ID: 1029813171

View in Genome Browser
Species Human (GRCh38)
Location 7:103069267-103069289
Sequence TTCCAGATGGGGCGGCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1707
Summary {0: 1, 1: 0, 2: 11, 3: 202, 4: 1493}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029813171_1029813177 -1 Left 1029813171 7:103069267-103069289 CCTGGTTGCCGCCCCATCTGGAA 0: 1
1: 0
2: 11
3: 202
4: 1493
Right 1029813177 7:103069289-103069311 AAGTGAGGAGCGCCTTTGCCCGG 0: 5
1: 651
2: 9382
3: 12352
4: 4389
1029813171_1029813182 29 Left 1029813171 7:103069267-103069289 CCTGGTTGCCGCCCCATCTGGAA 0: 1
1: 0
2: 11
3: 202
4: 1493
Right 1029813182 7:103069319-103069341 GCAACCCTCGAAGTGTGAAGTGG 0: 1
1: 9
2: 19
3: 9
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029813171 Original CRISPR TTCCAGATGGGGCGGCAACC AGG (reversed) Intronic
901030562 1:6305042-6305064 TCCCAGATGGGGCGGCTGGCCGG + Intronic
901678604 1:10900729-10900751 TTCCAGAGGAGGGGGCAAGCTGG + Intergenic
901727071 1:11250290-11250312 TCCCAGATGGGGCGGCTGGCCGG + Intronic
901734798 1:11305738-11305760 TCCCAGATGGGGCGGCTGGCGGG + Intergenic
901849822 1:12008347-12008369 TCCCGGATGGGGCGGCGGCCGGG + Intronic
901970323 1:12902920-12902942 TCTCAGATGGGGCGGCTGCCAGG - Intronic
902019099 1:13329473-13329495 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
902027517 1:13394962-13394984 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
903103419 1:21053387-21053409 TTCCAGACGGGGCGGCTGTCCGG - Intronic
903148053 1:21387863-21387885 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
903526365 1:23994463-23994485 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
903526472 1:23994892-23994914 TCCCAGACGGGGTGGCAGCCAGG + Intergenic
903633830 1:24799055-24799077 TCCCAGATGGGGTGGCGGCCGGG - Intronic
903633933 1:24799488-24799510 TCCCAGATGGGGTGGCTGCCGGG - Intronic
903633944 1:24799528-24799550 TCCCAGATGGGGGGGCTGCCGGG - Intronic
903637482 1:24832877-24832899 TCCCAGATGGGGCGGCTGGCCGG + Intronic
903748441 1:25603979-25604001 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
903921625 1:26804090-26804112 TCCCAGACGGGGTGGCAACCAGG + Intergenic
903923552 1:26817949-26817971 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
903923808 1:26818540-26818562 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
904077332 1:27852899-27852921 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
904532130 1:31176706-31176728 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
904761001 1:32804469-32804491 TCCCAGACGGGGCGGCTGCCAGG + Intronic
904761088 1:32804818-32804840 TCCCAGATGGGGTGGCAGCCAGG + Intronic
904794954 1:33051819-33051841 TCCCAGATGGGGTGGCTGCCGGG - Intronic
904831651 1:33309539-33309561 TCCCAGGTGGGGCGGCTGCCGGG + Intronic
904831744 1:33309889-33309911 TCCCAGATGGGGAGGCGGCCGGG + Intronic
904838777 1:33356890-33356912 TCCCAGACGGGGCGGCGGCCGGG + Intronic
904857333 1:33509384-33509406 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
904857419 1:33509732-33509754 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
904930384 1:34082429-34082451 TCTCAGATGGGGCGGCTGCCAGG - Intronic
905039944 1:34947837-34947859 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
905040003 1:34948066-34948088 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
905599159 1:39234702-39234724 TCCCAGATGGGGCGGCTGCCGGG + Intronic
905680859 1:39869825-39869847 TCCCAGACGGGGCGGCTGCCGGG - Intronic
905699345 1:39999882-39999904 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
905699356 1:39999922-39999944 TCCCGGATGGGGCGGCTGCCGGG - Intergenic
905847893 1:41248481-41248503 TTCCAGATGAGGTGGCATCTAGG - Intergenic
906370367 1:45248229-45248251 TCCCAGACGGGGCGGCCGCCGGG - Intronic
906370404 1:45248346-45248368 TCCCAGATGGGGTGGCGGCCGGG - Intronic
906432353 1:45765577-45765599 TCCCAGATGGGGTGGCGGCCAGG + Intergenic
906486677 1:46240551-46240573 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
906486785 1:46240980-46241002 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
906741965 1:48192540-48192562 TCCCAGATGGGGTGGCCCCCGGG - Intergenic
906741976 1:48192580-48192602 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
906956738 1:50381423-50381445 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
907009839 1:50952827-50952849 TCCCAGACGGGGCGGCTGCCGGG - Intronic
907089623 1:51711569-51711591 TCCCAGATGGGGTGGCTGCCGGG + Intronic
907182903 1:52586479-52586501 TTCCAGAGGGAGCGGAAAGCAGG - Intergenic
907202913 1:52743029-52743051 TCCCAGATGGGGTGGCGGCCGGG - Intronic
907402467 1:54233419-54233441 TCCCAGATGGGGTGGCTGCCGGG - Intronic
907702443 1:56802145-56802167 TTCCAGATGGGGAAGAAGCCAGG - Intronic
907965512 1:59324858-59324880 TCCCAGATGAGCAGGCAACCAGG - Intronic
908467804 1:64414815-64414837 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
909478995 1:76112487-76112509 TTCCAGATGGGGCGGCTGGCCGG + Intronic
909623031 1:77687260-77687282 TTCCAGACGGGGCGGGAGCTGGG - Intergenic
910343789 1:86215941-86215963 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
910673741 1:89797891-89797913 TCCCAGACGGGGCGGCTGCCGGG + Intronic
910815716 1:91289058-91289080 TCCCGGATGGGGCGGCTGCCGGG + Intronic
910815726 1:91289098-91289120 TCCCAGATGGGGCGGCTGCCAGG + Intronic
911533920 1:99078483-99078505 TCCCAGACGGGGTGGCAGCCAGG + Intergenic
911533996 1:99078689-99078711 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
911569855 1:99508649-99508671 TCCTAGATGGGGTGGCAGCCGGG - Intergenic
911598497 1:99823365-99823387 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
912266167 1:108160153-108160175 TCCCAGACGGGGCGGCTGCCGGG + Intronic
912298286 1:108489447-108489469 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
912316976 1:108675829-108675851 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
912355787 1:109053447-109053469 TCCCAGATGGGGCGGCTGCTGGG - Intergenic
912802475 1:112728754-112728776 TCCCAGATGGGGTGGCGGCCAGG - Intergenic
912808206 1:112774001-112774023 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
912825351 1:112898813-112898835 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
912825457 1:112899242-112899264 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
912844687 1:113068863-113068885 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
912844793 1:113069292-113069314 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
912966669 1:114242541-114242563 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
912966699 1:114242618-114242640 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
912990285 1:114479877-114479899 TTCCGGATGGGGCGGCGGCCGGG - Intronic
913293936 1:117300776-117300798 TCCCAGATGGGGCGGCGGCTGGG + Intergenic
913306000 1:117429875-117429897 TCCCAGATGGGGCGGCTGGCCGG + Intronic
913306206 1:117430366-117430388 TCCCAGATGGGGTGGCTGCCGGG + Intronic
914230965 1:145764599-145764621 TCCCAGACGGGGCGGCTGCCGGG - Intronic
914230979 1:145764639-145764661 TCCCAGACGGGGCGGCTGCCGGG - Intronic
914374576 1:147061926-147061948 TCCCAGATGGGGTTGCAGCCAGG - Intergenic
914392093 1:147232909-147232931 TCCCAGATGGGGTGGCGGCCAGG - Intronic
914392180 1:147233258-147233280 TCCCAGACGGGGCGGCTGCCGGG - Intronic
914780624 1:150781784-150781806 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
914888021 1:151600429-151600451 TTCCAGACGGGGTGGCTGCCAGG - Intergenic
914893781 1:151651298-151651320 TCCCAGATGGGGCGGCTGGCGGG + Intronic
914893842 1:151651438-151651460 TCCCAGATGGGGCGGCTGCCGGG + Intronic
914954030 1:152145223-152145245 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
914959835 1:152196257-152196279 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
914959893 1:152196457-152196479 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
914965797 1:152256319-152256341 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
915112793 1:153575233-153575255 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
915221597 1:154379464-154379486 TGCCAGATGGGGCAGAAGCCTGG + Intergenic
915221615 1:154379543-154379565 TCCCAGATGGGGCAGCAGCCAGG + Intergenic
915221692 1:154379897-154379919 TCCCAGATGGGGCAGGAGCCAGG + Intergenic
915221709 1:154379976-154379998 TCCCAGATGGGGCAGGAGCCAGG + Intergenic
915221737 1:154380094-154380116 TCCCAGATGGGGCGGCAGCCAGG + Intergenic
915861621 1:159450073-159450095 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
915992608 1:160532168-160532190 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
916037327 1:160933343-160933365 TTCCAGACGGGGCGGCTGCCGGG - Intergenic
916050051 1:161029720-161029742 TCCCAGACGGGGCGGCTGCCGGG - Intronic
916050067 1:161029760-161029782 TCCCGGATGGGGCGGCTGCCGGG - Intronic
916087578 1:161281972-161281994 TCCCAGATGGGGTGGCAGCCAGG + Intronic
916131633 1:161616601-161616623 TCCCAGATGGGGTGGCTGCCGGG + Intronic
916131644 1:161616641-161616663 TCCCAGACGGGGCGGCTGCCGGG + Intronic
916131722 1:161616950-161616972 TCCCAGACGGGGTGGCAGCCGGG + Intronic
916320497 1:163499002-163499024 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
916320509 1:163499042-163499064 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
916800016 1:168207844-168207866 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
916800106 1:168208196-168208218 TCCCAGATGGGGTGGCGGCCAGG + Intergenic
916864125 1:168837435-168837457 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
916864156 1:168837516-168837538 TCCCAGACGGGGCGGCGGCCAGG - Intergenic
917304626 1:173613430-173613452 TCCCAGAGGGGGCGGCTGCCGGG - Intronic
917376083 1:174350247-174350269 TCCCAGATGGGGTGGCTGCCGGG + Intronic
917456769 1:175192682-175192704 TGTCAGACGGGGCAGCAACCAGG - Exonic
917553229 1:176057745-176057767 TCCCAGATGGGGTGGCAGCCGGG - Intronic
917582824 1:176396046-176396068 TCCCAGATGGGGCAGCTAGCCGG + Intergenic
917889231 1:179419202-179419224 TCCCAGACGGGGTGGCAGCCGGG + Intronic
918022728 1:180710887-180710909 TCCCAGACGGGGCGGCTGCCGGG + Intronic
918172482 1:182010986-182011008 TCCCAGAGGGGGCGGCTGCCGGG - Intergenic
918228780 1:182509875-182509897 TCCCAGATGGGGTGGCTGCCGGG + Intronic
918701691 1:187616050-187616072 TCCCAGATGGGGCGGCGGCTGGG - Intergenic
918701771 1:187616314-187616336 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
918701793 1:187616391-187616413 TCCCAGATGGGGTGGCAGCTGGG - Intergenic
918812467 1:189139770-189139792 TCCCAGACGGGGCGGCAGCTGGG + Intergenic
918812493 1:189139851-189139873 TCCCAGACGGGGCGGCTGCCAGG + Intergenic
919079892 1:192856755-192856777 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
919959502 1:202452135-202452157 TTCCAGACGGGGTGGCGGCCGGG + Intronic
920065525 1:203266764-203266786 TCCCAGATGGGGCGGCTGCCGGG + Intronic
920226572 1:204443422-204443444 TTGCAGATGGGGCTGCCTCCCGG + Exonic
920451525 1:206064191-206064213 TCCCAGACGGGGCGGCTGCCGGG - Intronic
921043945 1:211460526-211460548 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
921044123 1:211460958-211460980 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
921109090 1:212015021-212015043 TCCCAGATGGGGCGGCTGCCAGG - Intronic
921109102 1:212015061-212015083 TCCCGGATGGGGCGGCTGCCGGG - Intronic
921140010 1:212298418-212298440 TCCCAGATGGGGCGGCTGGCCGG + Intronic
921192697 1:212724655-212724677 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
921192786 1:212724985-212725007 TCCCAGACGGGGCGGCTGCCAGG - Intergenic
921238372 1:213152436-213152458 TCCCAGACGGGGCGGCTGCCGGG + Intronic
921414132 1:214869504-214869526 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
921414313 1:214869919-214869941 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
921813961 1:219545413-219545435 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
922436877 1:225615453-225615475 TCCCAGATGGGGTGGCGGCCAGG - Intronic
922632717 1:227132541-227132563 TCCCAGACGGGGTGGCAGCCAGG - Intronic
922693038 1:227710728-227710750 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
922993006 1:229931878-229931900 TCCCAGAAGGGGCGGCTGCCGGG + Intergenic
923174947 1:231454471-231454493 TTCCAGACGGGGTGGCAGCCGGG - Intergenic
923589791 1:235308885-235308907 TCCCAGATGGGGTGGCAGCCGGG - Intronic
923589890 1:235309274-235309296 TCTCAGATGGGGCGGCTGCCGGG - Intronic
923589902 1:235309314-235309336 TCTCAGATGGGGCGGCTGCCGGG - Intronic
923710795 1:236386752-236386774 TCCCAGATGGGGTGGCTGCCGGG - Intronic
923793027 1:237127621-237127643 TCCCAGACGGGGCGGCTGCCGGG + Intronic
923793117 1:237127970-237127992 TCCCAGATGGGGTGGCGGCCGGG + Intronic
924765980 1:247032324-247032346 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
924824142 1:247522139-247522161 TTCCAGATGGGGCGGCTGCCAGG - Intronic
924824210 1:247522311-247522333 TCCCAGACGGGGCGGCGGCCAGG - Intronic
924943706 1:248830333-248830355 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
924943738 1:248830413-248830435 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
924943751 1:248830453-248830475 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1063084761 10:2806565-2806587 TCCCAGACGGGGCGGCGGCCGGG + Intergenic
1063459667 10:6207023-6207045 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1063744947 10:8869179-8869201 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1063776715 10:9273255-9273277 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1063776868 10:9273724-9273746 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1064070699 10:12226371-12226393 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1064109094 10:12522981-12523003 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1065055342 10:21837670-21837692 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1065335837 10:24656093-24656115 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1065594397 10:27296650-27296672 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1065685878 10:28283954-28283976 TTCCAGATGGGTCTGAAACTGGG - Intronic
1065738128 10:28772138-28772160 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1065840380 10:29696751-29696773 TCCCAGACGGGGTGGCAGCCAGG - Intronic
1066026130 10:31362148-31362170 TCCCAGATGGGGCGGCGGCTGGG + Intronic
1066085827 10:31971010-31971032 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1066115260 10:32233627-32233649 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1066952822 10:42137953-42137975 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1066952895 10:42138262-42138284 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1067026454 10:42847421-42847443 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1067086469 10:43243057-43243079 TTCTAGATGGGGTGGCGGCCGGG - Intronic
1067086588 10:43243475-43243497 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1067086627 10:43243586-43243608 TCCCAGATGGGGCAGCGGCCAGG - Intronic
1067100167 10:43329209-43329231 TCCCAGATGGGGTGGCGGCCAGG - Intergenic
1067325189 10:45260073-45260095 TTCCGGACGGGGTGGCAGCCGGG - Intergenic
1067334020 10:45346973-45346995 TCCCAGATGGGGTGGCAGCTGGG - Intergenic
1067334057 10:45347126-45347148 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1067334229 10:45347734-45347756 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1067334278 10:45347924-45347946 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1067339762 10:45391814-45391836 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1067339793 10:45391918-45391940 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1067391156 10:45865386-45865408 GCCCAGACGGGGCGGCAGCCGGG + Intergenic
1067391328 10:45865950-45865972 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1067871961 10:49970202-49970224 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1067872123 10:49970725-49970747 TCCCAGACGGGGCGGCAGCCGGG - Intronic
1067872152 10:49970802-49970824 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1068536389 10:58244459-58244481 TCCCAGACGGGGCGGCGGCCGGG - Intronic
1068673283 10:59744503-59744525 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1069052671 10:63811590-63811612 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1069157782 10:65052227-65052249 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1069365642 10:67691651-67691673 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1069424770 10:68279413-68279435 TTCCAGACGGGGTGGCGGCCGGG - Intergenic
1069674622 10:70238826-70238848 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1069674654 10:70238940-70238962 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1069674707 10:70239130-70239152 TCCCAGATGGGGTGGCAGCTGGG + Intergenic
1069674854 10:70239663-70239685 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1069674885 10:70239777-70239799 TCCCAGACGGGGCGGCCGCCAGG + Intergenic
1069698952 10:70407826-70407848 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1069732980 10:70631225-70631247 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1069733002 10:70631305-70631327 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1069741440 10:70688024-70688046 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1069929063 10:71870030-71870052 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1070629621 10:78075821-78075843 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1070629682 10:78075980-78076002 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1070629753 10:78076252-78076274 TTCCAGACGGGGTGGCGGCCGGG + Intergenic
1070684131 10:78468840-78468862 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1070807446 10:79279035-79279057 TCCCAGACGGGGCGGCGGCCGGG + Intronic
1070823241 10:79375511-79375533 CTGCAGATGGTGGGGCAACCCGG - Intergenic
1071311566 10:84348038-84348060 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1071476816 10:86032299-86032321 TCCCAGATGGGGTGGCAGCTGGG - Intronic
1071616482 10:87080777-87080799 TCCCAGATGGGGTGGCTGCCAGG - Intronic
1072013435 10:91323446-91323468 TCCCAGACGGGGTGGCAGCCAGG + Intergenic
1072013449 10:91323486-91323508 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1072013551 10:91323874-91323896 TTCCAGACGGGGTGGCGGCCGGG + Intergenic
1072150051 10:92675522-92675544 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1072150146 10:92675911-92675933 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1072602384 10:96941598-96941620 TTCCAGACGGGGTGGCTGCCAGG + Intronic
1072648204 10:97275582-97275604 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1072684624 10:97529001-97529023 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1072772429 10:98152829-98152851 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1072949993 10:99839622-99839644 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1072950099 10:99840051-99840073 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1072999687 10:100277262-100277284 TCCCAGACGGGGTGGCAGCCAGG - Intronic
1073274848 10:102301501-102301523 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1073386064 10:103128905-103128927 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1073386101 10:103128996-103129018 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1075000741 10:118795221-118795243 TCCCAGATGGGGTGGCAGCTGGG - Intergenic
1075013802 10:118895690-118895712 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1075050885 10:119182132-119182154 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1075061661 10:119261134-119261156 TTTCAGACGGGGCGGCTGCCGGG + Intronic
1075091485 10:119446410-119446432 TGCCAGGTGGGACGGCAGCCAGG - Intronic
1075128825 10:119722186-119722208 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1075407310 10:122203474-122203496 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1075677333 10:124304475-124304497 TTCTAGAAGGGGCAGGAACCTGG - Intergenic
1075892954 10:125970259-125970281 TTCCAGATGGGGCGGCTGCTGGG + Intronic
1075892971 10:125970299-125970321 TCCCAGACGGGGCGGCGGCCGGG + Intronic
1076011726 10:126994840-126994862 TCCCAGACGGGGTGGCCACCAGG + Intronic
1076914423 10:133414751-133414773 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1076993856 11:289133-289155 TTCCTGGTGGCGCGGCAGCCGGG + Exonic
1077065139 11:637694-637716 TTCCAGCTGGGGCGGCGGCAGGG + Intronic
1077397542 11:2332546-2332568 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1077668747 11:4137965-4137987 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1077839687 11:5961064-5961086 TCCCGGATGGGGCGGCTGCCGGG - Intergenic
1077839756 11:5961225-5961247 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1077899872 11:6479578-6479600 TTCCACATGGGAATGCAACCAGG - Intronic
1078122420 11:8523554-8523576 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1079018326 11:16888113-16888135 TCTCAGATGGGGCGGCTGCCAGG - Intronic
1079018352 11:16888194-16888216 TCCCAGATGGGGCGGCTGCTGGG - Intronic
1079039892 11:17050745-17050767 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1079444832 11:20548546-20548568 TTCCAGACGGGGTGGCTGCCAGG - Intergenic
1080538399 11:33243845-33243867 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1080538475 11:33244050-33244072 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1080891163 11:36410254-36410276 TTCCAGAGAGGCCGGAAACCTGG - Intronic
1080983077 11:37431193-37431215 TCCCAGACGGGGTGGCAACTGGG + Intergenic
1081288570 11:41303497-41303519 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1081288674 11:41303926-41303948 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1081784822 11:45738671-45738693 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1081784928 11:45739100-45739122 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1082065099 11:47893050-47893072 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1082065115 11:47893090-47893112 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1082166542 11:48956112-48956134 TCCCAGATGGGGTGGCAGCCAGG + Intergenic
1082706210 11:56497276-56497298 TCCCGGATGGGGCGGCTGCCAGG - Intergenic
1082870998 11:57943870-57943892 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1083042278 11:59699805-59699827 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1083079200 11:60073249-60073271 TCCCAGATGGGGCGGCTGCCAGG + Intergenic
1083079272 11:60073519-60073541 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1083120823 11:60510442-60510464 TCCCAGATGGGGCAGCTGCCGGG - Intergenic
1083382299 11:62278759-62278781 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1083646189 11:64172614-64172636 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1083832057 11:65239457-65239479 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1083865367 11:65450805-65450827 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1083865460 11:65451154-65451176 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
1083918092 11:65763254-65763276 TCCCAGATGGCGTGGCAGCCGGG + Intergenic
1084048929 11:66587825-66587847 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1084206556 11:67598086-67598108 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1084388715 11:68861260-68861282 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1084839214 11:71831467-71831489 TCCCGGATGGGGCGGCTGCCGGG - Intergenic
1084839297 11:71831652-71831674 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1084924802 11:72502698-72502720 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1084989532 11:72909831-72909853 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1084989543 11:72909871-72909893 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1085073728 11:73572011-73572033 TCTCAGATGGGGCGGCTGCCAGG - Intronic
1085097720 11:73774831-73774853 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1085097808 11:73775180-73775202 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1085097819 11:73775220-73775242 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1085116712 11:73936869-73936891 TCCCAGACGGGGTGGCAGCCAGG + Intergenic
1085116808 11:73937258-73937280 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1085159668 11:74328527-74328549 TCCCGGACGGGGCGGCAGCCGGG - Intergenic
1085161719 11:74353856-74353878 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1085288324 11:75378884-75378906 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1085288350 11:75378961-75378983 TCCCAGACGGGGCGGCAGCCAGG + Intergenic
1085360096 11:75877976-75877998 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1085360121 11:75878057-75878079 CTCCAGACGGGGCGGCTGCCGGG + Intronic
1085443347 11:76582588-76582610 TCCCGGATGGGGCGGCTGCCGGG + Intergenic
1085480878 11:76821609-76821631 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1085492484 11:76933844-76933866 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1085492498 11:76933884-76933906 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1085513374 11:77098886-77098908 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1085791388 11:79500176-79500198 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1086017267 11:82182162-82182184 TCCCAGATGGGGTGGCTGCCAGG - Intergenic
1086122415 11:83316528-83316550 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1086122702 11:83317382-83317404 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1086290712 11:85306194-85306216 TTGCAGATGAGGCTGAAACCAGG - Intronic
1086434856 11:86770818-86770840 TCTCAGATGGGGCGGCGGCCGGG + Intergenic
1086446746 11:86878673-86878695 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1086697164 11:89860430-89860452 TCCCAGATGGGGTGGCGGCCTGG - Intergenic
1086708995 11:89984057-89984079 TCCCAGATGGGGTGGCGGCCTGG + Intergenic
1086792932 11:91063884-91063906 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1086881678 11:92158130-92158152 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1087198321 11:95321272-95321294 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1087948552 11:104194450-104194472 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1088116371 11:106317851-106317873 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1088659034 11:112027485-112027507 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1089148472 11:116347190-116347212 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1089148486 11:116347230-116347252 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1089148499 11:116347270-116347292 TCCCAGATGGGGCGGCTGCTGGG - Intergenic
1089148552 11:116347401-116347423 TCCCGGATGGGGCGGCTGCCGGG - Intergenic
1089148572 11:116347446-116347468 TCCCGGATGGGGCGGCGGCCGGG - Intergenic
1089420863 11:118331333-118331355 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1089510072 11:118991511-118991533 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1089510147 11:118991714-118991736 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1089585641 11:119508079-119508101 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1090152775 11:124403349-124403371 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1090322911 11:125863046-125863068 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1090331978 11:125939521-125939543 TGCCAGATGGGGCAGAACCCAGG + Intergenic
1090476606 11:127027571-127027593 TAACAGCTGGGGCTGCAACCTGG - Intergenic
1090657370 11:128856321-128856343 TTCCAGACCCGGAGGCAACCAGG + Intronic
1090686700 11:129129346-129129368 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1090791156 11:130091878-130091900 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1091378839 12:42698-42720 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1092296047 12:7200126-7200148 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1092296130 12:7200475-7200497 TCCCAGATGGGGTGGCGGCCAGG + Intronic
1092331487 12:7590381-7590403 TCCCAGACGGGGCGGCTGCCAGG + Intergenic
1092401786 12:8184189-8184211 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1092531485 12:9349100-9349122 TTCCGGATGGTGCGGCGGCCAGG + Intergenic
1092590977 12:9953014-9953036 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1092843737 12:12565820-12565842 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1092849971 12:12618187-12618209 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1092849982 12:12618227-12618249 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1092849993 12:12618267-12618289 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1093038426 12:14354483-14354505 TCCCAGATGGGGTGGCGGCCAGG - Intergenic
1093038560 12:14354920-14354942 TCCCGGATGGGGCGGCAGCCAGG - Intergenic
1093904457 12:24673943-24673965 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1093927752 12:24926000-24926022 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1093927819 12:24926269-24926291 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1094319669 12:29171403-29171425 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1094319678 12:29171443-29171465 TCCCAGATGGGGTGGCAGCTGGG - Intronic
1094319705 12:29171562-29171584 TGCCAGATGGGGCGGCAGCTGGG - Intronic
1094319732 12:29171680-29171702 TGCCAGATGGGGCAGCAGCTGGG - Intronic
1094319763 12:29171838-29171860 TCCCAGATGGGGTGGCGGCCAGG - Intronic
1094319791 12:29171957-29171979 TCCCAGACTGGGCGGCAGCCAGG - Intronic
1094319853 12:29172234-29172256 TCCCAGATGGGGCAGCGACCAGG - Intronic
1094716974 12:33022944-33022966 TCCCAGATGGGGTGGCTGCCAGG + Intergenic
1095281022 12:40352981-40353003 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1095281052 12:40353058-40353080 TCCCAGACGGGGCGGCGGCCGGG + Intronic
1095439472 12:42227678-42227700 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1095452783 12:42350083-42350105 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1095452802 12:42350123-42350145 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1095738818 12:45586053-45586075 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1095738835 12:45586132-45586154 TCCCAGATGGGGCAGCGGCCGGG + Intergenic
1095884099 12:47170489-47170511 TCCCGGATGGGGCGGCGGCCGGG + Intronic
1096022365 12:48333300-48333322 TCCCAGATGGGGTGGCTGCCAGG + Intergenic
1096039411 12:48500666-48500688 TCCCAGATGGGGTGGCTGCCAGG + Intergenic
1096054715 12:48641774-48641796 TCCTAGATGGGGTGGCAGCCGGG - Intergenic
1096054941 12:48642584-48642606 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1096225052 12:49861206-49861228 TCCCGGATGGGGCGGCCAGCCGG - Intergenic
1096424866 12:51492458-51492480 TTCCAGATGGTGCCTCAACCAGG - Intronic
1096951552 12:55479110-55479132 TTCCAGATGGGGCGGCTGGCCGG + Intergenic
1097028529 12:56075893-56075915 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1097052134 12:56230048-56230070 TTCCAGCTGGGGGGGCAGGCAGG - Intronic
1097110063 12:56651778-56651800 TCCCAGACGGGGCGGCTGCCAGG + Intergenic
1097110166 12:56652167-56652189 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1097127108 12:56783873-56783895 TCCCAGACGGGGTGGCAGCCAGG + Intronic
1097127205 12:56784262-56784284 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1097127905 12:56789325-56789347 TCCCGGATGGGGCGGCCAGCCGG + Intergenic
1097138519 12:56879495-56879517 TCCCAGATGGGGCGGCTGCTGGG - Intergenic
1097149229 12:56963919-56963941 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1097228518 12:57495027-57495049 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1097230566 12:57507937-57507959 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1097254814 12:57665303-57665325 TCCCAGATGGGGCGGCGGCCAGG - Intergenic
1097779470 12:63686568-63686590 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1097779545 12:63686877-63686899 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1098018966 12:66134761-66134783 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1098021489 12:66160864-66160886 TTCCAGATGGGGCGGCGGGCGGG + Intronic
1098333157 12:69375256-69375278 TTCCAGATGGGGTCGCGGCCGGG + Intronic
1098379565 12:69853700-69853722 TCCCAGACGGGGAGGCAGCCGGG + Intronic
1098773860 12:74588127-74588149 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1099971260 12:89503525-89503547 TCCCAGACGGGGTGGCAGCCAGG - Intronic
1099971318 12:89503758-89503780 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1099971330 12:89503798-89503820 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1100048274 12:90411333-90411355 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1100570261 12:95840438-95840460 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1100582026 12:95947454-95947476 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1102174994 12:110867888-110867910 TCCCAGATGGGGTGGCTGCCAGG + Intronic
1102293870 12:111723113-111723135 TCCCAGACGGGGCGGCTAGCCGG + Intronic
1102294156 12:111723743-111723765 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1102294167 12:111723783-111723805 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1102323317 12:111957387-111957409 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1102349605 12:112182706-112182728 TTCCAGCTGGAGAGGCTACCAGG - Intronic
1102578415 12:113871935-113871957 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1102656229 12:114484780-114484802 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1103234536 12:119360488-119360510 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1103234597 12:119360721-119360743 TCCCAGATGGGATGGCAGCCGGG + Intronic
1103299876 12:119918892-119918914 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1103350175 12:120278365-120278387 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1103456946 12:121075749-121075771 TTCCAGACGGGGTGGCGGCCGGG - Intergenic
1103641843 12:122357784-122357806 TCCCGGATGGGGCGGCTAGCCGG - Intronic
1103776834 12:123372211-123372233 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1104954021 12:132455021-132455043 TTGCAGATGGGGTGGGAGCCAGG + Intergenic
1105367705 13:19779210-19779232 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1105527173 13:21186999-21187021 TCCCAGATGGGGTGGCAGCTGGG + Intergenic
1105555956 13:21448081-21448103 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1105555969 13:21448121-21448143 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1105921785 13:24970461-24970483 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1105921799 13:24970501-24970523 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1105980571 13:25513154-25513176 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1106495214 13:30269793-30269815 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1106746833 13:32716540-32716562 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1106747612 13:32721320-32721342 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1106747690 13:32721557-32721579 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1106799491 13:33242106-33242128 TTCCAGATGGGGTGGCGGCGGGG - Intronic
1106918589 13:34540671-34540693 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1107042838 13:35967223-35967245 TCCCAGACGGGGCGGCGGCCGGG - Intronic
1107042867 13:35967300-35967322 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1107562763 13:41572274-41572296 TCCCAGACGGGGTGGCAGCCTGG - Intronic
1107588909 13:41882001-41882023 TCTCAGATGGGGCGGCTTCCGGG + Intronic
1107692484 13:42966622-42966644 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1107737773 13:43416680-43416702 TCCCAGATGGGGTGGCGGCCAGG + Intronic
1108052200 13:46457048-46457070 CTCAAGGAGGGGCGGCAACCCGG - Intergenic
1108330236 13:49378192-49378214 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1108330272 13:49378283-49378305 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1108351330 13:49592980-49593002 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1108351366 13:49593070-49593092 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1108370316 13:49761958-49761980 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1108370341 13:49762038-49762060 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1109539084 13:63749144-63749166 CTCAAGGAGGGGCGGCAACCTGG + Intergenic
1110269310 13:73574783-73574805 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1110626561 13:77661050-77661072 TCCCAGACAGGGCGGCAGCCTGG + Intergenic
1110919992 13:81071818-81071840 ATCCAGATGGGATGGCAACCAGG - Intergenic
1110922140 13:81102150-81102172 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1111230695 13:85341092-85341114 TCCCAGATGGGGTGGCGGCCTGG + Intergenic
1111388601 13:87561773-87561795 TCCCAGATGGGGCGACTCCCGGG - Intergenic
1111418346 13:87976697-87976719 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1111418390 13:87976854-87976876 TCCCAGATGGGGTCGCGACCGGG + Intergenic
1111482725 13:88852511-88852533 TCCCAGATGGGGTGGCAGCTGGG + Intergenic
1112077276 13:95928431-95928453 TCCCAGATGGGGCGGCTGCTGGG + Intronic
1112179541 13:97064418-97064440 TGCCAGATGAGGTGGAAACCAGG + Intergenic
1112573958 13:100619011-100619033 TCCCAGATGGGGCGGCCGGCCGG + Intronic
1113194002 13:107782852-107782874 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1114137286 14:19866588-19866610 TCCCAGATAGGGCGGCTGCCAGG - Intergenic
1114137342 14:19866747-19866769 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1114428238 14:22639162-22639184 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1114491972 14:23108331-23108353 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1114491997 14:23108411-23108433 TCCCAGACGGGGCGGCGGCCGGG + Intergenic
1114507806 14:23232053-23232075 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1114507918 14:23232482-23232504 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1114578669 14:23736739-23736761 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1114594222 14:23898215-23898237 TCCCAGACGGGGTGGCAGCCAGG + Intergenic
1114594311 14:23898475-23898497 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
1114594337 14:23898555-23898577 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1115547366 14:34475871-34475893 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1115547511 14:34476346-34476368 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1115622331 14:35152667-35152689 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1116191860 14:41674347-41674369 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1116409031 14:44601187-44601209 TGCCAGATGGGGTGGCGGCCGGG - Intergenic
1116409118 14:44601498-44601520 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1116480348 14:45389198-45389220 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1116729004 14:48598599-48598621 TCCCAGATGGGGCGGCTGCTGGG - Intergenic
1116729021 14:48598639-48598661 TCCCAGATGGGGTGGCTGCCAGG - Intergenic
1116841061 14:49821144-49821166 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1116959606 14:50956463-50956485 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1116959649 14:50956583-50956605 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1117411697 14:55456429-55456451 TCCCAGATGGGGCGGCTGCCGGG + Intronic
1117596820 14:57333616-57333638 TCCCAGACGGGGTCGCAACCGGG - Intergenic
1118340757 14:64894742-64894764 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1118341345 14:64896269-64896291 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1118423615 14:65633959-65633981 TCCCGGATGGGGCGGCTAGCCGG - Intronic
1118428415 14:65692249-65692271 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1118428601 14:65692663-65692685 TCCCAGATGGGGTGGCTGCCAGG + Intronic
1118584675 14:67341353-67341375 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1118584689 14:67341393-67341415 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1118955586 14:70477691-70477713 TCCCAGATGGGGCAGCTGCCGGG - Intergenic
1118955720 14:70477993-70478015 TCCCAGATGGGGCGGCAGCCGGG - Intergenic
1119051798 14:71377169-71377191 TCCCAGATGGGGCGGCGGCCGGG + Intronic
1119254579 14:73184802-73184824 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1119254593 14:73184842-73184864 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1119698626 14:76734712-76734734 TCCCAGATGGGGTGGCAGCCAGG + Intergenic
1119700218 14:76750038-76750060 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1119722054 14:76898222-76898244 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1119835733 14:77747636-77747658 TCCCAGATGGGACGGCTGCCGGG - Intronic
1119835763 14:77747722-77747744 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1119835799 14:77747808-77747830 TCCCGGATGGGGCGGCGGCCAGG - Intronic
1120087098 14:80286792-80286814 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1120087112 14:80286832-80286854 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1120170501 14:81244409-81244431 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1120170562 14:81244567-81244589 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1120309963 14:82814873-82814895 TCCCAGATGGGGTGGCAGCCAGG + Intergenic
1120406592 14:84099652-84099674 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1120505875 14:85353055-85353077 TCCCAGAGGGGGTGGCAGCCGGG + Intergenic
1120547594 14:85829889-85829911 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1120547606 14:85829929-85829951 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1121208332 14:92187851-92187873 TCCCAGATGGGGTGGCGGCCAGG + Intergenic
1121306604 14:92911438-92911460 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1121306786 14:92911850-92911872 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1121531501 14:94657834-94657856 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1122963902 14:105112232-105112254 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1122963997 14:105112621-105112643 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1202848036 14_GL000009v2_random:199839-199861 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1202917513 14_GL000194v1_random:190392-190414 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1123429679 15:20203977-20203999 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1124245822 15:28070241-28070263 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1124335167 15:28850226-28850248 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1125031675 15:35081642-35081664 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1125031825 15:35082171-35082193 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1125031838 15:35082211-35082233 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1125079174 15:35656068-35656090 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1125079537 15:35656913-35656935 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1125459659 15:39894417-39894439 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1125651467 15:41321083-41321105 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1125659030 15:41382008-41382030 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1125659138 15:41382436-41382458 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1125740747 15:41962690-41962712 TCCCAGACGGGGCGGCGGCCGGG - Intronic
1125817795 15:42601463-42601485 TCCCAGACGGGGCGGCGGCCGGG + Intronic
1125861551 15:43005137-43005159 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1125861563 15:43005177-43005199 TCCCAGATGGGGCGGCTGCTGGG - Intronic
1125861613 15:43005305-43005327 TCCCGGATGGGGCGGCTGCCGGG - Intronic
1126573101 15:50172553-50172575 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1126573200 15:50172942-50172964 TCCCGGATGGGGCGGCTGCCGGG - Intronic
1126691882 15:51294512-51294534 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1126799349 15:52285879-52285901 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1126816473 15:52459766-52459788 TCCCAGACGGGGCGGCGGCCGGG + Intronic
1126816502 15:52459843-52459865 TCCCAGATGGGGTGGCGGCCAGG + Intronic
1127072914 15:55302913-55302935 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1127088425 15:55445799-55445821 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1127088501 15:55446061-55446083 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1127088662 15:55446637-55446659 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1127769418 15:62219003-62219025 TCCCGGATGGGGCGGCGGCCGGG - Intergenic
1127853236 15:62933855-62933877 TTTGAGATGGGGCGTCACCCAGG + Intergenic
1127874304 15:63099034-63099056 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1128071355 15:64799241-64799263 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1128071366 15:64799281-64799303 TCTCAGATGGGGCGGCTGCCAGG + Intergenic
1128586836 15:68859546-68859568 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1128970397 15:72101357-72101379 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1129180444 15:73871100-73871122 TTCCAGGTGGGGAGGAAACAGGG - Intergenic
1129428298 15:75480881-75480903 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1129428394 15:75481270-75481292 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1129438159 15:75558939-75558961 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1129810629 15:78507300-78507322 CTCGGGGTGGGGCGGCAACCCGG + Intergenic
1130340825 15:82998327-82998349 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1130428461 15:83822780-83822802 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1130942708 15:88524275-88524297 TCCCAGATGGGGCGGCTGCCAGG - Intronic
1130946531 15:88553223-88553245 CTCCAGATGGGGCGGCTGGCCGG + Intergenic
1130946720 15:88553636-88553658 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1131001416 15:88941905-88941927 TCCCGGATGGGGCGGCTGCCGGG + Intergenic
1131001427 15:88941945-88941967 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1131032791 15:89200419-89200441 TCCCAGATGGGGCGGCTCCCGGG + Exonic
1131125216 15:89853948-89853970 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1131127179 15:89867851-89867873 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1132300768 15:100774232-100774254 TTCCGGACAGGGCGGCAGCCGGG + Intergenic
1132676801 16:1124399-1124421 TACCAGCTGGGGCGGCCAGCAGG - Intergenic
1132992251 16:2802078-2802100 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1133752122 16:8733184-8733206 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1134471791 16:14532688-14532710 TCCCAGACGGGGGGGCGACCGGG + Intronic
1134750076 16:16618915-16618937 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1134854291 16:17506003-17506025 TCCCAGACGGGGCGGCTGCCAGG + Intergenic
1134995399 16:18734724-18734746 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1135575665 16:23583692-23583714 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1135639585 16:24109049-24109071 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1135694300 16:24574129-24574151 TCCCGGATGGGGCGGCTGCCGGG + Intergenic
1135694384 16:24574411-24574433 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1135694395 16:24574451-24574473 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1135694419 16:24574531-24574553 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1135694430 16:24574571-24574593 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1136160567 16:28416685-28416707 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1136202517 16:28698589-28698611 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1136202528 16:28698629-28698651 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1136583594 16:31169561-31169583 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1137240815 16:46653437-46653459 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1137240885 16:46653709-46653731 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1137388114 16:48059265-48059287 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1137430790 16:48416744-48416766 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1137439005 16:48483033-48483055 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1138037762 16:53625450-53625472 CCCCAGATGGGGCGGCTGCCGGG - Intronic
1138400558 16:56740182-56740204 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1138400665 16:56740611-56740633 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1138642676 16:58397392-58397414 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1138699327 16:58846282-58846304 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1139394739 16:66631017-66631039 TCTCAGATGGGGCGGCCGCCGGG - Intronic
1139623214 16:68163598-68163620 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1139633503 16:68244783-68244805 TTACAGATGCGGGGGGAACCGGG - Intergenic
1139885449 16:70204701-70204723 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1140063287 16:71589558-71589580 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1140161217 16:72496916-72496938 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1140881412 16:79201181-79201203 TTGCAGATGGGGTGGCAATATGG - Intronic
1140994082 16:80243294-80243316 TCCCAGACGGGGCGGCTGCCAGG - Intergenic
1140994095 16:80243334-80243356 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1140994290 16:80243798-80243820 TTCCGGATGGGGCGGCTGGCCGG - Intergenic
1140994421 16:80244105-80244127 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1141728821 16:85808560-85808582 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1142657422 17:1403333-1403355 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1142704981 17:1689223-1689245 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1142705252 17:1689852-1689874 TCCCGGATGGGGCGGCTGCCGGG + Intergenic
1142705264 17:1689892-1689914 TCCCAGAGGGGGCGGCTGCCGGG + Intergenic
1142705277 17:1689932-1689954 TCCCAGACGGGGCGGCTGCCAGG + Intergenic
1143008833 17:3854409-3854431 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1143667619 17:8373584-8373606 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1143667714 17:8373931-8373953 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1143884795 17:10057513-10057535 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1143884876 17:10057722-10057744 TTCCAGACGGGGCGGTGGCCAGG - Intronic
1144481928 17:15637046-15637068 TCCCAGATGGGGTGGCTACCGGG - Intronic
1144482092 17:15637415-15637437 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1144536372 17:16095324-16095346 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1144541338 17:16145618-16145640 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1144559794 17:16312196-16312218 TCCCAGATGGGGCGGCTGCCGGG + Intronic
1144673431 17:17145936-17145958 GTCCAGATGAGGCGGGTACCAGG - Intronic
1144724278 17:17493910-17493932 TTCCAGACAGGGTGGCACCCTGG + Intergenic
1144860321 17:18297833-18297855 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1145047276 17:19628052-19628074 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1145087089 17:19951154-19951176 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1145158369 17:20557494-20557516 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1145174145 17:20685210-20685232 TTCCCGATGGGGCGGCTGGCCGG - Intergenic
1145205692 17:20984090-20984112 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1145205797 17:20984519-20984541 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1145205834 17:20984609-20984631 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1145418137 17:22741349-22741371 TCCCAGATGGGGCAGCTGCCAGG - Intergenic
1145717201 17:27033952-27033974 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1145733864 17:27212706-27212728 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1145862829 17:28223905-28223927 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1145895717 17:28456249-28456271 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1145920235 17:28604411-28604433 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1145927578 17:28659388-28659410 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1145927617 17:28659519-28659541 TCCCAGATGGGGTGGCAGCCGGG + Intronic
1146048962 17:29533426-29533448 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1146155788 17:30523142-30523164 TTCCAGACGGGGTGGCGGCCGGG - Exonic
1146155869 17:30523454-30523476 TCCCAGATGGGGTGGCTGCCGGG - Exonic
1146361203 17:32178867-32178889 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1146731278 17:35195207-35195229 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1147024149 17:37565803-37565825 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1147024161 17:37565843-37565865 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1147278333 17:39337396-39337418 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1147622318 17:41876133-41876155 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1147785066 17:42973121-42973143 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1147963209 17:44180092-44180114 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1147963302 17:44180481-44180503 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1147974172 17:44238172-44238194 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1148277369 17:46317133-46317155 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1148299558 17:46534921-46534943 TCTCAGATGGGGCGGCTGCCAGG + Intronic
1148406455 17:47420706-47420728 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1148632847 17:49125673-49125695 TCCCAGACGGGGCGGCCACAGGG - Intergenic
1148672260 17:49419800-49419822 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1149593083 17:57846389-57846411 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1149625113 17:58074449-58074471 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1149632935 17:58142239-58142261 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1149633054 17:58142675-58142697 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1149908858 17:60551353-60551375 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1150380544 17:64716433-64716455 TTCCAGACGGGGTGGCGGCCGGG - Intergenic
1150380613 17:64716706-64716728 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1150403029 17:64874570-64874592 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1150477154 17:65484233-65484255 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1150518300 17:65837562-65837584 TCCCAGACGGGGCGGCAGCCGGG - Intronic
1150557729 17:66269149-66269171 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1150780230 17:68116137-68116159 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1150780301 17:68116336-68116358 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1150894575 17:69196120-69196142 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1150894718 17:69196598-69196620 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1151843794 17:76636743-76636765 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1152161737 17:78673028-78673050 TCCCGGCTGGGGCGGCAAGCTGG + Intergenic
1152873854 17:82774570-82774592 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1153633972 18:7098259-7098281 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1154089615 18:11344756-11344778 TCCCAGATGGGGCAGCAGCCGGG - Intergenic
1154115311 18:11608893-11608915 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1154115944 18:11613485-11613507 TCCCAGATGGGGTGGCGGCCAGG - Intergenic
1154116134 18:11614192-11614214 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1154158074 18:11959462-11959484 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1154158189 18:11959927-11959949 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1154289945 18:13098376-13098398 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1154398343 18:14011087-14011109 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1154420198 18:14222737-14222759 TCCTAGATGGGGTGGCAACCGGG - Intergenic
1154943498 18:21137794-21137816 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1154943573 18:21138061-21138083 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1154990133 18:21592397-21592419 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1156326327 18:36077807-36077829 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1156326339 18:36077847-36077869 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1157639843 18:49202832-49202854 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1157677428 18:49578179-49578201 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1157677536 18:49578608-49578630 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1157705097 18:49799625-49799647 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1157763710 18:50282539-50282561 TTCCAGATGGGGGAGCCGCCCGG - Exonic
1158646819 18:59255389-59255411 TCCTAGATGGGGTGGCAGCCGGG - Intergenic
1159158060 18:64609077-64609099 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1159614904 18:70569742-70569764 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1160465453 18:79072789-79072811 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1160916586 19:1499485-1499507 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1161340358 19:3738603-3738625 TTCCTGCTGGGGCTGCCACCAGG + Exonic
1161601741 19:5188364-5188386 CTCCAGAGGATGCGGCAACCAGG + Intronic
1161685836 19:5702222-5702244 TCCCAGACGGGGCGGCTAGCCGG - Intronic
1161685956 19:5702500-5702522 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1162163784 19:8739188-8739210 TTCCAGACGGGGTGGCGGCCAGG - Intergenic
1162255120 19:9483422-9483444 TCCCAGATGGGGTGGCTGCCAGG - Intronic
1162255238 19:9483689-9483711 TCCCAGACGGGGCGGCGGCCGGG - Intronic
1162255267 19:9483766-9483788 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1162573701 19:11486752-11486774 TTCCAGGTGAGGCCGCCACCCGG - Exonic
1162683157 19:12362130-12362152 TCCCAGATGGGGTGGCAGCCAGG - Intronic
1162694984 19:12467551-12467573 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1162886715 19:13702850-13702872 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1162886820 19:13703279-13703301 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1163542367 19:17918711-17918733 TCCCAGACGGGGCGGCTAGCCGG - Intergenic
1163558501 19:18005823-18005845 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1163865555 19:19770251-19770273 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1163904239 19:20137688-20137710 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1163904296 19:20137918-20137940 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1163905959 19:20150205-20150227 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1163906064 19:20150634-20150656 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1163909422 19:20176062-20176084 TCCCAGATGGGGCGGCTGCCAGG + Intronic
1163913033 19:20214307-20214329 TCCCAGATGGGGTGGCGACCGGG - Intergenic
1163945502 19:20530464-20530486 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1163986188 19:20953011-20953033 TCCCAGACGGGGTGGCAGCCAGG + Intergenic
1164012143 19:21212677-21212699 TCTCAGATGGGGCGGCTGCCAGG + Intergenic
1164016399 19:21259492-21259514 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1164016574 19:21260177-21260199 TCCCAGACGGGGCAGCAACCGGG + Intronic
1164016755 19:21260900-21260922 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1164016780 19:21260977-21260999 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1164016824 19:21261167-21261189 TCCCAGACGGGGTGGCAGCCAGG + Intronic
1164017257 19:21264360-21264382 TCCCAGATGGGGCGGCGGCCAGG - Intronic
1164017268 19:21264400-21264422 TCCCAGATGGGGCAGCGGCCAGG - Intronic
1164017330 19:21264674-21264696 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1164017400 19:21264990-21265012 TCCCAGATGGGGCGGCAGCTGGG - Intronic
1164017482 19:21265337-21265359 TCCCAGATGGGGAGGCAGCTGGG - Intronic
1164043190 19:21511273-21511295 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1164054063 19:21607163-21607185 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1164054977 19:21614817-21614839 TCCCAGATGGGATGGCAGCCGGG - Intergenic
1164055016 19:21614969-21614991 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1164065002 19:21707955-21707977 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1164065085 19:21708165-21708187 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1164066856 19:21722108-21722130 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1164071831 19:21775955-21775977 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1164081821 19:21866064-21866086 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1164105272 19:22105206-22105228 TCCCGGATGGGGCGGCTGCCAGG - Intergenic
1164106095 19:22107880-22107902 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1164168030 19:22700316-22700338 TCCCAGACGGGGTGGCAGCCAGG + Intergenic
1164168549 19:22703130-22703152 TCCCAGATCGGGCGGCTGCCAGG + Intergenic
1164186192 19:22871635-22871657 TCCCAGATGGGGTGGCAGCCAGG + Intergenic
1164186257 19:22871868-22871890 TTCCAGATGGGATGGCGGCCGGG + Intergenic
1164192036 19:22926025-22926047 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1164217153 19:23160734-23160756 TCCCAGATGGGGTGGCGGCCAGG + Intergenic
1164218691 19:23173413-23173435 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1164231279 19:23290395-23290417 TCCCAGACGGGGTGGCGACCGGG + Intergenic
1164238935 19:23366214-23366236 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1164244685 19:23419413-23419435 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1164256637 19:23533570-23533592 TCCCAGATGGGGTGGCTGCCAGG + Intronic
1164256660 19:23533650-23533672 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1164256726 19:23533917-23533939 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1164263841 19:23594569-23594591 TCCCAGATGGGGTGGCGGCCAGG - Intronic
1164263985 19:23595053-23595075 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1164301063 19:23963814-23963836 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1164301154 19:23964163-23964185 TCCCAGATGGGGTGGCTGCCAGG - Intergenic
1164301316 19:23964523-23964545 TCCCGGATGGGGCGGCGGCCGGG - Intergenic
1164653210 19:29901198-29901220 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1164653316 19:29901627-29901649 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1164659314 19:29949186-29949208 TCCCAGATGGGGCGGCTGCCGGG + Intronic
1165199378 19:34132627-34132649 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1165547851 19:36556678-36556700 TGGCAGATGGGGCAGCAGCCAGG - Intronic
1165852166 19:38855879-38855901 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1166028622 19:40108873-40108895 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1166029780 19:40118019-40118041 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1166029817 19:40118109-40118131 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1166049818 19:40252035-40252057 CTCCAGCTGGAGAGGCAACCAGG + Intronic
1166193313 19:41190355-41190377 TCCCAGATGGGGTGGGAAGCTGG + Intergenic
1166244385 19:41515305-41515327 TCCCAGATGGTGGGGCAGCCGGG - Intergenic
1166261462 19:41644320-41644342 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1166421446 19:42639678-42639700 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1166496707 19:43308043-43308065 TTCCATAGCGGGCAGCAACCTGG - Intergenic
1166611697 19:44204088-44204110 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1167038711 19:47009529-47009551 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1167540898 19:50086554-50086576 TCCCAGACGGGGTGGCTACCGGG - Intergenic
1167548089 19:50141115-50141137 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1167605311 19:50478826-50478848 GCCCAGATGGGGAGGGAACCTGG + Intronic
1167924703 19:52812161-52812183 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1168696044 19:58405061-58405083 TCCCAGATGGGGCGGCTGGCCGG + Intronic
925911667 2:8577780-8577802 TTCAAGATGGGGCACCAGCCAGG - Intergenic
926170303 2:10548921-10548943 TTCCAGATGGGACATCCACCCGG - Intergenic
926215523 2:10903028-10903050 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
926322659 2:11759916-11759938 TCCCAGACGGGGCGGCTGCCGGG + Intronic
926322756 2:11760267-11760289 TCCCAGATGGGGTGGCAGCCGGG + Intronic
926498012 2:13616222-13616244 TCCCAGAGGGGGCGGCAGCAAGG - Intergenic
926498025 2:13616262-13616284 TCCCAGATGGTGGGGCAGCCGGG - Intergenic
927141311 2:20132812-20132834 TTTCAGATGGGGCAGAAAACAGG + Intergenic
927755677 2:25705925-25705947 TCCCAGATGGGGTGGCCGCCGGG - Intergenic
927777134 2:25911192-25911214 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
927833424 2:26371446-26371468 TCCCAGATGGGGTGGCGGCCGGG + Intronic
928585575 2:32755014-32755036 TCTCAGATGGGGCGGCTGCCGGG + Intronic
928687166 2:33761424-33761446 TCCCAGACGGGGCGGCTCCCAGG + Intergenic
928888836 2:36180156-36180178 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
928888850 2:36180196-36180218 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
928888991 2:36180556-36180578 TTCCAGACGGGGCGGCTGGCCGG - Intergenic
928934641 2:36662817-36662839 TCCCAGATGGGGAGGCGGCCAGG - Intergenic
929066090 2:37977518-37977540 TCCCGGATGGGGCGGCTGCCAGG + Intronic
929066104 2:37977558-37977580 TCCCAGATGGGGCGGCTGCTGGG + Intronic
929151942 2:38756035-38756057 TCCCAGACGGGGCGGCTGCCGGG + Intronic
929238318 2:39628387-39628409 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
929516262 2:42606256-42606278 TCCCAGATGGGGTGGCTGCCGGG + Intronic
929517902 2:42621651-42621673 TCCCAGACGGGGTGGCAGCCGGG + Intronic
929577779 2:43063251-43063273 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
929614502 2:43297378-43297400 TCCCAGATGGGGTGGCTGCCGGG - Intronic
929650801 2:43677946-43677968 TCCCAGACGGGGCGGCTGCCGGG + Intronic
930202291 2:48557131-48557153 TCCCAGATGGGGTGGCTGCCGGG + Intronic
930703864 2:54485601-54485623 TCCCAGATGGGGTGGCGGCCGGG - Intronic
930727793 2:54698807-54698829 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
930727863 2:54699079-54699101 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
930827102 2:55705718-55705740 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
930833944 2:55773898-55773920 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
931479848 2:62630106-62630128 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
931576405 2:63722488-63722510 TCCCAGACGGGGCGGCTGCCGGG - Intronic
931656299 2:64512376-64512398 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
932410269 2:71543097-71543119 TTCCAGACGGGGCGGCTGCCGGG + Intronic
932577924 2:72972908-72972930 TTCCAGTGGGGGGGGCCACCAGG + Intronic
932718911 2:74123941-74123963 TCCCAGATGGGGTGGCAGTCGGG - Intergenic
932718946 2:74124058-74124080 TCGCAGATGGGGCGGCTGCCGGG - Intergenic
932718977 2:74124140-74124162 TCCCAGATGGGGCGGCTGGCGGG - Intergenic
933868453 2:86545491-86545513 TCCCAGATGGGGCGACTGCCGGG + Intronic
933869160 2:86549665-86549687 TCCCAGATGGGGTGGCGGCCGGG + Intronic
934067096 2:88350562-88350584 CTCCAAGTGGGGCGGCCACCGGG - Intergenic
934128368 2:88920673-88920695 TCCCAGACTGGGCGGCTACCGGG - Intergenic
934128797 2:88926324-88926346 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
934309656 2:91851872-91851894 TCCCAGATGGGGTGGCTGCCAGG - Intergenic
934309690 2:91851962-91851984 TCCCAGATGGGGCGGCTGCCCGG - Intergenic
934998458 2:98988777-98988799 TTCTGGACGGGGCGGCAGCCGGG + Intergenic
934998566 2:98989043-98989065 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
935131559 2:100264821-100264843 TCCCAGGTGGGGCGGCATCTGGG + Intergenic
935636122 2:105251064-105251086 TTCCAGACGGGGTGGCGGCCGGG - Intergenic
935667640 2:105526160-105526182 TGCCATGTGGGGCGGCTACCTGG - Intergenic
936546009 2:113393891-113393913 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
936546104 2:113394280-113394302 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
937437612 2:121892904-121892926 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
937734866 2:125277096-125277118 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
937734879 2:125277136-125277158 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
937919563 2:127119995-127120017 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
937947494 2:127353498-127353520 TCCCAGACGGGGCGGCTGCCGGG - Intronic
938006123 2:127788766-127788788 TCCCAGATGGGGCGGCTGGCCGG + Intronic
938006161 2:127788857-127788879 TCCCAGATGGGGTGGCTGCCGGG + Intronic
938055061 2:128208526-128208548 TCCCAAATGGGGCGGCAGCTGGG - Intergenic
938055130 2:128208842-128208864 TCCCAGATGGGGCGGCAGCCGGG - Intergenic
938055174 2:128209038-128209060 TCCCAGATAGGGCGGAAGCCTGG - Intergenic
938055259 2:128209432-128209454 TCCCAGATGGGGCGGCAGCCGGG - Intergenic
938720700 2:134064266-134064288 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
938836138 2:135105642-135105664 TCCCAGATGGGGTGGCGGCCGGG - Intronic
938836237 2:135106031-135106053 TCCCAGATGGGGCGGCTGCCGGG - Intronic
938836248 2:135106071-135106093 TCCCGGATGGGGCGGCTGCCGGG - Intronic
939578593 2:143922368-143922390 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
939578606 2:143922408-143922430 TCCCAGACGGGGCGGCTGCCAGG + Intergenic
940643165 2:156367971-156367993 TTCCAGACGGGGTGGCGGCCGGG - Intergenic
940817278 2:158310675-158310697 TCCCAGATGGGGTGGCGGCCGGG + Intronic
941025122 2:160449093-160449115 TCCCAGACGGGGCGGCTGCCGGG - Intronic
941025197 2:160449300-160449322 TCCCAGATGGGGTGGCGGCCGGG - Intronic
941603173 2:167564059-167564081 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
941822335 2:169855988-169856010 TCCCAGATGGGGGGGCTGCCAGG + Intronic
941822359 2:169856068-169856090 TCCCAGACGGGGCGGCTGCCGGG + Intronic
941847673 2:170149448-170149470 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
942012115 2:171774480-171774502 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
942021027 2:171866869-171866891 TCCCAGACGGGGCGGCTGCCGGG + Intronic
942024644 2:171899805-171899827 TCCCAGATGGGACGGCGGCCGGG - Intronic
942024705 2:171900038-171900060 TCCCAGACGGGGCGGCTACCGGG - Intronic
942096077 2:172537582-172537604 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
942096104 2:172537698-172537720 TCCCAGATGGGATGGCAGCCGGG - Intergenic
942355622 2:175108212-175108234 TCTCAGATGGGGCGGCTGCCGGG - Intronic
942621029 2:177845227-177845249 TCCCAGATGGGGTGGCTGCCGGG + Intronic
942630139 2:177945618-177945640 TCCCAGACGGGGCGGCTGCCGGG - Intronic
942630152 2:177945658-177945680 TCCCAGATGGGGTGGCTGCCGGG - Intronic
943005787 2:182386644-182386666 TCTCAGATGGGGCGGCTGCCGGG - Intronic
943005848 2:182386815-182386837 TCCCAGACGGGGCGGCGGCCGGG - Intronic
943100334 2:183479269-183479291 TTCCAGATGGGGCGACTGCCTGG - Intergenic
943125756 2:183792284-183792306 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
943297178 2:186154167-186154189 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
943323420 2:186472931-186472953 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
943411718 2:187556659-187556681 TCTCAGATGGGGCGGCTGCCGGG - Intronic
943587688 2:189760278-189760300 TCCCAGACGGGGTGGCAGCCGGG + Intronic
943648314 2:190430901-190430923 TCCCAGATGGGGTGGCTGCCGGG + Intronic
943773381 2:191741977-191741999 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
944283385 2:197922922-197922944 TCCCAGATGGGGCGGCTGGCCGG + Intronic
944283549 2:197923314-197923336 TCCCAGATGGGGTGGCTGCCGGG + Intronic
944316810 2:198293008-198293030 ATCCTGGTGGGGCGGCAACGTGG + Intronic
944570837 2:201042633-201042655 TCCCGGATGGGGCGGCTGCCAGG - Intronic
944585068 2:201166141-201166163 TCCCAGATGGGGCGGCCAGGCGG + Exonic
944598308 2:201282535-201282557 TCCCAGATGGGGCGGCTGGCCGG + Intronic
944797956 2:203207218-203207240 TCCCAGATGGGGTGGCTGCCAGG - Intronic
944815672 2:203373048-203373070 TCCCAGATGGGGTGGCGGCCGGG + Intronic
945114996 2:206401059-206401081 TTCCAGACGGGGCGGCTGGCCGG + Intergenic
945115152 2:206401424-206401446 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
945864921 2:215163845-215163867 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
946240072 2:218348790-218348812 TCCCAGATGGGGTGGCCGCCAGG + Intergenic
946304203 2:218846739-218846761 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
946447283 2:219751050-219751072 TCCCAGATGGGGCGGCGGCTGGG + Intergenic
946447351 2:219751232-219751254 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
946742597 2:222816395-222816417 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
947797794 2:232905824-232905846 TCCCAGACGGGGTGGCAGCCGGG - Intronic
947901392 2:233724396-233724418 TCCCAGATGGGGTGGCTGCCGGG + Intronic
948589153 2:239038472-239038494 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1169086202 20:2825137-2825159 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1169115585 20:3063310-3063332 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1169125609 20:3125027-3125049 TACCAGATGGGGTGGCTGCCAGG - Intronic
1169125641 20:3125140-3125162 TCCCAGATGGGGTGGCTGCCAGG - Intronic
1169125657 20:3125217-3125239 TCCCAGATGGGGTGGCTGCCAGG - Intronic
1169125777 20:3125676-3125698 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1169370825 20:5027645-5027667 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1169441719 20:5639188-5639210 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1169441790 20:5639354-5639376 TCCCTGATGGGGCGGCTGCCAGG + Intergenic
1169441801 20:5639394-5639416 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1169788479 20:9385610-9385632 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1169991910 20:11513460-11513482 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1169991936 20:11513540-11513562 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1170202525 20:13760554-13760576 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1170425042 20:16227905-16227927 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1170425147 20:16228334-16228356 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1170592183 20:17779219-17779241 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1170645623 20:18194316-18194338 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1170645703 20:18194592-18194614 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1171366130 20:24626272-24626294 TCCCAGATGGGGTGGCAGCCGGG + Intronic
1171463659 20:25312901-25312923 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1171463718 20:25313057-25313079 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1171496835 20:25561832-25561854 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1171848363 20:30291581-30291603 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1171861246 20:30405017-30405039 TCCCAGATGGGGTGGCTGCCAGG - Intergenic
1171899914 20:30847215-30847237 TCTCAGATGGGGCGGCTGCCAGG + Intergenic
1172059063 20:32176171-32176193 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1172059074 20:32176211-32176233 TCCCGGATGGGGCGGCTGCCGGG - Intergenic
1172279310 20:33699293-33699315 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1172279958 20:33701528-33701550 TCCCAGATGGGGTGGCTGCCCGG - Intergenic
1172337867 20:34132487-34132509 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1172348549 20:34223427-34223449 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1172349933 20:34230829-34230851 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1172379241 20:34474852-34474874 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1172465454 20:35153273-35153295 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1172739057 20:37151162-37151184 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1172797411 20:37550659-37550681 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1172817808 20:37702902-37702924 TTCCAGAAGGGGAAACAACCAGG - Intronic
1172910771 20:38407560-38407582 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1173406627 20:42771846-42771868 ATCCAGAGGGGGAGGGAACCAGG + Intronic
1173524741 20:43723163-43723185 TCCCAGATGGTGTGGCAGCCAGG - Intergenic
1173794687 20:45851109-45851131 ATCCAAATGGGGAGTCAACCAGG + Intronic
1174596555 20:51688766-51688788 TACCAGAGGGGGAGGCAGCCTGG - Intronic
1176656774 21:9594112-9594134 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1176797308 21:13379854-13379876 TCCCAGATGGGGTGGCAGTCGGG - Intergenic
1177134177 21:17292249-17292271 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1177178508 21:17720606-17720628 TCCCGGATGGGGCGGCTGCCGGG + Intergenic
1177178519 21:17720646-17720668 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1177788312 21:25695704-25695726 TTCCAGATGGGGCGGCTGCCAGG + Intronic
1178873163 21:36392644-36392666 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1179195210 21:39157388-39157410 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
1179969178 21:44824881-44824903 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1180039398 21:45268393-45268415 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1180039483 21:45268742-45268764 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1180672021 22:17561029-17561051 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1180861328 22:19084599-19084621 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1181247202 22:21511657-21511679 TTAGAGATGGGACAGCAACCTGG - Intergenic
1181273898 22:21676879-21676901 TCCCAGATGGGGTGGCAGCCGGG + Intronic
1181274009 22:21677203-21677225 TCCCAGATGGGGTTGCAGCCAGG + Intronic
1181296887 22:21847406-21847428 TCCCAGACGGGGTGGCAGCCAGG - Intronic
1181296946 22:21847638-21847660 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1181296969 22:21847715-21847737 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1181982243 22:26773538-26773560 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1182377385 22:29858167-29858189 TTCCGGATGGGGTGGCTGCCGGG + Intergenic
1182399819 22:30066818-30066840 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1182616839 22:31593192-31593214 TCCCAGATGGGGCGGCTGCCGGG + Intronic
1182976399 22:34626560-34626582 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1183185689 22:36290557-36290579 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1183321026 22:37165236-37165258 TTCCAAAGGTGGCGGCAGCCTGG - Intronic
1183537236 22:38410127-38410149 TCCCAGATGGGGTGGCAGTCGGG + Intergenic
1183595229 22:38807134-38807156 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1183841509 22:40502217-40502239 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1183845237 22:40536943-40536965 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1183871361 22:40744752-40744774 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1183940998 22:41294948-41294970 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1183995725 22:41631324-41631346 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1184145409 22:42607518-42607540 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1184145513 22:42607907-42607929 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1184201274 22:42971495-42971517 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1184201411 22:42971905-42971927 TTCCAGACGGGGCGGCGGCCGGG - Intronic
1184609583 22:45594266-45594288 TTCGTGATGGGGAGGCAGCCAGG + Intronic
949989928 3:9570209-9570231 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
950044285 3:9940020-9940042 TCCCAGACGGGGCGGCTGCCGGG + Intronic
950060820 3:10070221-10070243 TCTCAGATGGGGCGGCTGCCGGG - Intronic
950110672 3:10416898-10416920 TCCCAGATGGGGCGGCAGCCGGG + Intronic
950110701 3:10417016-10417038 TCCCAGATAGGGCGGCAGCCAGG + Intronic
950110744 3:10417139-10417161 TCCCAGATGGGGCGGTGGCCAGG + Intronic
950110795 3:10417340-10417362 TCCCAGATGGTGCAGCAGCCGGG + Intronic
950253739 3:11487799-11487821 TCCCAGATGGGGTGGCTGCCGGG + Intronic
950412706 3:12849715-12849737 TCCCAGATGGGGTGGCTGCCGGG + Intronic
950742402 3:15061975-15061997 TCCCAGACGGGGCGGCTGCCGGG - Intronic
950754694 3:15162809-15162831 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
951013609 3:17705404-17705426 TCCCAGATGGGGTGGCTGCCGGG + Intronic
951197509 3:19840455-19840477 TCCCAGATGGTGGGGCAGCCAGG - Intergenic
951264178 3:20547929-20547951 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
951290574 3:20867377-20867399 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
952308788 3:32169501-32169523 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
952885868 3:38010613-38010635 GTCCAGATGGGTGGGCAGCCAGG - Intronic
952892622 3:38053509-38053531 TCCCAGACGGGGCGGCTGCCGGG - Intronic
952896554 3:38081952-38081974 TCCCAGATGGGGTGGCTGCCGGG + Intronic
953084858 3:39655922-39655944 TCCCAGATGGGGCGGCAGGGCGG - Intergenic
953084876 3:39655962-39655984 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
953257489 3:41305630-41305652 TCCCAGACGGGGTGGCAGCCGGG - Intronic
953306996 3:41840784-41840806 TCCCAGATGGAGTGGCAGCCGGG - Intronic
953322275 3:41983242-41983264 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
953534227 3:43765175-43765197 TTCCAGCTGGGACCGCATCCTGG + Intergenic
953652640 3:44821048-44821070 TCCCGGATGGGGCGGCAGGCCGG + Intronic
953959491 3:47256403-47256425 TCCCAGATGGGGTGGCTGCCGGG - Intronic
953966201 3:47309290-47309312 TCCCAGACGGGGCGGCGGCCGGG + Intronic
953966236 3:47309407-47309429 TTCCAGATGGGGTCGCGGCCGGG + Intronic
954060324 3:48061681-48061703 TCCCAGACGGGGCGGCTGCCGGG - Intronic
954080544 3:48210938-48210960 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
954080650 3:48211367-48211389 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
954162911 3:48734706-48734728 TCCCAGATGGGGCGGCTGGCCGG - Intronic
954481224 3:50803671-50803693 TCCCAGATGGGGCGGCTACCAGG + Intronic
954481245 3:50803716-50803738 TCCCAGATGGGGCGGCTGGCCGG + Intronic
954481337 3:50803936-50803958 TCCCAGATGGGGCGGCTGCCGGG + Intronic
954566920 3:51607704-51607726 TCCCAGACGGGGCGGCGGCCGGG + Intronic
954566952 3:51607781-51607803 TCCCAGATGGGGTGGCGGCCGGG + Intronic
954566982 3:51607858-51607880 TCCCAGATGGGGCGGCGGCCGGG + Intronic
954567068 3:51608063-51608085 TCCCAGACGGGGCGGCTGCCGGG + Intronic
954599804 3:51858831-51858853 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
955297243 3:57747032-57747054 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
955394900 3:58550288-58550310 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
955434892 3:58890534-58890556 TCCCAGACGGGGCGGCTAGCCGG + Intronic
956270337 3:67443890-67443912 TCCCAGATGGGGTGGCTGCCGGG - Intronic
956803816 3:72788316-72788338 TCCCAGATGGGGTCGCAGCCGGG - Intronic
957316792 3:78583494-78583516 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
957620042 3:82584277-82584299 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
957620199 3:82584806-82584828 TCCCAGATGGGGCGGCTGGCTGG - Intergenic
957789309 3:84918915-84918937 TCCCGGACGGGGCGGCGACCGGG - Intergenic
958406281 3:93761361-93761383 TCCCAGATGGGGTGGCGACCGGG + Intergenic
958406292 3:93761401-93761423 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
958406306 3:93761441-93761463 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
958560742 3:95744761-95744783 TCCCAGATGGGGCGGCTGGCTGG + Intergenic
958560794 3:95744907-95744929 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
958560866 3:95745219-95745241 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
958808909 3:98838203-98838225 TCCCAGATGGGGTGGCTGCCGGG + Intronic
959042613 3:101439331-101439353 TCCCAGATGGGGTGGCTGCCGGG - Intronic
959419465 3:106112131-106112153 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
959419569 3:106112559-106112581 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
959683682 3:109123783-109123805 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
960030109 3:113046739-113046761 TTCCGGACGGGGCGGCTGCCGGG + Intergenic
960087761 3:113608934-113608956 TTCCAGAGGAGGCGGCAAGCTGG + Intronic
960344895 3:116519355-116519377 TCCCAGACGGGGCGGCTGCCGGG - Intronic
960344923 3:116519432-116519454 TCCCAGATGGGGTGGCAGCCGGG - Intronic
960577594 3:119242926-119242948 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
960625010 3:119674010-119674032 TCCCAGACGGGGCAGCAGCCGGG - Intronic
960697979 3:120414191-120414213 TCCCAGACGGGGTGGCAGCCAGG - Intronic
960770699 3:121190575-121190597 TCCCAGATGGGGTGGCGGCCGGG + Intronic
960770777 3:121190776-121190798 TCCCAGATGGGGCGGCTGCTGGG + Intronic
960861914 3:122164102-122164124 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
960862018 3:122164531-122164553 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
960866160 3:122202004-122202026 TCCCAGATGGGGTGGCAGCCGGG + Intronic
960918831 3:122725324-122725346 TCCCAGATGGGGTGGCGGCCGGG + Intronic
960920903 3:122747063-122747085 TCCCAGATGGGGTGGCGGCCGGG - Intronic
960921065 3:122747601-122747623 TCCCAGATGGGGCGGCTGGCCGG - Intronic
960924101 3:122780029-122780051 TCCCAGATGGGGTGGCAGCCGGG + Intronic
961120771 3:124368298-124368320 TCCCAGATGGGGTGGCTGCCGGG + Intronic
961498079 3:127308972-127308994 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
961498092 3:127309012-127309034 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
961498124 3:127309094-127309116 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
961704391 3:128773235-128773257 TCTCAGATGGGGCGGCTGCCGGG - Intronic
961704414 3:128773315-128773337 TCTCAGATGGGGCGGCTGCCGGG - Intronic
961784512 3:129340035-129340057 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
962063206 3:131952402-131952424 TCCCAGATGGGGTGGCTGCCGGG - Intronic
962113057 3:132471402-132471424 TCCCAGATGGGGTGGCTGCCGGG + Intronic
962572179 3:136723491-136723513 TCCCAGATGGGGTGGCTGCCGGG - Intronic
962623084 3:137198596-137198618 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
962688808 3:137872794-137872816 TCCCAGATGGGGCGGCTGCCAGG - Intergenic
962688888 3:137873000-137873022 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
962761833 3:138521603-138521625 TCCCAGATGGGGTGGCGGCCAGG - Intronic
962787912 3:138784993-138785015 TCCCAGACGGGGCGGCTGCCGGG - Intronic
963776333 3:149444893-149444915 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
963776410 3:149445094-149445116 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
965302362 3:167018903-167018925 TCCCAGATGGGGCAGCTGCCAGG - Intergenic
965302423 3:167019071-167019093 TACCAGATGGGGTGGCGGCCGGG - Intergenic
965358795 3:167710788-167710810 TTCCAGAGGTGGTGGCAACAGGG + Intronic
965649978 3:170923410-170923432 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
965650033 3:170923639-170923661 TCCCAGATGGGGTCGCAGCCGGG - Intergenic
965650076 3:170923796-170923818 TGTCAGATGGGGCGGCTGCCAGG - Intergenic
965650151 3:170923982-170924004 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
966015514 3:175132881-175132903 TCTCAGATGGGGCGGCTGCCGGG + Intronic
966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG + Intergenic
966351073 3:179032960-179032982 TCCCAGATGGGGTGGCGGCCGGG - Intronic
966617220 3:181925985-181926007 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
966895502 3:184441747-184441769 TCCCAGACAGGGCGGCACCCAGG + Intronic
966967008 3:185004065-185004087 TCCCAGATGGGGTGGCGGCCAGG + Intronic
966973937 3:185069090-185069112 TTCCAGGTGGGGCAGAAGCCTGG - Intergenic
967127219 3:186435396-186435418 TCCCAGACGGGGCGGCCGCCGGG + Intergenic
967169476 3:186812016-186812038 TCCCAGACGGGGTGGCAGCCAGG + Intergenic
967177486 3:186873981-186874003 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
967295769 3:187963259-187963281 TTCTAGATGTGGCGGGCACCAGG - Intergenic
967529212 3:190529900-190529922 TCCTAGATGGGGCAGCAGCCAGG - Intronic
967754037 3:193148344-193148366 TTCAAGATGGAGCTGCAATCAGG + Intergenic
968042435 3:195599781-195599803 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
968156604 3:196385851-196385873 TCCCAGATGGGGTGGCGGCCGGG - Intronic
968201822 3:196761893-196761915 TCCCAGATGGGGTGGCTGCCGGG + Intronic
968397509 4:256570-256592 TCCCAGATGGTGGGGCAGCCAGG + Intergenic
968852666 4:3094436-3094458 TCCCAGATGGGGTGGCGGCCGGG + Intronic
968924213 4:3538750-3538772 TCCCAGATGGGGCGGCTGGCTGG + Intergenic
970472726 4:16393497-16393519 TCCCGGATGGGGCGGCTGCCGGG + Intergenic
971282069 4:25249534-25249556 TCCCAGATGGGGCGGCTGCCGGG + Intronic
971282083 4:25249574-25249596 TCCCAGATGGGGCGGCTGCTGGG + Intronic
971594837 4:28514973-28514995 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
972304714 4:37820509-37820531 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
972700734 4:41491450-41491472 TCCTAGATGGGGTGGCGACCGGG + Intronic
972938426 4:44167909-44167931 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
972939721 4:44181892-44181914 TCTCAGATGGGGCGGCTGCCAGG - Intronic
972939745 4:44181972-44181994 TCTCAGATGGGGCGGCTGCCGGG - Intronic
973021224 4:45207699-45207721 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
973021296 4:45207966-45207988 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
973021356 4:45208196-45208218 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
973263436 4:48186783-48186805 TCCCAGATGGGGCGGCTGGCAGG - Intronic
973274500 4:48292823-48292845 TACCAGACGGGGTGGCAGCCGGG - Intergenic
973281498 4:48364032-48364054 TCCCAGATGGGGTGGCTGCCGGG + Intronic
973593428 4:52464943-52464965 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
973650416 4:52992669-52992691 TCCCAGATGGGGTGGCGGCCAGG - Intronic
973664132 4:53139603-53139625 TCCCAGACGGGGCAGCAGCCGGG - Intronic
973664160 4:53139680-53139702 TCCCAGATGGGGTGGCGGCCGGG - Intronic
973672730 4:53237535-53237557 TCCCAGATGGGGCGGCTGGCCGG + Intronic
973673165 4:53238557-53238579 TCCCAGATGGGGCGGCTGCCGGG + Intronic
973673178 4:53238597-53238619 TCCCAGACGGGGCGGCTGCCAGG + Intronic
974490942 4:62563899-62563921 TTCAAGGTGGGTCGGCAAGCTGG - Intergenic
974597869 4:64037359-64037381 TCCCAGATGGGGTCGCAGCCGGG - Intergenic
974597890 4:64037436-64037458 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
974848870 4:67381760-67381782 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
974870671 4:67637408-67637430 TCCCAGACGGGGTGGCAGCCGGG - Intronic
975063792 4:70037595-70037617 TCCCAGATGGGGTCGCAGCCGGG - Intergenic
975063823 4:70037712-70037734 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
975063869 4:70037839-70037861 TCCCAGATGGGGCGGCTGCCCGG - Intergenic
975633455 4:76423497-76423519 TCTCAGATGGGGCGGCTGCCAGG - Intergenic
975848489 4:78548398-78548420 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
975908807 4:79245465-79245487 TCCCAGATGGGGTGGCGGCCGGG - Intronic
975908830 4:79245545-79245567 TCCCAGATGGGGTGGCGGCCGGG - Intronic
976149428 4:82077877-82077899 TCCCAGATGGGGTGGCTGCCAGG - Intergenic
976149498 4:82078044-82078066 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
977205029 4:94157684-94157706 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
977205144 4:94158153-94158175 TCCCAGACGGGGCGGCTGCCAGG - Intergenic
978014197 4:103723113-103723135 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
978156980 4:105500643-105500665 TCCCAGATGGGGTGGCAGCCAGG + Intergenic
978224914 4:106321505-106321527 TCCCAGACGGGGCGGCTGCCGGG - Intronic
978376149 4:108077361-108077383 TCCCAGACAGGGCGGCAGCCGGG - Intronic
978376162 4:108077401-108077423 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376175 4:108077441-108077463 TCCCAGACTGGGCGGCAGCCGGG - Intronic
978376187 4:108077481-108077503 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376200 4:108077521-108077543 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376213 4:108077561-108077583 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376226 4:108077601-108077623 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376239 4:108077641-108077663 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376261 4:108077721-108077743 TCCCAGATGGGGCAGCAGCCGGG - Intronic
978527138 4:109678503-109678525 TCCCAGATGGGGCGGTGGCCGGG + Intronic
979482883 4:121238699-121238721 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
979702449 4:123684767-123684789 TCCTAGATGGGGTGGCAGCCAGG - Intergenic
979702555 4:123685153-123685175 TCCCAGATGGGGCAGCTGCCAGG - Intergenic
979941794 4:126771402-126771424 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
980883676 4:138739442-138739464 TCCCAGACGGGGCGGCTGCCAGG - Intergenic
981524077 4:145693900-145693922 TCCCAGATGGGGTGGCTGCCGGG + Intronic
981524088 4:145693940-145693962 TCCCAGATGGGGTGGCTGCCGGG + Intronic
981970436 4:150659556-150659578 TCCCAGATGGGGTGGCTGCCGGG - Intronic
981970696 4:150660146-150660168 TCCCAGATGGGGCGGCTGGCCGG - Intronic
982017275 4:151167681-151167703 TCCCAGATGGGGCGGCGGTCGGG - Intronic
982017308 4:151167798-151167820 TCCCAGATGGGGCGGCAGCCAGG - Intronic
982026146 4:151255183-151255205 TCCCAGATGGGGTGGCTGCCGGG + Intronic
982053632 4:151526760-151526782 TCTCAGATGGGGCGGCTGCCGGG + Intronic
982075221 4:151731525-151731547 TCCCAGACGGGGTGGCAGCCGGG - Intronic
982075294 4:151731834-151731856 TCTCAGATGGGGCGGCTGCCGGG - Intronic
982182871 4:152765397-152765419 TCCCGGATGGGGCGGCTGCCGGG + Intronic
982723462 4:158882144-158882166 TCTCAGATGGGGCGGCTGCCGGG - Intronic
982723509 4:158882304-158882326 TCCCAGATGGGGCAGCTGCCGGG - Intronic
982784185 4:159523211-159523233 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
982784198 4:159523251-159523273 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
982821022 4:159940240-159940262 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
983015197 4:162604932-162604954 TCCCAGATGGTGTGGCAGCCAGG - Intergenic
983613710 4:169679010-169679032 TCCCAGACGGGGCGGCTGCCGGG + Intronic
983613739 4:169679087-169679109 TCCCAGATGGGGCGGCTGCCGGG + Intronic
983628729 4:169828405-169828427 TCCCAGACGGGGCGGCTGCCAGG - Intergenic
983664460 4:170166360-170166382 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
983905974 4:173183710-173183732 TCCCAGACGGGGCGGCGGCCGGG + Intronic
983906026 4:173183835-173183857 TCCCAGACGGGGCGGCTGCCGGG + Intronic
983906036 4:173183875-173183897 TCCCAGACGGGGCGGCTGCCGGG + Intronic
984037794 4:174691802-174691824 TCCCAGATGGGGTGGCGGCCGGG - Intronic
984728225 4:183041235-183041257 TCCCAGAGGGGGTGGCAGCCAGG + Intergenic
984813799 4:183819130-183819152 TCCCAGAGGGGGTGGCAGCCAGG + Intergenic
984977187 4:185240668-185240690 TTCCGGACGGGGCGGCTGCCGGG + Intronic
985216363 4:187658135-187658157 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
985216375 4:187658175-187658197 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
987469284 5:18309725-18309747 TCTCAGATGGGGCGGCTGCCAGG - Intergenic
988532775 5:32040658-32040680 TCCCAGATGGGGTGGCAGCCAGG - Intronic
988532845 5:32040926-32040948 TCCCAGATGGGGTGGCAGCCGGG - Intronic
988551993 5:32208078-32208100 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
989068249 5:37484140-37484162 TCCCAGACGGGGTGGCAGCCGGG + Intronic
989075807 5:37563272-37563294 TTCCGGATGGGGCGGCTGGCCGG + Intronic
989252685 5:39334451-39334473 TCCCAGATGGGGTGTCAGCCAGG - Intronic
989252813 5:39334790-39334812 TCCCAGATGGGGTGGCGGCCGGG - Intronic
989633397 5:43510851-43510873 TCCCAGATGGGGTGGCGTCCGGG - Intronic
989655852 5:43746049-43746071 TCCCAGATGGGGTGGCTGCCAGG + Intergenic
989663396 5:43824400-43824422 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
989663469 5:43824602-43824624 TCCCAGATGGGGCGGCTGCTGGG + Intergenic
989977858 5:50607876-50607898 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
990293885 5:54381461-54381483 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
990293911 5:54381541-54381563 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
990297743 5:54420600-54420622 TCCCAGAAGGGGCGGCCGCCGGG + Intergenic
990501024 5:56397729-56397751 TCCCAGATGGGGTGGCGACCGGG + Intergenic
990709219 5:58563674-58563696 TCCCAGACGGGGCGGCAGCCAGG + Intergenic
990709230 5:58563714-58563736 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
990871116 5:60431658-60431680 TCCCAGACGGGGTGGCAGCCGGG + Intronic
991073806 5:62513788-62513810 TCCCAGACGGGGTGGCAGCCAGG + Intronic
991375174 5:65958205-65958227 TCCCAGATGGGGTGGCGGCCGGG + Intronic
991690474 5:69220501-69220523 TCCCAGACGGGGCGGCTGCCTGG - Intronic
991935210 5:71794040-71794062 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
991935238 5:71794121-71794143 TCCCAGACGGGGCGGCGGCCGGG + Intergenic
992289643 5:75270419-75270441 TTCCGGACGGGGCGGCTGCCGGG - Intergenic
992373738 5:76171150-76171172 TCCCAGACGGGGTGGCAGCCGGG - Intronic
992373832 5:76171539-76171561 TCCCAGATGGGGTGGCTGCCGGG - Intronic
992391771 5:76336478-76336500 TCCCAGATGGGGTGGCGGCCAGG + Intronic
992443066 5:76812590-76812612 TCCCAGACGGGGCGGCTAGCCGG - Intergenic
992470103 5:77043736-77043758 TCCCAGATGGGGTGGCTGCCGGG + Intronic
992540724 5:77761028-77761050 TCCCAGACGGGGCGGCAGCCGGG - Intronic
992574459 5:78096770-78096792 TCCCAGACGGGGCGGCTGCCGGG - Intronic
992801668 5:80300981-80301003 TCCCAGACGGGGTGGCGACCGGG - Intergenic
992801935 5:80301807-80301829 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
992964219 5:81983699-81983721 TCCCAGATGGGGTGGCTGCCGGG + Intronic
992964294 5:81984012-81984034 TTCCAGACGGGGTGGCAGCCAGG + Intronic
992978004 5:82139601-82139623 TCCCAGATGGGGTGGCTGCCGGG - Intronic
993496702 5:88616211-88616233 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
993657714 5:90595582-90595604 TCCCAGATGGGGCGGCTGGCCGG + Intronic
993657881 5:90595986-90596008 TTTCAGACGGGGCGGCTGCCGGG + Intronic
993657911 5:90596103-90596125 TCCCAGATGGGGTGGCGGCCGGG + Intronic
993723333 5:91343000-91343022 TCCCAGACGGGGCGGCGGCCGGG + Intergenic
993934717 5:93986258-93986280 TCCCAGATGGGGCGGCTGCTGGG - Intronic
993934735 5:93986298-93986320 TCCCAGATGGGGCGGCTGCTGGG - Intronic
994517155 5:100785694-100785716 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
994517175 5:100785771-100785793 TCCCAGATGGGGCGGCTGCCAGG - Intergenic
995161790 5:108992600-108992622 TCCCAGATGGGGCGGCTGGCCGG + Intronic
995193201 5:109341050-109341072 TCCCAGACGGGGTGGCAGCCGGG - Intronic
995193309 5:109341479-109341501 TCCCAGATGGGGTGGCTGCCGGG - Intronic
995236219 5:109832867-109832889 TCCCAGACGGGGCGGCTGCCGGG + Intronic
995421087 5:111967666-111967688 TCCCAGATGGGGCGGCAGCTGGG - Intronic
995515990 5:112955049-112955071 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
995994466 5:118282704-118282726 TCCCAGATGGGGTGGCGATCGGG - Intergenic
996054126 5:118965199-118965221 TCCCAGATGGGGCGGCTGCTGGG - Intronic
996057708 5:118999177-118999199 TCCCAGATGGGGCGGCTGCTGGG - Intergenic
996070072 5:119122539-119122561 TCTCAGATGGGGCGGCTGCCGGG + Intronic
996070158 5:119122889-119122911 TCCCAGATGGGGTGGCGGCCGGG + Intronic
996159811 5:120147832-120147854 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
996159887 5:120148140-120148162 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
996386340 5:122913578-122913600 TCTCAGATGGGGCGGCTGCCGGG + Intronic
996716175 5:126589833-126589855 TCCCAGATGGGGCGGCAGCTGGG - Intronic
996716199 5:126589951-126589973 TTCCAGATGGGGCAGCAGCTGGG - Intronic
996716215 5:126590030-126590052 TTCCAGACGGGGCGGCAGCTGGG - Intronic
996716230 5:126590108-126590130 TTCCAGACGGGGTGGCAGCTGGG - Intronic
997321726 5:132983516-132983538 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
997433476 5:133857773-133857795 TCCCAGATGGGGTGGCGGCCAGG + Intergenic
997433572 5:133858150-133858172 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
998025289 5:138811113-138811135 TCTCAGATGGGGCGGCTGCCGGG + Intronic
998060067 5:139112564-139112586 TCCCAGACGGGGCGGCTGCCGGG - Intronic
998232016 5:140366959-140366981 ATCCAGCTGGGGCAGCAACTGGG + Intronic
998432188 5:142076499-142076521 TCCCAGATGGGGTGGCTGCCAGG + Intergenic
998461671 5:142314556-142314578 TTCCTGCTGGGTCTGCAACCAGG - Exonic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999455583 5:151713921-151713943 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
999604174 5:153296978-153297000 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
999979072 5:156940712-156940734 TCCCAGACGGGGCGGCTGCCGGG - Intronic
999979100 5:156940789-156940811 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1000103529 5:158037581-158037603 TCCCAGACGGGGTGGCAGCCAGG + Intergenic
1000630207 5:163583702-163583724 TCCCGGATGGGGCGGCTGCCGGG + Intergenic
1000630244 5:163583822-163583844 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1000630266 5:163583899-163583921 TCCCAGATGGGGTGGCAGTCGGG + Intergenic
1000985264 5:167858920-167858942 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1000985361 5:167859309-167859331 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1001077897 5:168643589-168643611 TCCCAGATGGGGTGGCTGCCAGG + Intergenic
1001394238 5:171404292-171404314 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1001777539 5:174339877-174339899 TTCCACATGGAGTGGCATCCTGG - Intergenic
1002008123 5:176252725-176252747 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1002013652 5:176305025-176305047 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1002031578 5:176433999-176434021 TTCCAGACGGGGTGGCTGCCAGG - Intergenic
1002118510 5:176983876-176983898 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1002341394 5:178518728-178518750 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1002626116 5:180531087-180531109 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1002626165 5:180531221-180531243 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1004152397 6:13133705-13133727 TCCCAGACGGGGTGGCAGCCAGG - Intronic
1004387967 6:15188537-15188559 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1004388073 6:15188966-15188988 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1004448915 6:15726902-15726924 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1004664249 6:17735674-17735696 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1005414464 6:25586151-25586173 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1005607049 6:27485646-27485668 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1005710899 6:28502353-28502375 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1005710957 6:28502512-28502534 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1005837620 6:29719656-29719678 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1005901742 6:30222288-30222310 TCCTAGATGGGGTGGCAGCCAGG + Intergenic
1005929736 6:30474892-30474914 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1005929823 6:30475242-30475264 TCCCAGACGGGGCGGCTGCCAGG - Intergenic
1005933188 6:30498835-30498857 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1006014165 6:31067288-31067310 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1006014244 6:31067597-31067619 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1006064779 6:31454956-31454978 TCCCGGATGGGGCGGCTGCCGGG + Intergenic
1006069149 6:31485136-31485158 TTGCAGATGGGCCTGCAAACTGG + Intergenic
1006128476 6:31854433-31854455 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1006145782 6:31958889-31958911 TACCCGAGGGGGCGGCAACCGGG + Exonic
1006209915 6:32385329-32385351 TTCCGGATGGGGTGGCTGCCGGG + Intergenic
1006209924 6:32385369-32385391 TCCCAGACGGGGTGGCAGCCAGG + Intergenic
1006225391 6:32532383-32532405 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1006225418 6:32532460-32532482 TCCCAGAAGGGGTGGCAGCCGGG - Intergenic
1006232451 6:32596110-32596132 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1006346300 6:33485754-33485776 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1006492255 6:34397499-34397521 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1006617576 6:35340574-35340596 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1006826766 6:36941431-36941453 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1006826845 6:36941743-36941765 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1006826896 6:36941870-36941892 TCCCGGATGGGGCGGCGGCCGGG - Intergenic
1007295199 6:40815960-40815982 CCCCAGATGGGGCGGCGGCCAGG - Intergenic
1007442224 6:41872410-41872432 TCCCAGACGGGGCGGCGGCCAGG - Intronic
1007544926 6:42686599-42686621 TCCCAGATGGGGTGGCGGCCAGG + Intronic
1007545000 6:42686800-42686822 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1007651554 6:43425467-43425489 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1007674306 6:43581050-43581072 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1008106359 6:47444126-47444148 TCCCAGATGGGGCGGCTGCCAGG + Intergenic
1008112194 6:47505958-47505980 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1008377602 6:50809965-50809987 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1008377614 6:50810005-50810027 TCCCAGAAGGGGCGGCTGCCAGG + Intergenic
1008571959 6:52825244-52825266 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1008572008 6:52825436-52825458 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1008572047 6:52825587-52825609 TCCCAGATGGGGCAGCTGCCAGG - Intergenic
1008624754 6:53305437-53305459 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1008909855 6:56720991-56721013 TTCCAGACGGGGCGGCTGCCGGG + Intronic
1008909891 6:56721076-56721098 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1008909929 6:56721160-56721182 TCCCAGATGGGGCGGCTGCCGGG + Intronic
1008909946 6:56721202-56721224 TCCCAGATGGGGCAGCTGCCAGG + Intronic
1008919150 6:56824416-56824438 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1008926181 6:56894197-56894219 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1009049068 6:58257846-58257868 TCCCAGATGGGGTGGCTGCCAGG - Intergenic
1009217891 6:60945057-60945079 TCCCAGACGGGGCGGCTGCCAGG - Intergenic
1009392693 6:63163759-63163781 TCCCAGATGGGGTGGCGGCCAGG - Intergenic
1009392767 6:63164026-63164048 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
1009392780 6:63164103-63164125 TCTCAGATGGGGTGGCAGCCGGG - Intergenic
1009398300 6:63228156-63228178 TTCCAGACAGGGCGGCGACTGGG + Intergenic
1009398407 6:63228681-63228703 TCCCAGACAGGGCGGCAGCCTGG + Intergenic
1009622677 6:66096857-66096879 TCCCGGATGGGGCGGCTGCCGGG + Intergenic
1009622755 6:66097169-66097191 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1009844754 6:69121690-69121712 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1009844797 6:69121849-69121871 TCCCAGATGGGGTGGCGGCCAGG + Intronic
1009868920 6:69432473-69432495 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1009868933 6:69432513-69432535 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1009869137 6:69433188-69433210 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1010264426 6:73851207-73851229 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1010300574 6:74255036-74255058 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1010300713 6:74255550-74255572 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1010513059 6:76744064-76744086 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1010513175 6:76744533-76744555 TCCCAGATGGGGCGGCTGCCAGG - Intergenic
1011297326 6:85838933-85838955 TCCCAGATGGGGCGGCTTGCCGG - Intergenic
1011588094 6:88947483-88947505 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1011588242 6:88947934-88947956 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1011626474 6:89287363-89287385 GTCCAGCTGGGGAAGCAACCAGG + Intronic
1012012524 6:93807209-93807231 TTCCAGATGAGGGTGCAGCCTGG - Intergenic
1012428605 6:99141787-99141809 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1012428715 6:99142216-99142238 TCCCAGACGGGGTGGCTACCGGG - Intergenic
1013190823 6:107803153-107803175 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1013326009 6:109046922-109046944 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1013326067 6:109047060-109047082 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1013369295 6:109455747-109455769 TTCCTGTTGGGCTGGCAACCAGG + Exonic
1013530797 6:111017489-111017511 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1013638015 6:112047519-112047541 TTCCAGACGGGGTGGCGGCCGGG - Intergenic
1014557090 6:122849373-122849395 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1014557125 6:122849464-122849486 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1014763796 6:125388286-125388308 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1015070645 6:129088706-129088728 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1015476557 6:133664380-133664402 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1015476663 6:133664809-133664831 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1016123628 6:140373905-140373927 TCCCAGATGGGGCGGCTGCCAGG + Intergenic
1016476448 6:144433539-144433561 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1016476545 6:144433928-144433950 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1016479873 6:144470299-144470321 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1016479884 6:144470339-144470361 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1016802291 6:148179333-148179355 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1017063444 6:150507534-150507556 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1017851531 6:158309127-158309149 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1017855797 6:158349391-158349413 TCCCAGATGGGGTGGCAGCCGGG + Intronic
1017855849 6:158349586-158349608 TCCCAGATAGGGTGGCAGCCGGG + Intronic
1017981914 6:159407459-159407481 TCCCAGAGGGGGCGGCTGCCGGG - Intergenic
1018163314 6:161069403-161069425 TTCCAGGTGGGGAGGCAGCATGG + Intronic
1018295359 6:162339171-162339193 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1018528078 6:164736070-164736092 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1019128469 6:169857122-169857144 TCCCAGATGGGGTGGCGACCGGG + Intergenic
1019337535 7:492418-492440 TTTCTGATGGGGCGGCAGCTGGG - Intergenic
1019439108 7:1038085-1038107 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1019439146 7:1038176-1038198 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1019445755 7:1070187-1070209 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1019669063 7:2268184-2268206 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1019669113 7:2268380-2268402 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1019813056 7:3179092-3179114 TTCCAGATGAGACAGCACCCAGG - Intergenic
1020157260 7:5736762-5736784 TCCCAGATGGGGTCGCAGCCTGG - Intronic
1020326116 7:6975724-6975746 TCCCAGATGGGGTGGCGGCCCGG + Intergenic
1020498801 7:8890369-8890391 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1020616535 7:10466041-10466063 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1020616610 7:10466353-10466375 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1021735326 7:23636700-23636722 TTCCAGACGGGGTGGCTGCCAGG - Intronic
1021872167 7:25018054-25018076 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1021872271 7:25018483-25018505 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1022187783 7:27987065-27987087 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1022187875 7:27987414-27987436 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1022187973 7:27987665-27987687 TCCCAGATGGGGTGGCAGCCGGG - Intronic
1022318104 7:29263863-29263885 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1022700348 7:32754009-32754031 TCCCAGATGGGGCGGCTGCCAGG - Intergenic
1022757124 7:33304376-33304398 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1023044192 7:36197171-36197193 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1023971242 7:44992614-44992636 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1024305177 7:47922770-47922792 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1024538794 7:50459949-50459971 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1025102876 7:56150558-56150580 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1025102890 7:56150598-56150620 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1025572990 7:62599844-62599866 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1025793583 7:64717734-64717756 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1025796061 7:64738994-64739016 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1025800742 7:64784521-64784543 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1025800840 7:64784910-64784932 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1025803663 7:64809654-64809676 TCCCAGATGGGGCTGCTGCCGGG + Intronic
1025808184 7:64855921-64855943 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1025808287 7:64856350-64856372 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1025828976 7:65033680-65033702 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1026163567 7:67890503-67890525 TCCCAGATGGGGCGGCGGCCGGG - Intergenic
1026186109 7:68083184-68083206 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1026186189 7:68083485-68083507 TCCCAGATGGGGCAGCTGCCGGG - Intergenic
1026783253 7:73284065-73284087 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1026868210 7:73835972-73835994 TCCCAGACGGGGCGGCTGCCAGG - Intronic
1026868223 7:73836012-73836034 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1027371074 7:77509211-77509233 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1027374020 7:77534210-77534232 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1027826761 7:83125283-83125305 TTCCAGAGGGGGCGGCGGCCGGG - Intronic
1027826782 7:83125323-83125345 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1028227288 7:88266226-88266248 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1028535653 7:91887714-91887736 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1028535741 7:91888019-91888041 TTCCAGACGGGGCAGCTGCCGGG - Intergenic
1028548162 7:92027087-92027109 TCCTAGATGGGGTGGCAGCCGGG - Intronic
1028685603 7:93586242-93586264 TCCCAGACGGGGCGGCTGCCAGG + Intergenic
1029430133 7:100523806-100523828 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1029569230 7:101359289-101359311 TCCCGGATGGGGCGGCTAGCCGG + Intergenic
1029813132 7:103069107-103069129 TCCCAGAGGGGGCGACAGCCAGG - Intronic
1029813171 7:103069267-103069289 TTCCAGATGGGGCGGCAACCAGG - Intronic
1030036410 7:105411330-105411352 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1030329354 7:108255848-108255870 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1032028660 7:128463619-128463641 TGCCAGACGGGGCGGCTGCCGGG - Intergenic
1032028680 7:128463660-128463682 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1032028708 7:128463739-128463761 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1032156874 7:129476293-129476315 TCCCAGATGCGGCGGCTGCCGGG + Intronic
1032156924 7:129476453-129476475 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1032418260 7:131755863-131755885 TCCCAGACGGGGCGGCGGCCGGG + Intergenic
1032418292 7:131755980-131756002 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1032418304 7:131756020-131756042 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1032418326 7:131756097-131756119 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1032569455 7:132984473-132984495 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1032589373 7:133177659-133177681 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1033090207 7:138378834-138378856 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1033090237 7:138378911-138378933 CCCCAGACGGGGCGGCTACCGGG + Intergenic
1033219834 7:139520633-139520655 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1033294086 7:140114970-140114992 TCCCGGATGGGGCGGCTGCCGGG - Intronic
1034322522 7:150198683-150198705 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1034961912 7:155368019-155368041 TTCCAGACGGGGTGGCGGCCGGG + Intergenic
1035507982 8:150086-150108 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1035508087 8:150515-150537 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1035612106 8:973546-973568 TTCCAGATGGGGTGGCAGCTGGG + Intergenic
1036536746 8:9657797-9657819 TCCCGGATGGGGCGGCTGCCGGG + Intronic
1036536852 8:9658226-9658248 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1036737196 8:11330035-11330057 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1036737207 8:11330075-11330097 TCCCGGATGGGGCGGCTGCCAGG - Intergenic
1037647398 8:20805045-20805067 TCCCAGATGGTGTGGCGACCAGG + Intergenic
1038167974 8:25103196-25103218 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1038340852 8:26683885-26683907 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1038340902 8:26684075-26684097 TCCCAGATGGGGCGGTCACCTGG + Intergenic
1039072265 8:33658419-33658441 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1039153376 8:34529359-34529381 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1039488213 8:37927920-37927942 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1039650908 8:39339252-39339274 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1039750637 8:40475183-40475205 CTTCAGATGGGGCAGCAAACAGG - Intergenic
1039753158 8:40496463-40496485 TCCCAGACGGGGCGGCTGCCAGG + Intergenic
1040041325 8:42919140-42919162 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1040043602 8:42940068-42940090 TCCCAGACGGGGCGGCGGCCGGG + Intronic
1040052831 8:43033132-43033154 TCCCAGACGGGGCGGCTGCCAGG + Intronic
1040093322 8:43419593-43419615 TCCCAGATTGGGCGGCTGCCGGG + Intergenic
1040517826 8:48148694-48148716 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1040616205 8:49041414-49041436 TTCCAGACGGGGTGGCGGCCAGG + Intergenic
1040916993 8:52573603-52573625 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1040917002 8:52573643-52573665 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
1041286916 8:56272067-56272089 TCCCAGTAGGGGCGGCAGCCAGG + Intergenic
1041358057 8:57022033-57022055 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
1041362919 8:57071477-57071499 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1041513593 8:58676486-58676508 TCCCAGATGGGGCGGCTGCTGGG + Intergenic
1041728031 8:61036383-61036405 CTGCAGGTGGGGCAGCAACCTGG + Intergenic
1041796647 8:61753239-61753261 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1042048837 8:64685275-64685297 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1042048943 8:64685704-64685726 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1042196148 8:66232638-66232660 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1042196191 8:66232735-66232757 TCCCAGATGGGGCGGCTGGCTGG - Intergenic
1042281302 8:67059363-67059385 TGCCAGATCGGGAGGCAACTTGG - Exonic
1042303544 8:67310896-67310918 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1042475590 8:69245427-69245449 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1042912849 8:73844946-73844968 TCCCAGACGGGGCGGCTGCCAGG - Intronic
1042912912 8:73845108-73845130 TCCCAGACGGGGCGGCGGCCAGG - Intronic
1043958472 8:86389758-86389780 TCCCGGATGGGGCGGCTGCCCGG + Intronic
1043958494 8:86389803-86389825 TCCCAGATGGGGCGGCTGGCGGG + Intronic
1043958514 8:86389849-86389871 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1043961562 8:86423915-86423937 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1043961602 8:86424041-86424063 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1043961615 8:86424081-86424103 TCTCAGATGGGGCGGCTGCCAGG + Intronic
1043986017 8:86694496-86694518 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1044582211 8:93834426-93834448 TCCCAGATGGGGTGGCAGCCAGG + Intergenic
1044582224 8:93834466-93834488 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1044637482 8:94341093-94341115 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1044660488 8:94590305-94590327 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1044660593 8:94590734-94590756 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1044996263 8:97840901-97840923 TCCCAGATGGGGTGGCAGCCGGG + Intronic
1044996292 8:97841018-97841040 TCCCAGATGGGGCGGCGGCTGGG + Intronic
1044996310 8:97841097-97841119 TCCCAGATGGGGCAGCAGCCGGG + Intronic
1045021904 8:98051790-98051812 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
1045021931 8:98051870-98051892 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1045120389 8:99028815-99028837 TCCCAGATGGGGCGGCTGGCCGG + Intronic
1045195652 8:99927342-99927364 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1046703587 8:117426882-117426904 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1047099066 8:121657025-121657047 TCCCAGATGGGGTGGCGGCCTGG + Intergenic
1047266577 8:123314771-123314793 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1047266881 8:123315497-123315519 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1047388686 8:124432416-124432438 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1047848154 8:128826663-128826685 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1047848249 8:128827052-128827074 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1048368391 8:133757703-133757725 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1048672253 8:136736290-136736312 TTGCAGGTAGAGCGGCAACCAGG + Intergenic
1049828301 8:144684760-144684782 TTCCAGCTCGGGGGGCAACCGGG + Intergenic
1049976002 9:861782-861804 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1050417926 9:5434439-5434461 TCCCAGACGGGGCGGCGGCCGGG - Intronic
1050434636 9:5596284-5596306 TTCCAGATGGGGAGTGAACAAGG - Intergenic
1050558181 9:6807721-6807743 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1050862328 9:10449715-10449737 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1051258064 9:15234152-15234174 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1051258129 9:15234327-15234349 TGCCAGATGGGGCGGCTGGCTGG - Intronic
1051281050 9:15442407-15442429 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1051468776 9:17411366-17411388 TTACAGATGGGGCTGGAAACAGG - Intronic
1051615096 9:18999444-18999466 TGCCAGATGGTGGGGCAGCCGGG - Intronic
1052236141 9:26214938-26214960 TCCCAGACGGGGTGGCGACCAGG + Intergenic
1052274842 9:26664451-26664473 TCCCAGATGGGGCTGCTGCCGGG - Intergenic
1052274865 9:26664528-26664550 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1052274885 9:26664569-26664591 TCCCAGAGGGGGCGGCTGCCTGG - Intergenic
1052274927 9:26664683-26664705 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1052880957 9:33600698-33600720 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1053457198 9:38242070-38242092 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1054359726 9:64101144-64101166 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1054846064 9:69799776-69799798 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1055137184 9:72840754-72840776 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1055137539 9:72841568-72841590 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1055138746 9:72851505-72851527 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1055214916 9:73847674-73847696 TGCTAGATGTGGCAGCAACCAGG - Intergenic
1055297995 9:74853210-74853232 TCCCCGATGGGGCGGCTGCCGGG - Intronic
1055298020 9:74853290-74853312 TCCCGGATGGGGCGGCTGCCGGG - Intronic
1055298037 9:74853331-74853353 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1055414342 9:76064567-76064589 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1055580434 9:77702703-77702725 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1055580464 9:77702780-77702802 TCCCAGATGGGGCGGCAGCCGGG + Intergenic
1055586052 9:77761006-77761028 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1055586066 9:77761046-77761068 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1055948274 9:81710339-81710361 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1056097846 9:83272939-83272961 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1056097911 9:83273105-83273127 TCCCAGATGGGGTGGCAGCCGGG - Intronic
1056152588 9:83804268-83804290 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1056166816 9:83948312-83948334 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1056326796 9:85486807-85486829 TTTCTGATGTGGCAGCAACCTGG + Intergenic
1056624844 9:88245092-88245114 TTCCGGATGGGGCGGCTGGCCGG + Intergenic
1056670870 9:88626281-88626303 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1056670909 9:88626373-88626395 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1057071875 9:92105955-92105977 TCCCAGATGGGACGGCGGCCAGG - Intronic
1057630463 9:96715676-96715698 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1057630477 9:96715716-96715738 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1057716115 9:97497964-97497986 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1057716181 9:97498129-97498151 TCCCAGATGGGGCGGCTGCCAGG + Intergenic
1057751580 9:97796814-97796836 TCCCAGATGGGGCGGCTGGCCGG - Intergenic
1057844783 9:98514995-98515017 TTCCAGTGGGGGAGGCCACCAGG + Intronic
1058425902 9:104874963-104874985 TCCCAGATGGGGCGGCGGCCGGG - Intronic
1058659943 9:107257664-107257686 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1059118127 9:111617532-111617554 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1059210883 9:112513801-112513823 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1059210988 9:112514230-112514252 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1059879923 9:118678205-118678227 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1060041440 9:120304749-120304771 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1060041530 9:120305098-120305120 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1060064802 9:120495154-120495176 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1060064908 9:120495583-120495605 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1060080159 9:120636789-120636811 TCCCAGACGGGGCGGCTGCCGGG - Intronic
1060625543 9:125108514-125108536 TCCCAGATGGGGTCGCAGCCGGG - Intronic
1060686956 9:125623206-125623228 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1061143095 9:128780316-128780338 TCCCAGATGGGGTGGCTGCCAGG - Intergenic
1061977299 9:134075878-134075900 TCCCAGAAGGGGCGGCAGCCAGG - Intergenic
1061977309 9:134075918-134075940 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1061983963 9:134118536-134118558 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1062587441 9:137255606-137255628 TTCCAGGTGGGGCGGCCCCCGGG + Exonic
1203562539 Un_KI270744v1:71185-71207 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1203562645 Un_KI270744v1:71614-71636 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1185584535 X:1235175-1235197 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1185584629 X:1235564-1235586 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1185727315 X:2432392-2432414 TTCCAAATGAGGCGGCAAAGAGG + Intronic
1186786800 X:12963052-12963074 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1186923045 X:14303045-14303067 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1187184412 X:16969311-16969333 TTCCAGACGGGGTGGCGGCCGGG + Intronic
1187212481 X:17244872-17244894 TCCCAGACGGGGCGGCGGCCGGG + Intergenic
1188086425 X:25906015-25906037 TCCCAGACGGGGCGGCTGCCAGG - Intergenic
1188214314 X:27458595-27458617 TCCCAGATGGGGTGGCAGCCAGG - Intergenic
1188214401 X:27458897-27458919 TCCCAGACGGGGCGGCCGCCGGG - Intergenic
1188477101 X:30602330-30602352 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1189056950 X:37707791-37707813 TCCCAGATGGGGTGGCAGCCGGG + Intronic
1189210112 X:39277299-39277321 TTCCAGAGGGGGTGGCGGCCGGG - Intergenic
1189341943 X:40211122-40211144 TCCCAGATGGGGCGGCGGTCGGG + Intergenic
1189421789 X:40862924-40862946 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1189421802 X:40862964-40862986 TCCCAGATGGGGTGGCGGCCGGG - Intergenic
1189505866 X:41612459-41612481 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1189506000 X:41612773-41612795 TTCCAGACGGGGCGGCTGGCCGG - Intronic
1189882018 X:45503778-45503800 TCCCAGATGGGGTGGCGGCCGGG + Intergenic
1189955817 X:46275548-46275570 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1189968317 X:46395531-46395553 TCCCAGATGGGGCGGCTGGCCGG + Intergenic
1189968593 X:46396192-46396214 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1190153184 X:47965702-47965724 TCCCAGACAGGGCGGCAGCCGGG - Intronic
1190153194 X:47965743-47965765 TCCCAGACGGGGCGGCAGGCTGG - Intronic
1190159045 X:48017063-48017085 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1190159110 X:48017236-48017258 TCCCAGACGGGGCGGCGGCCTGG - Intronic
1190174730 X:48139251-48139273 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1190174741 X:48139291-48139313 TCCCGGATGGGGCGGCTGCCAGG - Intergenic
1190174821 X:48139464-48139486 TCCCAGACGGGGCGGCGGCCTGG - Intergenic
1190184450 X:48222199-48222221 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1190184530 X:48222511-48222533 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1190680938 X:52827024-52827046 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1190769622 X:53504207-53504229 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1190793601 X:53721778-53721800 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1190906830 X:54736595-54736617 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1190906907 X:54736786-54736808 TCCCAGATGGGGCAGCGGCCGGG - Intergenic
1191618194 X:63189852-63189874 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1191679342 X:63825515-63825537 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1191794117 X:65002455-65002477 TCCCGGATGGGGCGGCAGCTGGG - Intronic
1191828703 X:65392525-65392547 TCCCAGACGGGGTGGCTACCGGG - Intronic
1191894214 X:65975394-65975416 TCCCTGATGGGGCGGCTGCCGGG + Intergenic
1191894228 X:65975434-65975456 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1191894249 X:65975511-65975533 TCCCAGATGGGGCGGCTGTCGGG + Intergenic
1192107198 X:68327174-68327196 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1192252266 X:69422456-69422478 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1192350076 X:70349488-70349510 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1192350171 X:70349839-70349861 TCCCAGACGGGGTGGCAGCCGGG + Intronic
1192352880 X:70371800-70371822 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1192352892 X:70371840-70371862 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1192464086 X:71341763-71341785 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1192476990 X:71452217-71452239 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1192504982 X:71676130-71676152 TCCCAGATGGGGTGGCGACCAGG - Intergenic
1192505041 X:71676320-71676342 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1192530175 X:71876843-71876865 TCCCGGATGGGGCGGCGGCCAGG + Intergenic
1192530246 X:71877021-71877043 TCCCAGATGGGGCGGCTGCCAGG + Intergenic
1192621103 X:72680935-72680957 TCCCAGACGGGGTGGCAGCCGGG - Intronic
1192621208 X:72681364-72681386 TCCCAGATGGGGTGGCTGCCGGG - Intronic
1192621380 X:72681739-72681761 TCCCAGATGGGGCGGCTGGCCGG - Intronic
1192658988 X:73022218-73022240 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1192663790 X:73068658-73068680 TCCCAGATAGGGTGGCAGCCAGG - Intergenic
1192761308 X:74098529-74098551 TCCCAGATGGGGCAGCTGCCGGG - Intergenic
1192794186 X:74412742-74412764 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1192885634 X:75334612-75334634 TCCCAGATGGGGTGGCGGCCAGG + Intergenic
1192885646 X:75334652-75334674 TCCCAGATGGGGTGGCAGCTGGG + Intergenic
1192892774 X:75407684-75407706 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1192969885 X:76218377-76218399 TCCCAGATGGGGTGGCTGCCGGG + Intergenic
1192969992 X:76218806-76218828 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1193329033 X:80215311-80215333 TCCCAGACGGGGTGGCAGCCGGG - Intergenic
1193362107 X:80590799-80590821 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1193924369 X:87466112-87466134 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1194714656 X:97275434-97275456 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1194714667 X:97275474-97275496 TCCCAGATGGGGCGGCTGCCGGG + Intronic
1195009718 X:100723530-100723552 TCCCAGATGGGGTGGCGGCCGGG - Intronic
1195036194 X:100972870-100972892 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1195119909 X:101739088-101739110 TCCCAGATGGGGTGGCGGCCAGG - Intergenic
1195119920 X:101739128-101739150 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
1195889034 X:109671550-109671572 TCCCAGATGGGGTGGCGACCTGG - Intronic
1195979023 X:110558655-110558677 TTCCAGATGGGGCGGCCGCCGGG + Intergenic
1195979035 X:110558695-110558717 TCCTAGATGGGGTGGCAGCCCGG + Intergenic
1196778665 X:119362494-119362516 TCCCAGACGGGGCGGCGGCCAGG - Intergenic
1197429435 X:126342455-126342477 TTCCAGCTGTGGTGGCTACCAGG + Intergenic
1197455693 X:126674058-126674080 TCCCAGACGGGGCGGCTGCCGGG - Intergenic
1197455808 X:126674322-126674344 TCCCAGACGGGGCGGCGGCCGGG - Intergenic
1197735927 X:129850581-129850603 TCCCAGATGGGGTGGCTGCCGGG - Intergenic
1198108581 X:133483729-133483751 TCCCAGACGGGGTGGCAGCCGGG + Intergenic
1198108637 X:133483887-133483909 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1198189132 X:134286023-134286045 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
1198189146 X:134286063-134286085 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1198600795 X:138282775-138282797 TCCCAGACGGGGCGGCTGCCGGG + Intergenic
1199231050 X:145436599-145436621 TCCCAGATGGGGTGGTAGCCGGG - Intergenic
1199452696 X:147992573-147992595 TCCCAGATGGGGTGGCTGCCGGG + Intronic
1199586346 X:149420538-149420560 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1199586400 X:149420772-149420794 TCCCAGATGGGGTCGCAGCCGGG - Intergenic
1199836700 X:151599342-151599364 TCCCAGATGGGGCAGCGGCCGGG + Intronic
1199836757 X:151599501-151599523 TCCCAGACGGGGCGGCTGCCGGG + Intronic
1200324588 X:155223878-155223900 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1200324666 X:155224187-155224209 TCCCAGATGGGGTGGCGGCCGGG + Intronic
1200952919 Y:8918208-8918230 TCTCAGATGGGGCGGCTGCCAGG + Intergenic
1200952993 Y:8918482-8918504 TCCCAGATGGGGTGGCGGCCAGG + Intergenic
1201294833 Y:12453930-12453952 TCCTAGATGGGGTGGCAGCCAGG + Intergenic
1201440252 Y:14000915-14000937 TCCCAGATGGGGTGGCCGCCGGG + Intergenic
1201444319 Y:14041793-14041815 TCCCAGATGGGGTGGCCGCCGGG - Intergenic
1201948240 Y:19535609-19535631 TCCCAGACGGGGTGGCAGCCAGG - Intergenic
1201948336 Y:19535895-19535917 TCCCAGATGGGGTGGCCACCAGG - Intergenic
1202028751 Y:20551702-20551724 TCCCAGATGGGGTGGCGGCCGGG - Intergenic