ID: 1029831565

View in Genome Browser
Species Human (GRCh38)
Location 7:103265868-103265890
Sequence TAGGAAATACATAATGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029831560_1029831565 4 Left 1029831560 7:103265841-103265863 CCAGGAAGTAGGCACCTGGGATA No data
Right 1029831565 7:103265868-103265890 TAGGAAATACATAATGGGCATGG No data
1029831557_1029831565 11 Left 1029831557 7:103265834-103265856 CCATATTCCAGGAAGTAGGCACC No data
Right 1029831565 7:103265868-103265890 TAGGAAATACATAATGGGCATGG No data
1029831562_1029831565 -10 Left 1029831562 7:103265855-103265877 CCTGGGATACAGCTAGGAAATAC No data
Right 1029831565 7:103265868-103265890 TAGGAAATACATAATGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029831565 Original CRISPR TAGGAAATACATAATGGGCA TGG Intergenic
No off target data available for this crispr