ID: 1029819573

View in Genome Browser
Species Human (GRCh38)
Location 7:103132932-103132954
Sequence CTGTTTCCACAGATTGATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029819573 Original CRISPR CTGTTTCCACAGATTGATTG GGG (reversed) Intronic
904399539 1:30247184-30247206 GTGTTTCCCCAGACTGAGTGTGG + Intergenic
906866645 1:49428277-49428299 CTAGTTCCACAGATTCATAGTGG + Intronic
907619495 1:55961871-55961893 CTGTTTCCACAGGTTATTTCTGG + Intergenic
907862020 1:58362814-58362836 CTTTTCCCACAGAGTGATTTGGG - Intronic
908345149 1:63225039-63225061 CTGTTTTCATAGAATGATTTGGG - Intergenic
913435747 1:118845575-118845597 CTTTTTCCCCAGCTTTATTGAGG + Intergenic
915942534 1:160127865-160127887 CTCTTTCCTCAGAGTGATAGAGG + Intronic
916123448 1:161549442-161549464 TTGGTTCCACAGAGTGATTCTGG + Intronic
916883897 1:169048376-169048398 CTCTGTCCACAGATTGCTTCTGG + Intergenic
917763302 1:178188278-178188300 CTGTTTCCTCAAATTCATTGAGG + Intronic
919693465 1:200548289-200548311 CTTTTTCCCCAGTTTTATTGAGG - Intergenic
921253212 1:213316756-213316778 ATTTTTACACAGAGTGATTGAGG + Intergenic
921494183 1:215817019-215817041 ATGTGTCCACAGATAGATTCAGG + Exonic
921578794 1:216871691-216871713 ATGTTTCCACATATTGATAAAGG - Intronic
921607846 1:217176111-217176133 TTGTTTCCCCAGCTTTATTGAGG + Intergenic
1063824175 10:9875567-9875589 CTCTGTGCACAGATTGGTTGGGG + Intergenic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1065505847 10:26429472-26429494 ATTTTTCCACAGATTGGTGGGGG - Intergenic
1070243318 10:74705378-74705400 CTTTTTTCACAGTTTTATTGTGG + Intronic
1071460706 10:85891900-85891922 GTGTTTCTATTGATTGATTGAGG - Intronic
1073185568 10:101613361-101613383 GAGTTTCCACAGAATGACTGGGG + Intronic
1075228030 10:120647151-120647173 CTGTTTCCACTGATCAATGGTGG - Intergenic
1077199293 11:1297395-1297417 CTGTTTACTCACATTGGTTGTGG - Intronic
1079463942 11:20710550-20710572 CTGGTTTCACAGAATGATTTAGG + Intronic
1080170663 11:29298128-29298150 CTGTTTACACAAAGTTATTGAGG - Intergenic
1080251770 11:30241631-30241653 CTGTTTCCCCAGATGCATTAAGG - Intergenic
1082091726 11:48095951-48095973 CAGTTTCCACATATTCATGGGGG - Intronic
1082670156 11:56025751-56025773 TTGTTTCCAGGGTTTGATTGAGG + Intergenic
1085174820 11:74476617-74476639 CTGATTCCACAGACTGTTTCTGG + Intergenic
1086871602 11:92044224-92044246 CTTTGTCCACTTATTGATTGGGG - Intergenic
1087361532 11:97166446-97166468 CTGTTTTAACAGCTTTATTGAGG - Intergenic
1088580881 11:111315156-111315178 CTGGTTTCACAGAATGATTTAGG - Intergenic
1089861312 11:121592230-121592252 CTGTTTGCACTGATGGATGGTGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091632079 12:2169868-2169890 CTGTTAGAACAGGTTGATTGAGG + Intronic
1094039934 12:26111861-26111883 CTGTTTCCACACAGGGGTTGGGG + Intergenic
1094795159 12:33963509-33963531 CAATTTCCACAGATTGAATCGGG - Intergenic
1097217587 12:57426349-57426371 CTTTTTTCACAGATTGATTTTGG - Intronic
1097882791 12:64701133-64701155 GTGTTTCCAAAGGATGATTGTGG + Intergenic
1098069231 12:66654061-66654083 CTGTGACCACTGATTGATTGGGG + Intronic
1099308361 12:80986474-80986496 CTGTTTTCACAACTGGATTGTGG - Intronic
1100735855 12:97530073-97530095 CTGATTCCACAGGTTGACTTGGG + Intergenic
1102863126 12:116353671-116353693 CAGTTTCCACAGAATGGCTGAGG - Intergenic
1106937700 13:34742066-34742088 CTTTATCCACTGGTTGATTGTGG + Intergenic
1108811568 13:54231020-54231042 ATGTTTCCACATAATGATTCTGG + Intergenic
1109238660 13:59855661-59855683 CTGGTTCTACAGATAGACTGTGG - Intronic
1109924752 13:69121822-69121844 CTGGTTTCACAGAATGATTTAGG - Intergenic
1111064346 13:83071689-83071711 CTGAGTCCACAGATTGCTTTGGG + Intergenic
1111191793 13:84818105-84818127 CTTTTTCCCCAGATTTATTGAGG + Intergenic
1111563025 13:89977702-89977724 CTGTTTTCATAGATTTATTTAGG - Intergenic
1111854251 13:93616757-93616779 ATGTGTTCACAGATTGGTTGTGG - Intronic
1118951663 14:70441193-70441215 CTGTTTCCACACAGTCATGGAGG + Intergenic
1119953126 14:78766516-78766538 GAGTTTCCACAAGTTGATTGTGG + Intronic
1119990992 14:79197097-79197119 CTGTTTCTACAGGTTAATTTTGG + Intronic
1124169198 15:27357686-27357708 ATGTTGCAACAGATTGAATGCGG - Intronic
1127694279 15:61429224-61429246 CTTTATCCACTCATTGATTGAGG + Intergenic
1128661473 15:69504336-69504358 TTGTCCCCACAGCTTGATTGAGG + Intergenic
1128661970 15:69508155-69508177 TTGTCCCCACAGCTTGATTGAGG + Intergenic
1131988824 15:98072201-98072223 CTGAATCCATAGATTGCTTGGGG + Intergenic
1132400815 15:101503894-101503916 ATGTTTCCAAAGAATGGTTGAGG + Intronic
1134832029 16:17331424-17331446 CTGTTTCCACAGACTAAATGAGG - Intronic
1135824197 16:25712113-25712135 CTGTTTTCCCAGCTTTATTGAGG - Intronic
1136991749 16:35156310-35156332 CTGAATCCACAGATTGCTTTGGG + Intergenic
1139616492 16:68097705-68097727 CTATTTCAACAGCTTTATTGAGG + Intronic
1140298327 16:73730153-73730175 ATTTTTCAACACATTGATTGTGG - Intergenic
1140709927 16:77667925-77667947 CTGCTTCCTAAGATTGCTTGGGG + Intergenic
1143129312 17:4666247-4666269 CTGTGTGCACATATTTATTGTGG - Intergenic
1146169132 17:30619657-30619679 CTGTTTCCACAGTCTTAATGTGG - Intergenic
1146170430 17:30627792-30627814 CTGTTTCCACAGTCTTAATGTGG + Intergenic
1146343882 17:32043815-32043837 CTGTTTCCACAGTCTTAATGTGG + Intronic
1148075092 17:44931172-44931194 CTTCATCAACAGATTGATTGCGG - Intronic
1148255308 17:46126082-46126104 CTTTTTCAACAGCTTTATTGAGG - Intronic
1150782076 17:68132210-68132232 CTGTTTCCACAGTCTTAATGTGG - Intergenic
1153440393 18:5111250-5111272 CTGTGACCACAGTTTTATTGTGG - Intergenic
1156578149 18:38343552-38343574 CAGTTTCCCAAGATTGAATGAGG + Intergenic
1157375624 18:47161688-47161710 ATTTTTCCACAGATGGGTTGGGG + Intronic
1157534777 18:48450129-48450151 TATTCTCCACAGATTGATTGAGG - Intergenic
1158552324 18:58446518-58446540 CTGTTTCCTCAGAAAGCTTGAGG + Intergenic
1158819324 18:61141131-61141153 CTTTTTCCTCAGCTTTATTGAGG - Intergenic
1164846645 19:31438311-31438333 CTGTGTACACAGTATGATTGTGG - Intergenic
1164904947 19:31959728-31959750 CTGTTTCAAAAGAATAATTGTGG - Intergenic
1165572222 19:36785070-36785092 CTGTCTCCACAAAATTATTGGGG + Intergenic
924992444 2:323911-323933 CTTTATCCACTCATTGATTGAGG + Intergenic
926472676 2:13280540-13280562 CTGTTTCCTCAGATAAATTCTGG + Intergenic
926788378 2:16543454-16543476 CTTTTTAAACAGATTTATTGAGG - Intergenic
934728828 2:96643212-96643234 CTGCTTCCTCAGATTGATGCGGG + Intergenic
935233868 2:101121663-101121685 CTGTTTCAACATATGGATTTGGG + Intronic
935614690 2:105065043-105065065 CTGTCTCCACTGATAGAATGAGG + Intronic
937445143 2:121951033-121951055 CTGTTTCCACTGACTGAAAGGGG + Intergenic
941885001 2:170518953-170518975 CTATTTCCACATTTTGATTGAGG - Intronic
941961801 2:171261353-171261375 ATGTTTCTACAGCTTTATTGGGG - Intergenic
941976626 2:171412437-171412459 CTCTTACCAGAGATTGATTTGGG - Intronic
942379439 2:175373332-175373354 CTGATTACACAGATTGACTAAGG - Intergenic
946828644 2:223705246-223705268 CTGTGTCTTCAGATAGATTGAGG + Intergenic
1172126060 20:32626046-32626068 CTGTTTATACAGAGTGATAGGGG - Intergenic
1177244634 21:18507347-18507369 CTTTTTGGAAAGATTGATTGTGG + Intergenic
1178375579 21:32064962-32064984 CTGTTTCCACACATAGTTGGGGG - Intergenic
1178877519 21:36424206-36424228 GTGCTTCAACAGATTGAGTGAGG + Intergenic
1179547119 21:42120215-42120237 GTGTTTGCACAGATTGCTGGTGG + Intronic
1182581933 22:31319083-31319105 CAGTTGCAACAGATTTATTGGGG - Intergenic
1184078631 22:42201383-42201405 GTGTATCCACAGAATGATTCAGG - Intronic
949365724 3:3278464-3278486 CTTTTTCCAAAGAGAGATTGGGG - Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
951508301 3:23473788-23473810 CTTTATCCACGCATTGATTGTGG + Intronic
952051811 3:29393623-29393645 CTGTTTCCCCCGATAGTTTGGGG - Intronic
952732790 3:36656816-36656838 CTGGTTTCACAGAATGATTTAGG - Intergenic
952878850 3:37970596-37970618 TTGTTTCCCCAGATTCATTCAGG + Intronic
956298244 3:67738227-67738249 CTTTTTCCACAGATGGGCTGGGG + Intergenic
956491487 3:69776923-69776945 TTATTTCCACAGAGTGTTTGTGG - Intronic
958189186 3:90162623-90162645 ATTTTTCCACAGATTGGTGGTGG + Intergenic
958411498 3:93822255-93822277 ATTTTTCCACAGATTGCTTGGGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962241589 3:133755150-133755172 CTGTTTCCTCTGATGGATGGTGG + Intronic
962518292 3:136174041-136174063 CTTTTTCAACAGATTGAGGGAGG - Intronic
963178395 3:142326215-142326237 CTGTATCTGCAGATTGCTTGGGG + Intronic
963350788 3:144148685-144148707 CTGTTTCCAAAGGAAGATTGGGG - Intergenic
963351811 3:144160844-144160866 CTGTATCCACAGTTAGAATGTGG + Intergenic
966361676 3:179137076-179137098 CCATTTCCCCACATTGATTGGGG - Intergenic
970460518 4:16270353-16270375 CTGTTTCTAAGGATTGCTTGCGG - Intergenic
970772784 4:19635599-19635621 CTGTTTCCAAAGGTTGCTTGAGG + Intergenic
971109608 4:23570366-23570388 CTGTGTCCTCATATTGAGTGAGG + Intergenic
972628631 4:40824356-40824378 CTGTTTCCACAGTTTTTCTGGGG + Intronic
973839189 4:54843567-54843589 CTGTTTCAAAAAATTGATTGAGG - Intergenic
976417901 4:84800683-84800705 ATTTTTTCACAGATGGATTGTGG + Intronic
976583348 4:86766478-86766500 GTGTTTCCACAGCTTGCTTATGG - Exonic
976841753 4:89440111-89440133 GTGTTACCAAAGATTGATTCAGG - Intergenic
977597898 4:98903765-98903787 ATGTTTACACAGAATGATTAAGG + Intronic
977662025 4:99600005-99600027 CTGTTCACACATATTCATTGTGG + Intronic
978058298 4:104301857-104301879 GTTTTTCCCCAGATTTATTGAGG - Intergenic
978650021 4:110991277-110991299 CTGTTTTTTCAGATTTATTGGGG + Intergenic
980581436 4:134758790-134758812 CTGTTTCTCTAGATTCATTGTGG + Intergenic
984128552 4:175843508-175843530 CTGTTTCAACACATTTATTCAGG + Intronic
985346428 4:189010244-189010266 CGGTATCCACAGATTTATTCTGG - Intergenic
986018265 5:3776859-3776881 CTTTATCCACTCATTGATTGAGG + Intergenic
986526470 5:8683890-8683912 CTGATTCCACAGGTTGAATGAGG - Intergenic
987647272 5:20690188-20690210 TTGTTTCCACAGATAGTTGGGGG - Intergenic
988145065 5:27294578-27294600 CAGTTTCAACATATTAATTGGGG - Intergenic
989431365 5:41359221-41359243 CTGGTTTCACAGAATGATTTAGG + Intronic
990032013 5:51273049-51273071 CCTTTTCTACACATTGATTGTGG + Intergenic
990993964 5:61712639-61712661 ATGTTTCCACAGAATGTTTGAGG - Intronic
991966320 5:72095019-72095041 CTTTTTCCCCAGTTTTATTGAGG - Intergenic
994112342 5:96020839-96020861 ATTTTTCCACAGATGGGTTGGGG - Intergenic
996925214 5:128817280-128817302 CTGTTTTCATAGATTGAATTGGG - Intronic
1001537530 5:172508669-172508691 CTGTTTGCAGAGGTTGTTTGGGG + Intergenic
1005584425 6:27261753-27261775 CGGATTCTACAGATTTATTGGGG - Intergenic
1005681236 6:28210496-28210518 CTGATTCCACAGACTGCTTCAGG - Intergenic
1006209162 6:32378383-32378405 CTGTTTCCAAATATTGCTTAAGG - Intergenic
1007610825 6:43147677-43147699 CTGCTTCCCCAGAGAGATTGGGG - Intronic
1010358303 6:74962292-74962314 CTGCCTTCACAGAATGATTGAGG + Intergenic
1010862780 6:80934284-80934306 CTGGTTTCACAGATTGATTTAGG + Intergenic
1011738005 6:90331967-90331989 TGGTTTCCACAGGTTGATTTTGG + Intergenic
1011849350 6:91606241-91606263 ATGTATCCACAAATAGATTGGGG + Intergenic
1012645266 6:101671489-101671511 ATGTTACAACAGATTGAATGAGG - Intronic
1012960482 6:105616661-105616683 CTGTCCCCACAGATGGAATGAGG - Intergenic
1014188572 6:118464744-118464766 CTGTTTTTCCAGAGTGATTGTGG - Exonic
1015360733 6:132336307-132336329 CTTTTTCCAGAGATGGATTACGG - Intronic
1016017472 6:139200719-139200741 CTGTTAACAAAGATTTATTGAGG + Intergenic
1018951730 6:168382775-168382797 CTGTGTCCACAGCTGGATGGGGG - Intergenic
1021434280 7:20596546-20596568 CTGTTTCAACAAATTGAATATGG - Intergenic
1023349422 7:39305518-39305540 CTGTCTACACATCTTGATTGCGG - Intronic
1024634463 7:51275833-51275855 ATGTTTCCACAGCCTGATTAGGG + Intronic
1024726185 7:52198584-52198606 CTGGTTCCATAGATTGAGTTAGG + Intergenic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1027736680 7:81941140-81941162 CTGTCTCTACAGATTGCCTGGGG - Intergenic
1028773274 7:94651693-94651715 CAGTTTCCACAGACTGACTCTGG - Intronic
1029819573 7:103132932-103132954 CTGTTTCCACAGATTGATTGGGG - Intronic
1032225597 7:130029019-130029041 CTTTTTCCACAGACCGATTTGGG - Exonic
1032576960 7:133064884-133064906 CTGTTTCTTCATATTGATTTGGG + Intronic
1032795579 7:135273574-135273596 ATTTTTCCACAGACTGGTTGGGG + Intergenic
1032817342 7:135490194-135490216 ATGTTTCAACAGAATGATAGTGG - Intronic
1033853102 7:145521962-145521984 ATTTTTCCACAGATGGGTTGTGG - Intergenic
1036963423 8:13270582-13270604 CTGATTCCACACATTGATGAGGG - Intronic
1037217628 8:16476978-16477000 CTGTTACCAGAGATTTACTGTGG + Intronic
1038504444 8:28072427-28072449 CTCTTTCCACAGACAGGTTGTGG - Intronic
1038728656 8:30105734-30105756 TTATTTCCATAGATTGAGTGGGG + Intronic
1039095781 8:33883492-33883514 CTGTGTCCACAGTTTAATTAGGG - Intergenic
1039100960 8:33941650-33941672 CTGTGTCCCCAGAATGAGTGGGG - Intergenic
1039170273 8:34737488-34737510 ATGTTTGCAAAGATGGATTGAGG - Intergenic
1040049166 8:42995037-42995059 CTGTGTCCCCATATTGAATGTGG + Intronic
1040353399 8:46591074-46591096 CTTCTTCCACAGGTTGTTTGAGG - Intergenic
1041119211 8:54569668-54569690 CTGTCACCACAGATTCACTGAGG + Intergenic
1043482303 8:80665663-80665685 CTGTTTTCAGAGGTTGAATGGGG - Intronic
1044577080 8:93781281-93781303 GTGCTTCCAAAGATTGATTGGGG + Intronic
1045872905 8:106946410-106946432 CTTTTTCCACAGATTGGTCCAGG + Intergenic
1047164373 8:122420832-122420854 CTGTTTCCAATGATTGGTTCAGG - Intergenic
1048174932 8:132143132-132143154 CTGTTCCAGCAGTTTGATTGAGG + Intronic
1049504534 8:142988894-142988916 CTGTTTCCTCAGGTTGGTTTAGG + Intergenic
1052116207 9:24651300-24651322 CTGTTTTTACAGACTGATTTAGG + Intergenic
1052219432 9:26001462-26001484 CTTTATCCACTCATTGATTGTGG - Intergenic
1054941989 9:70753631-70753653 GTTTTTACACAGATTGCTTGAGG + Intronic
1057177102 9:93008502-93008524 GTTTGTCCACAGTTTGATTGAGG + Intronic
1061780929 9:132995625-132995647 CTGCTTCCAAGGATTGAATGGGG + Intergenic
1062514920 9:136928236-136928258 TTGTTAAAACAGATTGATTGAGG + Intronic
1203560694 Un_KI270744v1:53986-54008 CTGTCTCCCCAGATTAACTGTGG + Intergenic
1187205733 X:17179257-17179279 CTATTTCCACAAATAGAATGTGG + Intergenic
1187533569 X:20117379-20117401 CTGTGTTCACACATTGAGTGAGG - Intergenic
1188146351 X:26618487-26618509 TGGTATCCACAGCTTGATTGTGG - Intergenic
1188884099 X:35528780-35528802 CCATTTCCACAGTTTGAATGAGG - Intergenic
1188929100 X:36083165-36083187 ATGTTTCCCCAGCTTGATTCAGG + Intronic
1192477316 X:71454216-71454238 CTGTTACCAGACATTGACTGAGG + Exonic
1192836211 X:74802170-74802192 CTTTTGCCACATATTGATTGTGG + Intronic
1194091101 X:89582502-89582524 CTGTTTCCACACAGTCATGGAGG + Intergenic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1198761482 X:140037459-140037481 GTCTTTCCACAGATTGGATGAGG - Intergenic
1202168522 Y:22017090-22017112 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202222839 Y:22569278-22569300 CTGTTTCCACAGAGTCATGAAGG + Intergenic
1202320276 Y:23626382-23626404 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202550491 Y:26043674-26043696 CTGTTTCCACAGAGTCATGAAGG + Intergenic