ID: 1029835143

View in Genome Browser
Species Human (GRCh38)
Location 7:103301514-103301536
Sequence AAGGAGAAACAGAAAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029835134_1029835143 25 Left 1029835134 7:103301466-103301488 CCAGCCTAGTTCCTTCCTTTATT 0: 1
1: 2
2: 1
3: 68
4: 774
Right 1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG No data
1029835137_1029835143 10 Left 1029835137 7:103301481-103301503 CCTTTATTTACACAGAACAACAG 0: 1
1: 0
2: 1
3: 25
4: 288
Right 1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG No data
1029835135_1029835143 21 Left 1029835135 7:103301470-103301492 CCTAGTTCCTTCCTTTATTTACA 0: 1
1: 0
2: 5
3: 49
4: 462
Right 1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG No data
1029835136_1029835143 14 Left 1029835136 7:103301477-103301499 CCTTCCTTTATTTACACAGAACA 0: 1
1: 0
2: 2
3: 30
4: 366
Right 1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029835143 Original CRISPR AAGGAGAAACAGAAAAAGGA AGG Intronic
No off target data available for this crispr