ID: 1029828315

View in Genome Browser
Species Human (GRCh38)
Location 7:103225255-103225277
Sequence GTGATAGCTGAGATGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029828315_1029828323 29 Left 1029828315 7:103225255-103225277 CCCTGTTCCATCTCAGCTATCAC No data
Right 1029828323 7:103225307-103225329 TTCAAATTTTGGACAAATTTTGG No data
1029828315_1029828322 18 Left 1029828315 7:103225255-103225277 CCCTGTTCCATCTCAGCTATCAC No data
Right 1029828322 7:103225296-103225318 ACTGTTGATTTTTCAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029828315 Original CRISPR GTGATAGCTGAGATGGAACA GGG (reversed) Intergenic
No off target data available for this crispr