ID: 1029818287

View in Genome Browser
Species Human (GRCh38)
Location 7:103119827-103119849
Sequence CTGTGAGAATGTGATTGAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029818287_1029818290 12 Left 1029818287 7:103119827-103119849 CCAACTCAATCACATTCTCACAG 0: 1
1: 0
2: 2
3: 16
4: 233
Right 1029818290 7:103119862-103119884 ATCCAGTCAAGGAGACCCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 184
1029818287_1029818289 1 Left 1029818287 7:103119827-103119849 CCAACTCAATCACATTCTCACAG 0: 1
1: 0
2: 2
3: 16
4: 233
Right 1029818289 7:103119851-103119873 CACATTTTTGCATCCAGTCAAGG 0: 1
1: 0
2: 2
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029818287 Original CRISPR CTGTGAGAATGTGATTGAGT TGG (reversed) Exonic
901541828 1:9922957-9922979 ATGAAAGAATGTGATTGAGTTGG - Intronic
902881536 1:19374876-19374898 CTGTGAGAAAGTGTTTGTATGGG + Intronic
903324328 1:22561186-22561208 CTGTGAGCCTGGGATGGAGTAGG + Intergenic
903453819 1:23473247-23473269 CTGGGAGATTCTGATTCAGTGGG + Intronic
904123741 1:28221394-28221416 CTGCAAGATTGTGTTTGAGTGGG - Intronic
904442270 1:30539594-30539616 GTGTGAGACTGAGATTGAGGAGG - Intergenic
905551711 1:38846528-38846550 CTGTGAAAATGTGATTGACCTGG - Intronic
907316666 1:53576900-53576922 TTGTTAGAATGTGAATGAGAAGG - Intronic
908044860 1:60157584-60157606 CTGTGAGAATTAGGTTGGGTTGG + Intergenic
908682950 1:66682519-66682541 CTGTGAGCATCTGATGGACTAGG - Intronic
909319551 1:74266157-74266179 CTGAGAAAATGTGAATGAATGGG + Intronic
911078465 1:93904035-93904057 CTGTGAGCCTTTGACTGAGTTGG + Intronic
913181132 1:116322835-116322857 CTATGAGAAAGGGATGGAGTAGG + Intergenic
913319472 1:117578211-117578233 CTGAGAGAATGGGAAGGAGTGGG - Intergenic
915943499 1:160133982-160134004 CTGTGTGAATTTGAGTGGGTGGG - Intronic
916494042 1:165328638-165328660 CTCTGTGAATATGACTGAGTTGG - Intronic
919367646 1:196684623-196684645 CTGTGGCCATGTGATTGCGTAGG - Intronic
922141665 1:222894066-222894088 CTGTGTGAATCTGACTGGGTGGG + Intronic
1064492029 10:15868563-15868585 ATGTGATAATGTGGTTGTGTGGG - Intergenic
1065253005 10:23835968-23835990 CCATAAGAATGTGACTGAGTTGG + Intronic
1065283679 10:24166233-24166255 CTGTGAGATTGTTTCTGAGTGGG + Intronic
1068527293 10:58144645-58144667 CTGTGAGAATTTTATAGAGGAGG - Intergenic
1069259405 10:66374973-66374995 CTGGGATGATGTAATTGAGTTGG + Intronic
1070036705 10:72732580-72732602 CTGTGGGAATCTGATTGAGCAGG + Intronic
1072615207 10:97044643-97044665 CTCTGAGAGTGTGAGTGACTGGG + Intronic
1073499373 10:103922060-103922082 CTGTGATGCTGTGATGGAGTGGG + Intergenic
1074442256 10:113488276-113488298 CTGAGAGATTCTGATTCAGTAGG - Intergenic
1074929133 10:118105793-118105815 CTTTGAGAATGAGATTAAATGGG - Intergenic
1076499576 10:130926793-130926815 GTGTGTGAATGTGACTGTGTGGG + Intergenic
1077172787 11:1175474-1175496 GTGTGAGCATGTGCATGAGTGGG - Intronic
1077677572 11:4209915-4209937 CTGAGAAAATGTGAGTGAGAGGG + Intergenic
1079129566 11:17739495-17739517 GTGTGAGAATGAGACTGTGTGGG + Intronic
1079653046 11:22954594-22954616 CTATGAAAATCTGATTAAGTAGG + Intergenic
1081286055 11:41271396-41271418 CAGAGAGAATGTGAATGAGAAGG - Intronic
1081392431 11:42544719-42544741 CTGTGAGAATCTCATTCTGTGGG + Intergenic
1081450560 11:43167415-43167437 CTGTTAGACTGGGATAGAGTTGG - Intergenic
1084558778 11:69890976-69890998 ATGTGAGAATGGGACTGTGTGGG + Intergenic
1084762330 11:71281872-71281894 CTGTGAAAATATGAAGGAGTGGG + Intergenic
1084792727 11:71484965-71484987 CTGTGAGCATGTGGGTGGGTGGG + Intronic
1085918586 11:80923401-80923423 CAGTGCGAATGTGATTGAGAAGG + Intergenic
1086011277 11:82106441-82106463 CTGTGTGATTGTGTTTCAGTTGG - Intergenic
1086354082 11:85974665-85974687 CTGTGGTAATGTGTTTGATTTGG - Intronic
1086957512 11:92948896-92948918 CTGTTAGACTGGGATCGAGTTGG - Intergenic
1087833050 11:102840486-102840508 CTGTGAGTGAGTGATAGAGTGGG + Exonic
1087934415 11:104015947-104015969 TTGTGAGAATGTGTTTCTGTTGG - Intronic
1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG + Intronic
1088990646 11:114950501-114950523 CTGAGAGAATGTCACTCAGTGGG + Intergenic
1089001153 11:115053577-115053599 CTTGGGGAGTGTGATTGAGTGGG - Intergenic
1089479437 11:118792259-118792281 CTGTGAGAGTGCGACTGAGGGGG + Intergenic
1090244262 11:125204511-125204533 CTGTGACAATGGGATTAAATTGG - Intronic
1091446694 12:547853-547875 CTGTTAGCAAGTGATAGAGTGGG + Intronic
1093420716 12:18971281-18971303 CTGAGAGAATCTGGTTCAGTAGG - Intergenic
1094036290 12:26075422-26075444 CTGTGAGAATGACATGGATTTGG + Intronic
1094159374 12:27373510-27373532 CTGGGAGAAGCTGATGGAGTGGG + Intronic
1095092963 12:38124027-38124049 CTGTTAGACTGGGATAGAGTTGG + Intergenic
1095139537 12:38644904-38644926 GAGTGAGAATGTGAAAGAGTTGG + Intergenic
1096270269 12:50160433-50160455 CTGAGAGAATGGCATTGAGAAGG + Intronic
1098932111 12:76430344-76430366 CTCTGACATTGTGATTGAGTGGG - Intronic
1099039305 12:77631217-77631239 CTGGGAGAATCTGGTTCAGTAGG - Intergenic
1099823130 12:87740645-87740667 CTGGGAGAAATTGATTGATTAGG - Intergenic
1106003938 13:25751071-25751093 CTGTGCAAATGTGATTTATTTGG + Intronic
1106146573 13:27054666-27054688 CTGTGAGAATGTGTTTGTAAAGG + Intergenic
1106777725 13:33024846-33024868 CTGGGAGAATGTAGTTGAGTCGG - Intronic
1107198281 13:37682017-37682039 CTGTGAGGATGTGATGGGGTAGG + Intronic
1107242658 13:38255529-38255551 CTTTGTGAATGTGAATGAGAAGG - Intergenic
1112135256 13:96571040-96571062 CTGTGAGAATGTAGTTCAGGAGG + Intronic
1113728867 13:112625433-112625455 CTGTGTGAAGGTGGTTGATTTGG - Intergenic
1114186221 14:20404424-20404446 CATGGAGAATGTGATTGAGAAGG - Intronic
1114870661 14:26652432-26652454 CTGTGAGGATGTTTTTGAATGGG + Intergenic
1115004583 14:28467305-28467327 CTGTGTGACTGGGATTGTGTAGG + Intergenic
1115984881 14:39094612-39094634 ATGTGAGAATGTGTTTAAGAGGG + Intronic
1117383077 14:55185004-55185026 CTGGAAGAATGTCCTTGAGTAGG - Intronic
1118906004 14:70023684-70023706 CTGTGAGAGTGTGCTAGGGTGGG + Intronic
1120290920 14:82569773-82569795 CTTTGAGGAAGTGATGGAGTAGG - Intergenic
1123474252 15:20578193-20578215 TTCTGATAATATGATTGAGTAGG + Intergenic
1123643759 15:22422160-22422182 TTCTGATAATATGATTGAGTAGG - Intergenic
1123734553 15:23173205-23173227 TTCTGATAATATGATTGAGTAGG + Intergenic
1124285059 15:28394513-28394535 TTCTGATAATATGATTGAGTAGG + Intergenic
1124297638 15:28517101-28517123 TTCTGATAATATGATTGAGTAGG - Intergenic
1126211026 15:46100362-46100384 CTTTGTGAATGTGATTGTGGAGG + Intergenic
1127247574 15:57194431-57194453 CTGTGTAAATGTCATTTAGTGGG + Intronic
1128235091 15:66061542-66061564 CTGTGATCATCTTATTGAGTAGG - Intronic
1129922713 15:79333781-79333803 CTGTGAGAATTAGAATTAGTAGG + Intronic
1130121330 15:81050154-81050176 ATGTCAGAATGTGATTGCTTTGG + Intronic
1131197684 15:90369267-90369289 GTGTGTGCATGTGTTTGAGTGGG - Intergenic
1133195488 16:4167031-4167053 CTGTGGGAATCTGGTTGAGAGGG - Intergenic
1133987385 16:10678811-10678833 CAGGGAGAATGTGATTAAGCGGG - Intronic
1134385306 16:13766404-13766426 CTCTTAGAAAGTGATTGAGCTGG + Intergenic
1136173320 16:28501445-28501467 CTGTGAGTGTGTGAGTGTGTGGG - Intronic
1136487879 16:30585052-30585074 CGCTGAGGATGTGAGTGAGTTGG + Intronic
1137360047 16:47805983-47806005 CTGTGAGGCTGGGGTTGAGTTGG + Intergenic
1141028852 16:80570852-80570874 TGGTGAGGGTGTGATTGAGTGGG - Intergenic
1141615309 16:85206711-85206733 CTGGGAGATTGTGAATGAATGGG - Intergenic
1143209311 17:5172228-5172250 CTGTTAGAATTTGATGGGGTTGG + Intronic
1143973561 17:10813461-10813483 CTATGAGAATGTGATAAAGAGGG + Intergenic
1144893904 17:18514013-18514035 CTGTTAGAATTTGATGGGGTTGG - Intergenic
1145138324 17:20430260-20430282 CTGTTAGAATTTGATGGGGTTGG + Intergenic
1147419528 17:40315464-40315486 CTGTGAGAATCAAATGGAGTGGG + Intronic
1147740364 17:42667885-42667907 CTGTGGGAGTGTTATTCAGTGGG - Intergenic
1147920399 17:43913024-43913046 CTGTGTGTATGTGAGTGTGTAGG - Intergenic
1148470210 17:47888609-47888631 CTCTGAGAATGTGATGGAGTTGG - Intergenic
1149870827 17:60179969-60179991 CTGTTAGAATTTGATGGGGTTGG - Intronic
1150672807 17:67216751-67216773 CCATGAGAATGTGTCTGAGTGGG - Intronic
1151414703 17:73953527-73953549 GTGTGTGAATGTGAGTGTGTGGG - Intergenic
1151769044 17:76147696-76147718 CTGTGAGAATGAGGCTGAGGAGG - Intronic
1155246606 18:23916606-23916628 ATGGGAGCATGTGGTTGAGTTGG - Exonic
1157833130 18:50876004-50876026 CTGTGACATTGTGATAGAATAGG + Intergenic
1157886473 18:51371656-51371678 CTGTGAGTCTGTGATTAAATAGG - Intergenic
1158518058 18:58147187-58147209 CTGTGAGAGTGCGGTTGAGCTGG + Intronic
1159239654 18:65725324-65725346 CTATGGTAATGAGATTGAGTTGG - Intergenic
1159827822 18:73236500-73236522 ATGTGAGAATGTGAATGAATCGG - Intronic
1162064718 19:8118178-8118200 GTGTGAGAATGTGTTTGAGTGGG - Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1165720643 19:38077148-38077170 CAGTGAGAAAGTCATTGAGGAGG + Intronic
1166228192 19:41410470-41410492 CAGTGAGAAAGTGCTGGAGTTGG + Intronic
927547576 2:23968270-23968292 TTGTGAGGATTTGAATGAGTTGG + Intronic
928942060 2:36736160-36736182 CTGTTAGAAACTGCTTGAGTAGG - Intronic
929760298 2:44801347-44801369 CTGCGAGACTGTGATTGAAATGG - Intergenic
932416630 2:71577421-71577443 GTGTGAGAGTGTGATTGTGTAGG - Intronic
933268683 2:80209580-80209602 CTGTGTGTATGAGAATGAGTGGG - Intronic
935248382 2:101239023-101239045 CTGTTAGACTGGGATAGAGTTGG + Intronic
935699832 2:105801868-105801890 CTGAGAGAAAGTGATGGAGCTGG + Intronic
936167848 2:110139523-110139545 CTGTGAAAATGTGAATTATTCGG - Intronic
937856696 2:126677417-126677439 GTGAGAGAATGTGAGAGAGTAGG + Intronic
938602251 2:132854400-132854422 GTGTGAGTAGGAGATTGAGTGGG + Intronic
939024984 2:137001768-137001790 TTGTGAGAAAATGAATGAGTAGG - Intronic
940116781 2:150218360-150218382 CTCAGAGTCTGTGATTGAGTAGG + Intergenic
941414111 2:165197409-165197431 CTCAGAGAATCTGATTGAATTGG + Intronic
942328356 2:174794721-174794743 CTGTGAGAAGGTGATGACGTGGG - Intergenic
942719974 2:178940494-178940516 CTGTGAGAATGAGAATGTGAGGG + Intronic
944610125 2:201394857-201394879 TTGTTAGCATGTGATTGAGAAGG - Exonic
945987721 2:216368897-216368919 CTGTGAAAATCTGAATGAATAGG + Intronic
946120826 2:217512545-217512567 CTGTGAGCAGGTGACTGAGGGGG - Intronic
946997559 2:225412394-225412416 CTGTTAGAGTGTCCTTGAGTGGG + Intronic
947077377 2:226360053-226360075 CTGTGAGTATGTGAATATGTTGG + Intergenic
948533427 2:238628687-238628709 CCCTGAGAATGTGATGGTGTGGG + Intergenic
948735951 2:240004913-240004935 CTTTGAAAATGTGTTTTAGTAGG - Intronic
948964254 2:241364022-241364044 CTGGGAGTATGTGACTGATTTGG + Intronic
1169599110 20:7236711-7236733 TTGTGAGATCGTGACTGAGTAGG + Intergenic
1169689199 20:8311451-8311473 CAGGGAGGATTTGATTGAGTTGG + Intronic
1170499029 20:16955780-16955802 CTGTGAGAAGGTGACGAAGTCGG + Intergenic
1173137503 20:40452327-40452349 CTGGGAGCATGGGATAGAGTAGG - Intergenic
1173526845 20:43739282-43739304 TTGTGGAAATGTGAGTGAGTCGG + Intergenic
1175614194 20:60378876-60378898 CTGTCTGTATGTGATTGATTTGG + Intergenic
1177293163 21:19141511-19141533 CTGTGAGCATCAGAATGAGTAGG + Intergenic
1180031653 21:45213147-45213169 CTCTGAGATTCTGATTGGGTAGG - Intronic
1180953311 22:19730430-19730452 CTGTGAGAATGGGCTTGGGAGGG - Intergenic
1183515687 22:38264538-38264560 CTGAGTGAATGTCATGGAGTGGG - Intronic
1183760936 22:39817127-39817149 TGGTGAGAATGTGAGTGAATAGG + Intronic
1184634027 22:45811946-45811968 CTTTTAGAATGTGATAGACTAGG - Intronic
949385472 3:3497300-3497322 CTGTGAGTATGTGGCTGAGCTGG - Intergenic
950167585 3:10813474-10813496 CTGGGACAATTTGATTGAGGGGG + Intergenic
951364389 3:21762994-21763016 CTGTGACACTGTCATTGAGTAGG + Intronic
951630896 3:24719033-24719055 CTGACAGAATGTGATCTAGTTGG - Intergenic
952641274 3:35599731-35599753 CAGTGAGAATCTGCTAGAGTAGG + Intergenic
952661954 3:35862414-35862436 CTTTGAGAAAGTGTTGGAGTCGG + Intergenic
954383165 3:50230341-50230363 CTGCAAGGCTGTGATTGAGTTGG + Intronic
955468559 3:59262151-59262173 GAGAGAGAATCTGATTGAGTCGG - Intergenic
955635915 3:61029442-61029464 CTGTGGGAATCTGATTTAGCCGG + Intronic
958481256 3:94648377-94648399 CTGTTAGACTGGGATAGAGTTGG + Intergenic
958481576 3:94651608-94651630 CTGTGGGTCTGTGATTGAATGGG - Intergenic
959264329 3:104118501-104118523 GTGTCAGAAAGTGATTGGGTCGG + Intergenic
959624835 3:108438198-108438220 ATGTGAGAATGTGTTTGAATGGG - Intronic
959640687 3:108629226-108629248 CTGTAAGAATATGATATAGTTGG - Intronic
960076229 3:113488985-113489007 AAGTGAGAATGAGAATGAGTTGG - Exonic
960171098 3:114461771-114461793 CTCTGAGCATCTGATTCAGTAGG - Intronic
962148802 3:132870592-132870614 CAGTGGGTATGTGATTGAATGGG + Intergenic
962292189 3:134146203-134146225 CTGTGAGAATAGGCTAGAGTTGG + Intronic
965524672 3:169703076-169703098 CTGTGAGAATGTGTCAGAATAGG - Intergenic
967271357 3:187736199-187736221 GTGTGTGCATGTGAGTGAGTGGG + Intronic
967822001 3:193847053-193847075 CTGTCTGAAGGTGATGGAGTTGG - Intergenic
971397275 4:26240392-26240414 CTGTGTGAATGTTATTGATCTGG - Intronic
973117657 4:46481160-46481182 CTGTTAGAATGTGACAGAGCTGG - Intergenic
975373997 4:73621014-73621036 CTGTGAGACTCTGATTTAGTAGG + Intergenic
977951938 4:102981064-102981086 CTGTTAGAATGTCATATAGTTGG + Intronic
979799277 4:124887614-124887636 CTGTAAACATATGATTGAGTTGG - Intergenic
979903160 4:126249347-126249369 CTTAGAGATTCTGATTGAGTGGG + Intergenic
981434867 4:144708492-144708514 CTGTGAGAAGCAGATTGAGAAGG + Intronic
982277042 4:153646659-153646681 CTGTGACTTTGGGATTGAGTAGG + Intergenic
982395556 4:154911729-154911751 CTCTGAGACTGTGGTTGAGTGGG + Intergenic
983343759 4:166500997-166501019 CTGTAAGAATGTTTTTGAATGGG + Intergenic
984501835 4:180566824-180566846 GTGTGTGAATGTGATTGGGTGGG + Intergenic
984589427 4:181600719-181600741 CTGTCTGAATGTGAGAGAGTGGG - Intergenic
987783781 5:22472050-22472072 CAGTAAGAATCTGATTCAGTTGG - Intronic
988774703 5:34467311-34467333 CTGTTAGACTGGGATAGAGTTGG - Intergenic
990409045 5:55522278-55522300 CTGTGAGCATGTTACTGAATAGG + Intronic
991036718 5:62134799-62134821 CTCTGAGAAAGTGACTGGGTGGG + Intergenic
991550831 5:67834076-67834098 CAGTGAAAATGTAATGGAGTAGG + Intergenic
991662630 5:68966212-68966234 GTGTGAGGGTGTGTTTGAGTTGG - Intergenic
991971961 5:72149975-72149997 CTGTGTGTATGTGTCTGAGTGGG + Intronic
995632463 5:114149014-114149036 CTGTTAGACTGGGATAGAGTTGG - Intergenic
996884016 5:128334478-128334500 CTGTGACAGAGTGAGTGAGTAGG - Intronic
999327676 5:150653212-150653234 CTGTGTGTATGTTTTTGAGTCGG - Exonic
999875795 5:155804346-155804368 CTGTTAGAAAGTGATAGAGGAGG + Intergenic
1000256144 5:159540461-159540483 CTTAGAGAATGTGATTTAGTGGG + Intergenic
1002304004 5:178272891-178272913 CTGTGTGACTGAGACTGAGTGGG - Intronic
1003153419 6:3571625-3571647 GTGAGAGAATCTGATTCAGTAGG + Intergenic
1006179616 6:32146983-32147005 CTGTGAAAATGCCATTGATTTGG + Intergenic
1007459822 6:42009932-42009954 CTGAGAGATTCTGATTCAGTAGG - Intronic
1008272590 6:49507343-49507365 CTGTTAGACTGGGATAGAGTTGG - Intronic
1010660656 6:78566995-78567017 CTCTGGGACTGTGGTTGAGTGGG - Intergenic
1014281181 6:119444008-119444030 CTGTGAGAAGGTGGTTAAGCTGG + Intergenic
1014401834 6:120999425-120999447 GTGTGAGAATATAATTGAGGAGG + Intergenic
1014405263 6:121043267-121043289 CTGTTAGACTGGGATAGAGTTGG + Intergenic
1014549960 6:122779006-122779028 ATGTGAGAACGAGACTGAGTTGG - Intergenic
1016045912 6:139480224-139480246 CTGTGAGAATGAGATTATGGTGG - Intergenic
1022464478 7:30644059-30644081 CTCTGAGAATATGAATGTGTAGG + Intergenic
1023511787 7:40960919-40960941 CTGTGACAATTTAATTGAGCAGG + Intergenic
1027179572 7:75928840-75928862 CTGTGGAGATGTGCTTGAGTTGG - Intronic
1027268094 7:76504969-76504991 GTGTGAGAATGGGCTTGAGGTGG + Intronic
1027863016 7:83609398-83609420 CAGAGACAAAGTGATTGAGTTGG + Intronic
1028620595 7:92823196-92823218 CTGTATGAATGTGACTGACTCGG - Intronic
1029818287 7:103119827-103119849 CTGTGAGAATGTGATTGAGTTGG - Exonic
1029918594 7:104238142-104238164 CTCTCAGAAGGTGATTTAGTAGG - Intergenic
1030695715 7:112582734-112582756 CTGAGAGATTCTGATTTAGTAGG + Intergenic
1031049486 7:116930522-116930544 TTCTGAGCATGTGTTTGAGTGGG + Intergenic
1032620686 7:133527855-133527877 GTGTGAGAGTGTGATATAGTGGG + Intronic
1033638040 7:143230630-143230652 GTGTGTGAATGTGAGTGTGTGGG - Intergenic
1033638043 7:143230676-143230698 GTGTGTGAATGTGAGTGTGTTGG - Intergenic
1033638054 7:143230939-143230961 GTGTGTGAATGTGAGTGTGTTGG - Intergenic
1034685922 7:152971388-152971410 CTGTGAGGTTGTGGTTCAGTGGG + Intergenic
1034988868 7:155534923-155534945 CTGGGAGGATGTGACTGAGGAGG + Intergenic
1040560077 8:48515829-48515851 CTGTGAGACTGTGAGTGGGAAGG - Intergenic
1040821035 8:51557721-51557743 CTGAGAGAGTCCGATTGAGTAGG - Intronic
1041789289 8:61674195-61674217 CTGGGTGAATTTCATTGAGTGGG + Intronic
1042290164 8:67162532-67162554 CTTTGAGATTCTGATTTAGTAGG + Intronic
1042718844 8:71805121-71805143 ATGTGAGAATGTGCTGGAATAGG + Intergenic
1044429419 8:92091076-92091098 CTTGGGGAATGTGATTGACTGGG - Intronic
1045679072 8:104639659-104639681 CTCAGAGACTTTGATTGAGTGGG - Intronic
1047464584 8:125099968-125099990 CTGGGAGAATGTCTTAGAGTAGG + Intronic
1048201206 8:132375479-132375501 CTGTGAGAATGCGACTGAAAAGG + Intronic
1048350512 8:133612049-133612071 CTCTGGGAATGGGATGGAGTAGG + Intergenic
1048410865 8:134170999-134171021 ATCTGAGAATGTGATTTATTTGG + Intergenic
1051948882 9:22606593-22606615 CTATGACAACCTGATTGAGTGGG - Intergenic
1054767408 9:69053813-69053835 CTGTGAGACAGTGATGGGGTAGG + Intronic
1055868853 9:80849684-80849706 TTTTGCGTATGTGATTGAGTTGG + Intergenic
1056910308 9:90694410-90694432 GTGTGTGAATGTGAGTGTGTGGG + Intergenic
1056910312 9:90694522-90694544 GTGTGTGAATGTGAGTGTGTGGG + Intergenic
1059287056 9:113183110-113183132 GTGTGATAATGGGAATGAGTAGG + Intronic
1059585459 9:115601308-115601330 CTGTGAGAATGGACTGGAGTAGG + Intergenic
1060474061 9:123972504-123972526 GTGCGAGAATGTGACTGTGTAGG + Intergenic
1061300565 9:129702559-129702581 CAGTGAGAATTTCATTGAGATGG + Intronic
1187539741 X:20180642-20180664 CTGTAAGAATGTGATTATTTGGG - Intronic
1188020864 X:25155952-25155974 CTGTGAGAATATAATAGACTAGG - Intergenic
1188354374 X:29173130-29173152 CTGAGAGATTGTGATTTAGGAGG + Intronic
1189774002 X:44453942-44453964 GTGTGAGAGAGTGATTAAGTCGG - Intergenic
1197118554 X:122862943-122862965 ATGTGAGTATGTGAGTGTGTGGG - Intergenic
1197525631 X:127559048-127559070 CTGTGAGTCAGTGATTAAGTGGG + Intergenic
1197705417 X:129631286-129631308 CTGTGAGTGTGTGAATGAGTGGG - Intergenic
1199879740 X:151964462-151964484 CTCTGAGACTGTGATCTAGTTGG - Intronic
1200067794 X:153512757-153512779 GTGTGAGAGTGTGTGTGAGTGGG - Intergenic
1201623068 Y:15981455-15981477 CTGTTAGACTGGGATAGAGTTGG - Intergenic