ID: 1029831565 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:103265868-103265890 |
| Sequence | TAGGAAATACATAATGGGCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1029831560_1029831565 | 4 | Left | 1029831560 | 7:103265841-103265863 | CCAGGAAGTAGGCACCTGGGATA | No data | ||
| Right | 1029831565 | 7:103265868-103265890 | TAGGAAATACATAATGGGCATGG | No data | ||||
| 1029831557_1029831565 | 11 | Left | 1029831557 | 7:103265834-103265856 | CCATATTCCAGGAAGTAGGCACC | No data | ||
| Right | 1029831565 | 7:103265868-103265890 | TAGGAAATACATAATGGGCATGG | No data | ||||
| 1029831562_1029831565 | -10 | Left | 1029831562 | 7:103265855-103265877 | CCTGGGATACAGCTAGGAAATAC | No data | ||
| Right | 1029831565 | 7:103265868-103265890 | TAGGAAATACATAATGGGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1029831565 | Original CRISPR | TAGGAAATACATAATGGGCA TGG | Intergenic | ||
| No off target data available for this crispr | |||||