGCCACCACCCCGTCTGGG + Intronic
1013206955 6:107953938-107953960 GCCCGGCCACCACCCCGTCTGGG + Intronic
1013244076 6:108270406-108270428 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1013326275 6:109047566-109047588 GCCCGGCCACCACCCCGTCTGGG + Intronic
1013679530 6:112508858-112508880 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1014556627 6:122848309-122848331 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1015220985 6:130802781-130802803 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1015477022 6:133665655-133665677 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1015643468 6:135363571-135363593 GCCCGGCCACCACCCCGTCTGGG - Intronic
1015908466 6:138142710-138142732 CCAAGGCTACCACAGCATCTAGG + Intergenic
1016476330 6:144433208-144433230 GCCCGGCCACCACCCCGTCTGGG - Intronic
1016802061 6:148178669-148178691 GCCCGGCCACCACCCCATCTGGG - Intergenic
1016973360 6:149785930-149785952 GCCCGGCCACCACCCCGTCTGGG - Intronic
1017170538 6:151450673-151450695 GCCCGGCCACCACCCCGTCTGGG + Intronic
1017214891 6:151898922-151898944 GCCCGGCCACCACCCCGTCTGGG - Intronic
1017465286 6:154687724-154687746 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1017493686 6:154966122-154966144 GCCCGGCCACCACCCCGTCTGGG - Intronic
1017493876 6:154966697-154966719 TCCCGGCCACCATCCCATCTAGG - Intronic
1017843190 6:158238950-158238972 GCCCGGCCACCACCCCGTCTGGG - Intronic
1018009961 6:159660702-159660724 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1018528079 6:164736071-164736093 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1018528232 6:164736589-164736611 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1019128484 6:169857202-169857224 GCTCGGCCGCCACGCCGTCTGGG - Intergenic
1019179484 6:170177470-170177492 CCACAGCCACCACCCTCTCTAGG + Intergenic
1019579433 7:1753008-1753030 CCACGCCCTACACCCCATCTGGG - Intergenic
1019651636 7:2162061-2162083 GCCCGGCCACCACCCCGTCTGGG + Intronic
1019669378 7:2269001-2269023 GCCCGGCCACCACCCCGTCTGGG + Intronic
1019674343 7:2302511-2302533 GCCCGGCCACCACCCCGTCTGGG + Intronic
1019674644 7:2303426-2303448 GCCCGGCCACCACCCCGTCTGGG + Intronic
1019953150 7:4390122-4390144 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1020284539 7:6670745-6670767 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1020325818 7:6974881-6974903 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1020498907 7:8890757-8890779 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1020831872 7:13103143-13103165 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1021120129 7:16789575-16789597 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1021120457 7:16790431-16790453 TCCCGGCCACCATCCCATCTAGG - Intergenic
1021493509 7:21246616-21246638 GCCCGGCCCCCACCCCATCTGGG - Intergenic
1021647512 7:22801319-22801341 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1021672161 7:23045817-23045839 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1021992011 7:26148530-26148552 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1022005572 7:26262491-26262513 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1022083592 7:27045619-27045641 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1022187782 7:27987064-27987086 GCCCGGCCGCCACCCCATCTGGG + Intronic
1022274134 7:28838997-28839019 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1022318247 7:29264208-29264230 GCCCGGCCACCACCCCGTCTGGG + Intronic
1022393207 7:29961592-29961614 GCCCGGCCACCACCCCGTCTGGG - Intronic
1022757031 7:33304032-33304054 GCCCGGCCGCCACCCCATCTAGG + Intronic
1022757123 7:33304375-33304397 GCCCGGCCGCCACCCCATCTGGG + Intronic
1023044278 7:36197385-36197407 GCCCGGCCACCACCCCGTCTGGG + Intronic
1023160772 7:37293190-37293212 GCCCGGCCACCACCCCGTCTGGG + Intronic
1023954079 7:44871318-44871340 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1023954115 7:44871435-44871457 GCCCGGCCACCACCCCATCTGGG - Intergenic
1023971265 7:44992692-44992714 CCCCGGCCACCACCCCGTCTGGG - Intergenic
1024625728 7:51207839-51207861 GCCCGGCCACCACCCCGTCTGGG + Intronic
1024625946 7:51208533-51208555 GCCCGGCCACCACCCCATCTGGG + Intronic
1024910655 7:54444008-54444030 GCCCAGCCACCACCCCATCTAGG + Intergenic
1024931101 7:54667536-54667558 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1024988872 7:55219599-55219621 GCCCGGCCACCACCCCGTCTGGG - Intronic
1025011370 7:55402064-55402086 GCCCGGCCACCACCCCGTCTGGG - Intronic
1025103486 7:56152001-56152023 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1025572909 7:62599627-62599649 GCCCAGCCACCACCCCATCTGGG - Intergenic
1025706985 7:63874639-63874661 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1025778330 7:64577591-64577613 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1025793776 7:64718342-64718364 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1025795785 7:64738311-64738333 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1025800941 7:64785176-64785198 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1025803426 7:64809107-64809129 GCCCGGCCACCACCCCGTCTGGG - Intronic
1025808183 7:64855920-64855942 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1026186108 7:68083183-68083205 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1026783149 7:73283811-73283833 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1026862019 7:73797112-73797134 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1026868541 7:73836754-73836776 GCCCGGCCACCACCCCGTCTGGG + Intronic
1027371428 7:77510050-77510072 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1027373693 7:77533422-77533444 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1027826795 7:83125362-83125384 GCCCGGCCACCACCCCATCTGGG + Intronic
1028227191 7:88266003-88266025 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1028535652 7:91887713-91887735 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1028548067 7:92026741-92026763 GCCCGGCCACCACCCCGTCTAGG + Intronic
1028548099 7:92026857-92026879 GCCCGGCCGCCACGCCGTCTAGG + Intronic
1028685402 7:93585745-93585767 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1029279694 7:99427576-99427598 GCCCGGCCACCACCCCGTCTGGG + Intronic
1029334653 7:99888680-99888702 TCCCGGCCACCATCCCATCTAGG - Intronic
1029429668 7:100522720-100522742 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1029430186 7:100524000-100524022 TCCCGGCCACCATCCCATCTAGG - Intergenic
1029468432 7:100740823-100740845 GCCCGGCCACCACCCCGTCTGGG - Intronic
1029482889 7:100823665-100823687 CCACGGCCCTCACGCCAGCCTGG - Exonic
1029525827 7:101092809-101092831 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1029569410 7:101359882-101359904 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1029813087 7:103068946-103068968 CCACGGCCACCACGCCATCTGGG + Intronic
1030368450 7:108671861-108671883 GCCCGGCCACCACCCCAGCTGGG + Intergenic
1030725797 7:112922949-112922971 GCCCGGCCACCACCCCATCTGGG + Intronic
1032056788 7:128689880-128689902 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1032087206 7:128890648-128890670 CCACGGCCTCCCCGCCCTCACGG - Intronic
1032129387 7:129216140-129216162 GCCCGGCCACCACCCCATCTAGG + Intergenic
1032129474 7:129216451-129216473 GCCCGGCCACCACCCCATCTGGG + Intergenic
1032290998 7:130590665-130590687 GCCCGGCCACCACCCCGTCTGGG + Intronic
1032291438 7:130591872-130591894 GCCCGGCCACCACCCCGTCTGGG + Intronic
1032431321 7:131864454-131864476 CCAGGACCACCACATCATCTGGG - Intergenic
1032569454 7:132984472-132984494 GCCCGGCCGCCACCCCATCTGGG + Intronic
1032569995 7:132985875-132985897 GCCCGGCCACCACCCCGTCTGGG + Intronic
1032589422 7:133177787-133177809 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1033090208 7:138378835-138378857 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1033173152 7:139101484-139101506 GCCCGGCCACCACCCCGTCTGGG + Intronic
1033185687 7:139225581-139225603 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1033219661 7:139520038-139520060 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1033323695 7:140362075-140362097 GCCCGGCCACCATCCCATCTAGG + Intronic
1033333163 7:140431861-140431883 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1033376047 7:140763130-140763152 GCCCGGCCACCACCCCGTCTGGG - Intronic
1034234397 7:149555317-149555339 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1034361796 7:150506232-150506254 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1036482920 8:9153927-9153949 GCCCGGCCACCACCCCGTCTGGG - Intronic
1036506885 8:9364897-9364919 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1036536467 8:9657143-9657165 GCCCGGCCACCACCCCGTCTGGG - Intronic
1036737338 8:11330390-11330412 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1037756321 8:21712437-21712459 TCCCGGCCACCATCCCATCTAGG - Intronic
1038167874 8:25102842-25102864 GCCCGGCCACCACCCCGTCTAGG + Intergenic
1038167973 8:25103195-25103217 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1039067834 8:33624403-33624425 CGTCGGCCACCACCCCGTCTGGG + Intergenic
1039072109 8:33658058-33658080 GCCCGGCCACCACCCCATCTGGG - Intergenic
1039488309 8:37928170-37928192 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1039807675 8:41014720-41014742 TCGCGGCCGCCACCCCATCTGGG - Intergenic
1039881084 8:41626233-41626255 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1039961940 8:42254996-42255018 GCCCGGCCACCACCCCATCTGGG + Intergenic
1040043323 8:42939240-42939262 TCCCGGCCACCACCCCGTCTGGG - Intronic
1040121148 8:43687396-43687418 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1040409241 8:47137906-47137928 GCCCGGCCACCACCCCGTCTAGG + Intergenic
1040785672 8:51159656-51159678 GCCCGGCCACCACCCCATCTGGG + Intergenic
1041066178 8:54085395-54085417 GCACGGCCGCCACCCCATCTAGG + Intronic
1041270238 8:56104170-56104192 GCCCGGCCACCACCCCTTCTGGG - Intergenic
1041286857 8:56271900-56271922 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1041357996 8:57021799-57021821 TCCCGGCCACCATCCCATCTAGG + Intergenic
1041358301 8:57022647-57022669 GCCCGGCCACCACCCCATCTGGG + Intergenic
1041362861 8:57071312-57071334 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1041513532 8:58676321-58676343 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1041676717 8:60547419-60547441 GCCCGGCCACCACCCCGTCTGGG - Intronic
1041796281 8:61752395-61752417 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1041920680 8:63179741-63179763 GCCCGGCCACCACCCCATCTGGG - Intronic
1042049335 8:64686600-64686622 GCCCGGCCACCACCCCGTCTGGG + Intronic
1042195975 8:66232072-66232094 GCCCGGCCACCACCCCATCTGGG + Intergenic
1042303449 8:67310506-67310528 GCCCGGCCACCACCCCATCTGGG + Intronic
1044223966 8:89699601-89699623 GCCCGGCCACCACCCCATCTGGG + Intergenic
1044507749 8:93039682-93039704 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1044637481 8:94341092-94341114 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1044969351 8:97604763-97604785 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1045298398 8:100891994-100892016 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1046703508 8:117426575-117426597 GCCCGGCCGCCACCCCATCTAGG + Intergenic
1046703536 8:117426691-117426713 GCCCGGCCACCACCCCTTCTAGG + Intergenic
1046703607 8:117426961-117426983 GCCCGGCCACCACCCCATCTGGG + Intergenic
1046703618 8:117427001-117427023 GCCCAGCCACCACCCCATCTGGG + Intergenic
1047267116 8:123316055-123316077 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1047388687 8:124432417-124432439 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1047687663 8:127317352-127317374 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1047781888 8:128118338-128118360 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1047847647 8:128825504-128825526 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1047969764 8:130074670-130074692 CCACGGCCACCATGCCAGGCAGG + Intronic
1048368324 8:133757469-133757491 TCCCGGCCACCATCCCATCTAGG + Intergenic
1048368734 8:133758537-133758559 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1049177274 8:141202072-141202094 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1049177508 8:141202736-141202758 GCCCAGCCACCACCCCATCTGGG - Intergenic
1049257260 8:141620594-141620616 CCACCCCCAGCACTCCATCTTGG - Intergenic
1049683193 8:143928947-143928969 CTGCGGCCACCACCCCAGCTGGG + Intronic
1049704960 8:144037289-144037311 GCCCGGCCACCACCCCGTCTGGG + Intronic
1049739583 8:144231331-144231353 GCCCGGCCACCACCCCGTCTGGG - Intronic
1050557052 9:6798762-6798784 GCCCGGCCACCACCCCGTCTGGG - Intronic
1050558369 9:6808165-6808187 GCCCGGCCACCACCCCGTCTGGG + Intronic
1050876976 9:10651246-10651268 CCACTGCCTCTATGCCATCTGGG + Intergenic
1051277097 9:15407200-15407222 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1051430526 9:16977265-16977287 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1051661762 9:19433677-19433699 GCCCGGCCACCACCCCATCTGGG - Intronic
1052236294 9:26215484-26215506 GCCCGGCCGCCACCCCATCTAGG - Intergenic
1052259126 9:26492829-26492851 GCCCGGCCACCACCCCATCTGGG + Intergenic
1052880956 9:33600697-33600719 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1052881135 9:33601296-33601318 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1052941855 9:34137404-34137426 TCCCGGCCACCATCCCATCTAGG + Intergenic
1053048222 9:34937121-34937143 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1053081893 9:35183874-35183896 GCCCGGCCACCACCCCGTCTGGG - Intronic
1053082003 9:35184296-35184318 GCCCGGCCACCACCCCGTCTGGG - Intronic
1053255667 9:36614960-36614982 GCCCGGCCACCACCCCGTCTGGG - Intronic
1053467916 9:38324434-38324456 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1053468275 9:38325438-38325460 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1054359820 9:64101393-64101415 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1054846063 9:69799775-69799797 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1055133773 9:72806067-72806089 GCCCGGCCACCACCCCGTCTGGG - Intronic
1055136917 9:72840114-72840136 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1055242024 9:74197370-74197392 GCCCGGCCACCATCCCATCTAGG + Intergenic
1055414042 9:76063852-76063874 GCCCGGCCACCACCCCGTCTGGG - Intronic
1055518826 9:77060676-77060698 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1055580407 9:77702627-77702649 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1055586714 9:77762569-77762591 GCCCGGCCACCACCCCATCTGGG + Intronic
1056097809 9:83272821-83272843 GCCCGGCCACGACCCCATCTGGG + Intronic
1056145894 9:83728851-83728873 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1056152885 9:83804940-83804962 GCCCGGCCACCACCCCATCTGGG + Intronic
1056229398 9:84527538-84527560 GCCCGGCCGCCACCCCATCTAGG - Intergenic
1056336458 9:85573942-85573964 GCCCGGCCACCACCCCGTCTGGG + Intronic
1056409530 9:86312145-86312167 GCCCGGCCACCATCCCATCTAGG + Intronic
1056409659 9:86312584-86312606 GCCCGGCCACCATCCCATCTGGG + Intronic
1056564501 9:87759486-87759508 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1056624643 9:88244615-88244637 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1056670960 9:88626498-88626520 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1056845164 9:90031479-90031501 CCACGGCCCCCATTCCATCCAGG - Intergenic
1057087760 9:92227328-92227350 GCCCGGCCACCACCCCGTCTGGG - Intronic
1057207851 9:93184263-93184285 CCACGGCCCCCACCCCAGCGCGG + Intergenic
1057629311 9:96707360-96707382 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1057630420 9:96715555-96715577 GCCCGGCCGCCACCCCATCTAGG - Intergenic
1057674905 9:97130758-97130780 GCCCGGCCGCCACCCCATCTAGG - Intergenic
1057674933 9:97130874-97130896 TCCCGGCCGCCACCCCATCTAGG - Intergenic
1057716116 9:97497965-97497987 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1058661699 9:107272560-107272582 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1058723207 9:107777750-107777772 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1058972654 9:110097475-110097497 GCCCGGCCACCACCCCGTCTGGG - Intronic
1059121371 9:111642081-111642103 GCCCGGCCACCACCCCGTCTGGG + Intronic
1059470027 9:114497953-114497975 CCACGGCCACAAAGCCAGCTTGG + Intronic
1059879782 9:118677863-118677885 GCCCGGCCGCCACTCCATCTGGG - Intergenic
1060249234 9:121971541-121971563 GCCCGGCCACCACCCCGTCTGGG + Intronic
1060352153 9:122868213-122868235 GCCCGGCCACCACCCCGTCTGGG + Intronic
1060369554 9:123056998-123057020 GCCCGGCCACCACCGCATCTGGG - Intronic
1060625641 9:125108831-125108853 GCCCGGCCACCACCCCGTCTGGG + Intronic
1060651186 9:125328723-125328745 GCCCGGCCACCACCCCGTCTGGG - Intronic
1060669675 9:125458739-125458761 GCCCAGCCACCACACCATCTGGG - Intronic
1060682588 9:125577903-125577925 GCCCGGCCACCACCCCGTCTGGG + Intronic
1060686955 9:125623205-125623227 GCCCGGCCGCCACCCCATCTGGG + Intronic
1060686983 9:125623321-125623343 GCCCGGCCACCATCCCATCTAGG + Intronic
1060687529 9:125624711-125624733 GCCCGGCCACCACCCCGTCTGGG + Intronic
1061143219 9:128780621-128780643 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1061154116 9:128846804-128846826 CCACGGCCCACCAGCCATCTGGG - Intronic
1061635953 9:131908348-131908370 GCCCGGCCACCACCCCGTCTGGG + Intronic
1061657511 9:132104324-132104346 CCAGGGCCACCAGGCCTGCTGGG - Intergenic
1061831719 9:133300304-133300326 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1061914934 9:133744983-133745005 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1062593892 9:137288619-137288641 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1186786799 X:12963051-12963073 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1186787100 X:12963891-12963913 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1186922925 X:14302614-14302636 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1187183374 X:16964552-16964574 GCCCGGCCACCACCCCGTCTGGG - Intronic
1187184087 X:16968364-16968386 GCCCGGCCACCACCCCGTCTGGG - Intronic
1187976290 X:24708908-24708930 GCCCGGCCACCACCCCGTCTGGG - Intronic
1188086391 X:25905897-25905919 GCCCGGCCACGACCCCATCTGGG + Intergenic
1188476996 X:30601900-30601922 GCCCGGCCGCCACGCCGTCTGGG + Intergenic
1188477540 X:30603352-30603374 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1188492652 X:30753879-30753901 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1188942821 X:36261847-36261869 GCCCGGCCACCACCCCGTCTGGG - Intronic
1189056759 X:37707154-37707176 GCCCGGCCACCACCCCGTCTGGG - Intronic
1189421788 X:40862923-40862945 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1189421801 X:40862963-40862985 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1189458098 X:41211933-41211955 GCCCGGCCACCACCCCGTCTGGG + Intronic
1189506126 X:41613103-41613125 GCCCGGCCACCACCCCGTCTGGG + Intronic
1189569923 X:42285556-42285578 GCCAGGCCACCACCCCATCTGGG - Intergenic
1189587171 X:42473933-42473955 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1189882019 X:45503779-45503801 GCCCGGCCGCCACCCCATCTGGG - Intergenic
1189955710 X:46275118-46275140 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1189956052 X:46276114-46276136 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1190117648 X:47636797-47636819 CCACCACCACCACCCCTTCTGGG - Exonic
1190171671 X:48115820-48115842 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1190184449 X:48222198-48222220 GCCCGGCCGCCACCCCATCTGGG + Intronic
1190184593 X:48222676-48222698 GCCCGGCCACCACCCCGTCTGGG + Intronic
1190241151 X:48659223-48659245 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1190680797 X:52826709-52826731 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1190799169 X:53772495-53772517 GCCCGGCCACGACCCCATCTGGG - Intergenic
1190820533 X:53967586-53967608 GCCCGGCCACCACCCCATCTGGG + Intronic
1190839066 X:54128994-54129016 GCCCGGCCACCACCCCGTCTGGG - Intronic
1190839223 X:54129450-54129472 TCCCGGCCACCATCCCATCTAGG - Intronic
1190891427 X:54572528-54572550 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1190906730 X:54736205-54736227 ACCCGGCCGCCACCCCATCTAGG + Intergenic
1191010237 X:55749506-55749528 GCCCGGCCACCACCCCATCTGGG + Intronic
1191068856 X:56379996-56380018 GCCCGGCCACCACCCCATCTGGG - Intergenic
1191617881 X:63189134-63189156 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1191637524 X:63393624-63393646 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1191679265 X:63825316-63825338 GCCCGGCCACCACCCCATCTGGG - Intergenic
1192252110 X:69422037-69422059 GCCCGGCCACAACCCCATCTGGG + Intergenic
1192350107 X:70349603-70349625 GCCCGGCCACCACCCCGTCTGGG - Intronic
1192350239 X:70350073-70350095 GCCCGGCCGCCACCCCATCTAGG - Intronic
1192352761 X:70371498-70371520 GCCCGGCCACCACCCCGTCTGGG - Intronic
1192386711 X:70679348-70679370 GCCCGGCCACCACCCCGTCTGGG + Intronic
1192386948 X:70680053-70680075 GCCCGGCCACCACCCCGTCTGGG + Intronic
1192463855 X:71341200-71341222 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1192476901 X:71451999-71452021 GCCCGGCCACCACCCCGTCTGGG - Intronic
1192504840 X:71675594-71675616 GCCCGGCCGCCACCCCATCTAGG + Intergenic
1192530269 X:71877099-71877121 GCCCGGCCACGACCCCATCTGGG - Intergenic
1192621671 X:72682396-72682418 GCCCGGCCACCACCCCGTCTGGG + Intronic
1192663580 X:73067856-73067878 GCCTGGCCACCACCCCATCTAGG + Intergenic
1192664042 X:73069431-73069453 GCCCGGCCACCACACCATCTGGG + Intergenic
1192768986 X:74167601-74167623 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1192794084 X:74412485-74412507 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1192813311 X:74568430-74568452 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1192892773 X:75407683-75407705 GCCCGGCCGCCACCCCATCTGGG + Intronic
1193068191 X:77279774-77279796 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1193114780 X:77766212-77766234 GCCCGGCCACCACCCCGTCTGGG - Intronic
1193132175 X:77931536-77931558 GCCCGGCCACCACCCCCTCTGGG - Intronic
1193164717 X:78266026-78266048 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1193345131 X:80396796-80396818 GCCCGGCCACCACCCCGTCTGGG - Intronic
1193345354 X:80397516-80397538 GCCCGGCCACCACCCCGTCTGGG - Intronic
1193362417 X:80591717-80591739 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1193372442 X:80713162-80713184 GCCCGGCCACCACCCCGTCTGGG + Intronic
1193889971 X:87033173-87033195 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1193924458 X:87466339-87466361 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1194181118 X:90713518-90713540 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1194992126 X:100556132-100556154 GCCCGGCCACCACCCCATCTGGG + Intergenic
1195009717 X:100723529-100723551 GCCCGGCCGCCACCCCATCTGGG + Intronic
1195010015 X:100724342-100724364 GCCCGGCCACCACCCCGTCTGGG + Intronic
1195035939 X:100972252-100972274 GCCCGGCCACCACCCCGTCTGGG - Intronic
1195119845 X:101738860-101738882 GCCCGGCCGCCACCCCATCTAGG + Intergenic
1195703808 X:107724208-107724230 CCACTGCCCCCACCCCAGCTAGG - Intronic
1195978980 X:110558459-110558481 GCCCAGCCACCACCCCATCTGGG - Intergenic
1196404173 X:115347021-115347043 GCCCGGCCACCACCCCGTCTGGG - Intergenic
1197241668 X:124128468-124128490 GCCCGGCCACCACCCCGTCTGGG - Intronic
1197453054 X:126641806-126641828 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1197735867 X:129850347-129850369 CCCCGGCCGCCATCCCATCTAGG + Intergenic
1197814996 X:130488794-130488816 CCACGGCCACCAGGCACACTAGG - Intergenic
1197897175 X:131327697-131327719 GCCCGGCCACCACCCCGTCTGGG + Intronic
1198260394 X:134960341-134960363 GCCCGGCCACGACCCCATCTGGG + Intergenic
1198476634 X:137001138-137001160 GCCCGGCCACCATCCCATCTAGG - Intergenic
1199230881 X:145436036-145436058 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1199231049 X:145436598-145436620 GCCCGGCTACCACCCCATCTGGG + Intergenic
1199452537 X:147992181-147992203 GCCCGGCCACCACCCCGTCTGGG - Intronic
1199586571 X:149421241-149421263 GCCCGGCCACCACCCCATCTGGG + Intergenic
1200324667 X:155224188-155224210 GCCCGGCCGCCACCCCATCTGGG - Intronic
1201282314 Y:12352395-12352417 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1201335857 Y:12879024-12879046 GCCCGGCCACCACCCCGTCTGGG + Intergenic
1202028750 Y:20551701-20551723 GCCCGGCCGCCACCCCATCTGGG + Intergenic
1202028853 Y:20552078-20552100 GCTCGGCCGCCACCCCATCTGGG + Intergenic