ID: 1029841408

View in Genome Browser
Species Human (GRCh38)
Location 7:103367604-103367626
Sequence GGTTTTCTTACCTCTAGATC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029841408_1029841410 -10 Left 1029841408 7:103367604-103367626 CCCGATCTAGAGGTAAGAAAACC 0: 1
1: 0
2: 0
3: 16
4: 211
Right 1029841410 7:103367617-103367639 TAAGAAAACCATTTCATTTTAGG 0: 1
1: 0
2: 5
3: 46
4: 611
1029841408_1029841411 -5 Left 1029841408 7:103367604-103367626 CCCGATCTAGAGGTAAGAAAACC 0: 1
1: 0
2: 0
3: 16
4: 211
Right 1029841411 7:103367622-103367644 AAACCATTTCATTTTAGGAAAGG 0: 1
1: 0
2: 3
3: 32
4: 416
1029841408_1029841412 -4 Left 1029841408 7:103367604-103367626 CCCGATCTAGAGGTAAGAAAACC 0: 1
1: 0
2: 0
3: 16
4: 211
Right 1029841412 7:103367623-103367645 AACCATTTCATTTTAGGAAAGGG 0: 1
1: 0
2: 3
3: 44
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029841408 Original CRISPR GGTTTTCTTACCTCTAGATC GGG (reversed) Exonic
900073996 1:797440-797462 AGTTTTCTCATCTCTAGAGCAGG - Intergenic
901927189 1:12573834-12573856 GGTTTCCTTATCTGTAAATCAGG - Intronic
903778859 1:25809295-25809317 AGTTTTCTCACCTGTGGATCCGG + Intronic
904288286 1:29467813-29467835 GGTTTTATTATCTATAGCTCTGG + Intergenic
905526374 1:38643095-38643117 GGACTTCTGACCTCTAGAACAGG + Intergenic
906476426 1:46172263-46172285 GGTTTTCTCATCTATAGATGAGG + Intronic
906906008 1:49893229-49893251 TGTTTTCTTAGTTCCAGATCAGG - Intronic
907935726 1:59040565-59040587 AGTTTCCTTACCTCTAAAACAGG - Intergenic
908261011 1:62339202-62339224 GGTTTTCTTATCTGTAAATGGGG + Intergenic
908375538 1:63535611-63535633 AGTTTTCTTACCTATAAATAGGG + Intronic
910500367 1:87883329-87883351 GGTTTTCTCACCTTTAAATGGGG + Intergenic
911827713 1:102508507-102508529 GGTTTTCTAGCCTCTAGAACTGG - Intergenic
912299368 1:108498375-108498397 AGTTTTCTTAACTCTAAAACTGG - Intergenic
912806201 1:112758893-112758915 GGTTTTCTGACCTTAAGATGGGG - Intergenic
912873645 1:113332722-113332744 AGTTTTCTCACCTGTAGACCTGG + Intergenic
914745268 1:150496919-150496941 GGTCTTCTTTCCTCTAGACCTGG - Intronic
916439008 1:164803892-164803914 AGTTTTCTTACCTGTAAAACAGG + Intronic
917169174 1:172150753-172150775 GGTTTTCTCATCTCTAAAACAGG + Intronic
917280087 1:173371637-173371659 GGTTTTTTTACTCCTAGATTTGG - Intergenic
917637419 1:176950513-176950535 GGTGTCCTTACCTCTAAATAGGG - Intronic
919870187 1:201814450-201814472 AGTTTTCTTACCTGTAAATTAGG + Intronic
921014195 1:211172136-211172158 GTTTTGCTTACCTGTACATCAGG + Intergenic
921732089 1:218589933-218589955 AGTTTTCTTACCTATAAAACAGG + Intergenic
922269850 1:224022348-224022370 AGTTTTCTCATCTCTAGAGCAGG - Intergenic
923583086 1:235237311-235237333 AGTTTCCTTATCTCTACATCGGG + Intronic
1063199063 10:3770090-3770112 GTTTTTCTTACCTCTAAAATGGG - Intergenic
1067135020 10:43600471-43600493 TCTTTTCTTACCACAAGATCAGG - Intergenic
1068110968 10:52680678-52680700 GGTTTTCATGCCTCTTGTTCTGG + Intergenic
1069258964 10:66370098-66370120 GATTTTCTTTCCTCTAGTTTGGG - Intronic
1073256846 10:102157749-102157771 GGTTTAATTTCCTCTAGATTCGG - Intronic
1074390743 10:113056177-113056199 GGTTTTCTTATCTCTAAAATGGG - Intronic
1078490350 11:11762502-11762524 GGTCTTCTAACCTCCAGCTCAGG + Intergenic
1078928589 11:15895956-15895978 GGTTTCCTTACTTATAGATGGGG + Intergenic
1079242250 11:18729246-18729268 GCTTTTCTTCCCTCTTCATCTGG + Intronic
1079363328 11:19788055-19788077 GGGTTACTTAGCTCTACATCTGG - Intronic
1079405514 11:20141959-20141981 AGGTTTCTTAACTCTAGTTCAGG - Intergenic
1079603394 11:22338608-22338630 CTTTGTCTTACCTGTAGATCTGG - Exonic
1080030857 11:27659217-27659239 GGTTTCCTTACCTGTAAAACAGG - Intronic
1081668427 11:44929989-44930011 TGTTTTCTTAGCTGTAGAGCAGG - Exonic
1083519961 11:63300318-63300340 GGTTTTTCTACATCTTGATCTGG - Intronic
1085887734 11:80540185-80540207 GGTTTTCTTACTTTATGATCTGG - Intergenic
1086234282 11:84609246-84609268 GGTTTTCTTATCTATATATTGGG + Intronic
1088942445 11:114473863-114473885 GGTTTCTTTACCTCTAAAACGGG + Intergenic
1091719897 12:2805156-2805178 GGTTTTCTTATCTGTAAATAGGG - Exonic
1095406064 12:41868686-41868708 GGTTTTCTTATCTGTAAAACTGG + Intergenic
1098293510 12:68981141-68981163 TATTTTCTTTGCTCTAGATCTGG - Intergenic
1102472388 12:113166787-113166809 AGTTTTCTTATCTATAGAACAGG - Intronic
1102657139 12:114491532-114491554 GGTCTTCTTCCCTCAAGACCTGG + Intergenic
1104546807 12:129720752-129720774 TGCTTTCTCACTTCTAGATCTGG + Intronic
1107000753 13:35541937-35541959 GGTTTTCTTATCTAAAGATGGGG - Intronic
1107803128 13:44129211-44129233 TCTTTTCTCACCTCTAGATCTGG - Intergenic
1107990634 13:45816022-45816044 GGTTTCCTCACCTCTAGAATGGG - Intronic
1109424663 13:62154024-62154046 GGTTTTTGTACTTCTAGAACTGG - Intergenic
1109586352 13:64409772-64409794 GCCTTTCTTACCTTTAAATCAGG + Intergenic
1109856379 13:68133386-68133408 AGTTTTCTTACTTCTAAATTAGG - Intergenic
1110191795 13:72738854-72738876 GGTTTTCTTACCTATAAAATGGG - Intronic
1110483038 13:76005268-76005290 GGTTTATTTACATCTAGTTCTGG + Intergenic
1111824880 13:93255147-93255169 CGTTTTCTTTCCACTAGTTCTGG - Intronic
1113147971 13:107229899-107229921 GTTTTTCTTACCTCTTGCACTGG - Intronic
1114524181 14:23357892-23357914 GGTTTCCTTAACTCTAAAACAGG + Intronic
1114969343 14:28005876-28005898 GGCTTTCTTGCCTGTAGAACAGG - Intergenic
1116414025 14:44659211-44659233 GGTTTTCTTACCTCTGTCTTTGG + Intergenic
1116417164 14:44692644-44692666 GGTTTTCTGACTCCTAAATCAGG - Intergenic
1118184831 14:63527609-63527631 GGTTTTCTTCTCTCTAAAACTGG - Intronic
1119352530 14:73977878-73977900 GGATTCCTTAAGTCTAGATCTGG - Intronic
1122402152 14:101473890-101473912 GGTTTTCTCATGTCTAGAGCTGG + Intergenic
1125174375 15:36804090-36804112 GGTTTTTTTACTTGTAGAACAGG + Intronic
1139790740 16:69432691-69432713 TGTTTTCTCACCTCTAAAACAGG - Intronic
1139854106 16:69967165-69967187 GGCTTTCTCACCTCCAGATAAGG - Intergenic
1139883087 16:70190079-70190101 GGCTTTCTCACCTCCAGATAAGG - Intergenic
1140369421 16:74405441-74405463 GGCTTTCTCACCTCCAGATAAGG + Intergenic
1141033576 16:80609868-80609890 CGTTTTCTTAGCTCTAGAGTGGG - Intronic
1141473706 16:84257545-84257567 GGTTTTCTAACCTAGAGAGCGGG - Intergenic
1143045820 17:4078460-4078482 GGTTATCTGACCTCCAGATACGG + Intronic
1143088479 17:4434284-4434306 GGTGTTCTCACCTCTAGAGGTGG + Intronic
1146658997 17:34652133-34652155 GGTTCTCTTACCTTTGGATTGGG + Intergenic
1147508853 17:41047909-41047931 TGTTTTCTTTTCTCTAGTTCAGG + Intergenic
1147595201 17:41712376-41712398 GGTTTTCTCACCTGCAGAGCTGG - Exonic
1150691026 17:67366892-67366914 GGTTTTCTCATCTCTACATCAGG + Intergenic
1153082254 18:1241567-1241589 GGTTTTCTTAGCTCTAGTGAAGG - Intergenic
1156167818 18:34444310-34444332 GGATTCCTTACCTATGGATCAGG + Intergenic
1156631346 18:38972996-38973018 GGTTTCCTTATCTGTAAATCAGG + Intergenic
1159130982 18:64280246-64280268 TGTTTTCCTACCTCCAGGTCAGG - Intergenic
1160388934 18:78515642-78515664 GGCTTTCTTCACTCTAGAGCAGG + Intergenic
1160410820 18:78674292-78674314 AGTTGTATTACCTCTAGATGAGG + Intergenic
1160903695 19:1441972-1441994 CGTGTTCTTACCTCTCGATTTGG + Intergenic
1162384870 19:10354706-10354728 AGTTTTCTTACCTCTAGAATCGG - Intronic
1162436346 19:10661946-10661968 GGTTTCCTGACCTCTGGAGCTGG - Intronic
1164023858 19:21332370-21332392 TGTTTTCTGAACACTAGATCTGG - Intergenic
1164412783 19:28019859-28019881 GGTTTTCTCATCTCTAAAACCGG + Intergenic
1165599579 19:37042460-37042482 GGTTTACTTACATTTAGTTCTGG - Intronic
1166295919 19:41889340-41889362 GGTTTTCTTGTTTCCAGATCAGG - Intronic
1166766331 19:45253659-45253681 AGTTTCCTTATCTCTAAATCGGG + Intronic
1167551552 19:50164357-50164379 GTTTTTCTCAGCTCTAGCTCTGG - Intergenic
925111339 2:1341025-1341047 GGTTTTCTCACCTATAAATTGGG - Intronic
925470489 2:4156037-4156059 GGTTTCCTTACCTGGAGATGAGG + Intergenic
925474872 2:4202079-4202101 ACTTTTATTATCTCTAGATCAGG - Intergenic
926410997 2:12602621-12602643 AGTTTTCTCACCTGTAGAGCTGG - Intergenic
927697782 2:25249837-25249859 GGTTTTCTCCCCTCTAAATCTGG - Intronic
930342100 2:50130062-50130084 GGTTTTCTTATCTGTAAAACGGG - Intronic
931662505 2:64579574-64579596 AGCTTTCTTAACTCTAGCTCTGG - Intronic
935459066 2:103307280-103307302 GGTCTTCTGACCTCTAGAACTGG - Intergenic
939191229 2:138918663-138918685 AGTTTTATTTGCTCTAGATCAGG + Intergenic
939261414 2:139815074-139815096 GGTTTTCTTATCTCTAAAATGGG + Intergenic
941708710 2:168688520-168688542 GGTTTTCTTATCTATAAATTGGG + Intronic
942692757 2:178604300-178604322 GTTTTTCTAATTTCTAGATCTGG - Exonic
943089183 2:183353637-183353659 GGTTGGCTTACCTTTTGATCAGG + Intergenic
945427318 2:209722882-209722904 GGTTTTCTTTCCTCTAAAAATGG + Intronic
947360088 2:229337989-229338011 AGTTTTCTCACCTGTAGATAAGG - Intergenic
947963383 2:234258828-234258850 GGTGTTCTTACCTATAGCTCGGG - Intergenic
948233532 2:236369921-236369943 GGTTTTCTGCCCTCTTGATCTGG - Intronic
1169160799 20:3376754-3376776 AGTTTTATTACCTAAAGATCTGG + Intronic
1169391241 20:5192988-5193010 GCTTTCCTTCCCTCTAGCTCAGG + Exonic
1169451692 20:5717470-5717492 GGTCTTCTTTCCTCTAGACTGGG - Intergenic
1169889880 20:10440982-10441004 GGTTTTCTTACCTCTGAAATGGG - Intronic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1170541690 20:17395572-17395594 AGTTTTCTTACCTGTAGAATGGG + Intronic
1172715227 20:36958186-36958208 CTTTCTCTTACCTCTAGATGTGG - Intergenic
1172917015 20:38450763-38450785 GGTTTTCTTCCATCTAGGCCAGG + Intergenic
1174421484 20:50401879-50401901 GGTTTTCTTATCTGTAGAATGGG - Intergenic
1174941998 20:54939645-54939667 GGTTTTCTTATCTATAGAATAGG + Intergenic
1176421161 21:6516975-6516997 TATTTACTTACCTCAAGATCAGG - Intergenic
1178615481 21:34129269-34129291 GGTTCTCTTTCCACTAGATGGGG + Intronic
1179696651 21:43125292-43125314 TATTTACTTACCTCAAGATCAGG - Intergenic
1181011302 22:20042407-20042429 AGTTTTCTTTCCTCAAGACCAGG + Intronic
1181852222 22:25757710-25757732 GCTTTTCTCACTTCTAGCTCTGG - Intronic
1182009546 22:26989133-26989155 GGTCTTCTTACTCCTAGAGCTGG + Intergenic
1182547655 22:31085201-31085223 TGGTTTCTTCCCTTTAGATCCGG + Intronic
1182824404 22:33252099-33252121 TTTTTTATTACCTCTATATCTGG + Intronic
1183057448 22:35315602-35315624 GGTTGCTTTACCCCTAGATCAGG - Intronic
1183600558 22:38837724-38837746 GGTTTTCTTATCTGTAAAACAGG - Intronic
1184662857 22:45973413-45973435 GATTTTCTAACTTCTAGACCTGG + Intronic
1184862332 22:47179853-47179875 GGTTTTCTTTCCCCTAGAAGCGG + Intergenic
1185169156 22:49282335-49282357 GGTTTTCTCATCTGTAGATTGGG + Intergenic
950313123 3:11976338-11976360 GGTTTCCTTACCTGTAAAACAGG - Intergenic
950787089 3:15445890-15445912 TGTTTTCTTACCTCTAAATGGGG - Intronic
952183742 3:30946078-30946100 AGTTTCCTTACCTCTACAACAGG - Intergenic
953831129 3:46298363-46298385 GGTTTTCTTATCTGTAAATCAGG + Intergenic
954229045 3:49201911-49201933 GGTTTTCTTTCCTTTTGAGCTGG - Intronic
955555268 3:60130232-60130254 GGTTTTCTCATCTCTAAAACTGG + Intronic
955689332 3:61575486-61575508 GGTTTTCTTACCTTTAAAATGGG + Intronic
957623611 3:82628490-82628512 TGTTTTTTTATCTCTAGATTGGG - Intergenic
957888177 3:86318170-86318192 AGTTTTCTCACCTCTAAATTGGG - Intergenic
959748715 3:109808195-109808217 AGTTTCCTTACTCCTAGATCTGG + Intergenic
963076384 3:141351114-141351136 GGTTGTGTTATCTCTAGGTCAGG + Intronic
963291508 3:143494718-143494740 GGTTTTCCTAGCTCTAGGCCTGG - Intronic
964088211 3:152844008-152844030 GGTCTTCTGACCTCTTCATCTGG + Intergenic
965787986 3:172356529-172356551 GGTTTTTTTGCCTCCAGAGCAGG + Intronic
966012454 3:175097606-175097628 GTTTTTATTACCTGTATATCTGG - Intronic
967320834 3:188193383-188193405 GGTTTCCTTACCTGTAAAACGGG + Intronic
967395668 3:189006246-189006268 AGTTTTCTTACCTTAACATCTGG + Intronic
967786479 3:193502482-193502504 AGTTTACTTACCTTTAGGTCTGG + Exonic
968933688 4:3597934-3597956 GGATTTCTGACCTCCAGAACTGG - Intergenic
970170406 4:13283680-13283702 AGTTTTCTAACCTGTAAATCAGG - Intergenic
971936025 4:33148668-33148690 GGTTTTCTTACCTTTAAAATAGG + Intergenic
972517567 4:39822298-39822320 GACTTTCTTACCTCTCGTTCTGG + Intergenic
973035505 4:45401149-45401171 TGTCTTCTAACCTCTAGAGCTGG - Intergenic
977213004 4:94242937-94242959 GGATTTCTTCCCTCTTTATCAGG + Intronic
978380101 4:108117844-108117866 GGTTTTCTTATCTCTAAAATGGG - Intronic
978417532 4:108492719-108492741 GGTTTTCTTAGCTCTTGCTAAGG - Intergenic
979931476 4:126637063-126637085 GCTTTTCTTAGCTCTGAATCTGG - Intergenic
980516796 4:133874454-133874476 GGTTTTGTTATCTCTAGTTCAGG + Intergenic
981226174 4:142297314-142297336 GGTTGACTTAACTCTGGATCTGG - Intronic
981888237 4:149704530-149704552 CGTTTTCTGACCCCTAGATTAGG + Intergenic
983496848 4:168451598-168451620 GGTTTCCTCACCTCTATATTTGG + Intronic
983561794 4:169108956-169108978 GGCTTTATTGCCTCTGGATCTGG - Intronic
984253780 4:177365953-177365975 GGTTGTCTTTCCTCTAAAACTGG - Intergenic
986574610 5:9198989-9199011 TGTTTTCTTACCTGTAAGTCAGG - Intronic
990595060 5:57304200-57304222 GGCTTCCTTACCTGTAGAACAGG + Intergenic
991277296 5:64864143-64864165 GGTTTTCTTATTTGTATATCTGG + Intronic
992918378 5:81483541-81483563 GGTTTTCTTACCTGTAAAATAGG - Intronic
993213615 5:84989330-84989352 GGTTTCATAACTTCTAGATCAGG - Intergenic
995571871 5:113489353-113489375 AGTTTTCTTACCTGTAAATTGGG - Intergenic
996135791 5:119840653-119840675 GGTTTTCCTACTTCTAGCTTAGG + Intergenic
997582502 5:135026639-135026661 GGTTTTCTCACCTTCAGATGAGG - Intergenic
999645080 5:153709865-153709887 GGTTTTCCAACCTCTAGAGTAGG + Intronic
1001239849 5:170060201-170060223 GGATCTCTGACCCCTAGATCAGG - Intronic
1001400637 5:171444365-171444387 GGTTTTCTCACCTGTAAATTGGG + Intronic
1002411695 5:179084024-179084046 GGATTTCTAACCTGAAGATCAGG + Intergenic
1002554953 5:180029731-180029753 GGTTTTGTTATGTCTAGAACAGG + Intronic
1005375736 6:25180480-25180502 GATTTTCTTTCCTCTAGAGCTGG - Intergenic
1005430169 6:25748367-25748389 TGTTTTATTATCTCAAGATCTGG - Intergenic
1005771247 6:29074665-29074687 GGTTTTCTTACTTTTAGTTTCGG - Intronic
1009240213 6:61176684-61176706 TTTTTACTTACCTCAAGATCAGG - Intergenic
1012655182 6:101808114-101808136 TGTTTTCTTCCCTCTAGAGCTGG - Intronic
1015636709 6:135282704-135282726 GGTTTCCTTAGTTCTAGAGCAGG + Intergenic
1017894400 6:158666714-158666736 GGGTTTCTTCCCCCTAAATCCGG + Intronic
1018868117 6:167760893-167760915 GGGTTCCTTAACTCCAGATCTGG - Intergenic
1021402955 7:20230989-20231011 AGTTTTCTTACCTGTAAATAGGG - Intergenic
1027552114 7:79612110-79612132 GGCTTTCTTAGGTCTAGAACTGG - Intergenic
1028504795 7:91559094-91559116 TGATTTCTTACCTCTAGACATGG - Intergenic
1028699664 7:93762566-93762588 GGGTTTCTTCCCACTAGATCTGG + Intronic
1029841408 7:103367604-103367626 GGTTTTCTTACCTCTAGATCGGG - Exonic
1030099627 7:105934003-105934025 GGTGTTCATACCTCTTGATTTGG - Intronic
1034510316 7:151528781-151528803 GGTTTTTTTAGGTCTAGACCAGG + Intergenic
1035541637 8:444037-444059 AGTTTTCTCATCTCTAGAGCAGG + Intronic
1037468378 8:19183461-19183483 GGTTAGCTGACCTCTAGCTCTGG - Intergenic
1038075273 8:24066258-24066280 GGTTTGCTTAACTCCAAATCTGG - Intergenic
1038585769 8:28787818-28787840 TGTTTTCTTACCTCTGCATGAGG + Exonic
1038869401 8:31478163-31478185 AGATTTCTAACCTCTAGAACTGG - Intergenic
1039649037 8:39320708-39320730 TGTGTTTTTTCCTCTAGATCAGG + Intergenic
1041406729 8:57507799-57507821 AGTTTTCTTACCTATAGAATGGG + Intergenic
1043419433 8:80083904-80083926 AATGTTCTTACCTCTAGATTAGG + Intronic
1043831108 8:84990539-84990561 GGATTTCTAACCTCCAGAACTGG - Intergenic
1045831282 8:106463855-106463877 GGTTTTCCTATTTCTAAATCAGG - Intronic
1046020435 8:108658378-108658400 CATGTGCTTACCTCTAGATCTGG + Intronic
1046143500 8:110125969-110125991 GGATTTCTTAACTATAAATCAGG + Intergenic
1046862404 8:119108230-119108252 GGTTTTCATTCCTCATGATCTGG - Intergenic
1047039786 8:120980066-120980088 CGTTTTCTTACCTCTAAAATAGG + Intergenic
1047552019 8:125884586-125884608 GGATTTCTTATCAGTAGATCAGG - Intergenic
1049342000 8:142118150-142118172 GGGCTTCTGACCTCTAGAGCCGG + Intergenic
1052194756 9:25698087-25698109 GGTCTTCTTACCTGAATATCTGG + Intergenic
1052318799 9:27144847-27144869 GCTTTTCTTCCCTCTCGAACAGG - Intronic
1052412660 9:28142358-28142380 GATTTTGTTACTGCTAGATCTGG + Intronic
1052422102 9:28255756-28255778 GTTATTATTACCTCAAGATCAGG - Intronic
1052453101 9:28657773-28657795 TATTTTCTTACTTCTAGATTTGG + Intronic
1055382862 9:75727973-75727995 GGTTTACTTCCCTGTAGTTCAGG - Intergenic
1059301347 9:113316016-113316038 TGTTTTCTTATCTGTAGAGCTGG + Exonic
1060468020 9:123924868-123924890 GGTTTTCTTGCCTCAAGGCCTGG + Intronic
1062719848 9:138034299-138034321 GGTCTTGTTACCACTAGATAGGG + Intronic
1188094734 X:26007401-26007423 TGTTTTCTTACATCTTTATCTGG - Intergenic
1193028151 X:76868005-76868027 GGTTTCTCTACCTCGAGATCTGG + Intergenic
1193801428 X:85941335-85941357 GCATTTCTTACTTGTAGATCTGG - Intronic
1194502259 X:94696186-94696208 GGTTTTCAGGCCTCTAGATCTGG + Intergenic
1194710514 X:97230900-97230922 AGTTTTCATACCTGTAGAACAGG - Intronic
1195521050 X:105829615-105829637 TGTTTTCTTACCTTTAAATATGG - Intronic
1199692857 X:150321866-150321888 GGTTTCCTCAGCTCTAAATCTGG - Intergenic
1201505637 Y:14696366-14696388 GGTTTTCTGGCCTCCAGAACTGG - Intronic