ID: 1029847867

View in Genome Browser
Species Human (GRCh38)
Location 7:103431507-103431529
Sequence ATAGAGAAAGGGTCTCATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 14, 3: 79, 4: 467}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029847864_1029847867 8 Left 1029847864 7:103431476-103431498 CCACAGCTGGCTAATTTTTAAAT 0: 18
1: 573
2: 3477
3: 26308
4: 66401
Right 1029847867 7:103431507-103431529 ATAGAGAAAGGGTCTCATTATGG 0: 1
1: 0
2: 14
3: 79
4: 467
1029847863_1029847867 11 Left 1029847863 7:103431473-103431495 CCACCACAGCTGGCTAATTTTTA 0: 53
1: 2568
2: 33394
3: 91381
4: 180790
Right 1029847867 7:103431507-103431529 ATAGAGAAAGGGTCTCATTATGG 0: 1
1: 0
2: 14
3: 79
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029847867 Original CRISPR ATAGAGAAAGGGTCTCATTA TGG Intronic
901426703 1:9186207-9186229 GTAGAGATGGGGTCTCACTATGG - Intergenic
902290954 1:15434387-15434409 ATGGAGAAAGGGGCCCATGAAGG + Intergenic
903102561 1:21044832-21044854 GTAGAGACAGGGTCTCAGAAGGG + Intronic
903936607 1:26899751-26899773 ATAGAGAAAGGGTCTCAAAAGGG + Intronic
905041663 1:34965025-34965047 ATTGAGACAGGGTCTCACTCTGG - Intergenic
905227284 1:36487563-36487585 GTAGAGAAAGGGTTTCACCATGG + Intergenic
907175108 1:52513374-52513396 TTTGAGACAGGGTCTCATTCTGG - Intronic
907406446 1:54256532-54256554 TTAGAAAAGGGGTCTGATTACGG - Intronic
907797249 1:57729875-57729897 TTAGAGATGGGGTCTCACTATGG - Intronic
908112103 1:60908163-60908185 AAGAAGAAAGGGTCTCATGAAGG + Intronic
909352137 1:74666431-74666453 ATACTGAAAGAGTCTCAGTAAGG + Intronic
909496566 1:76285635-76285657 ATAGAGGAAGGTACTCATGAGGG + Intronic
910894012 1:92048719-92048741 TTAGAGACAGGATCTCATTTAGG + Intronic
911415474 1:97566509-97566531 TTAGAGGAAGGGACTTATTAAGG - Intronic
911978964 1:104541827-104541849 ATAAAGAAGGGCTCTCAATAGGG - Intergenic
912314632 1:108656660-108656682 GTAGACACAGGGTCTCACTATGG + Intronic
914764584 1:150626739-150626761 ATAGAGACGGGGTTTCACTATGG + Intronic
915111909 1:153569195-153569217 AAAGAGAAATGGCCTCATTGTGG + Intergenic
915215179 1:154335506-154335528 GTAAAGACAGGGTCTCACTATGG - Intronic
915230902 1:154444711-154444733 GTAAAGACAGGGTCTCCTTATGG - Intronic
915964433 1:160294174-160294196 ATAGAGACAGGGTCTTGCTATGG + Intronic
916903734 1:169258152-169258174 GTAGAGACAGGGTCTCACTATGG - Intronic
916969595 1:169997685-169997707 GTAGAGACAGGGTTTCATCATGG - Intronic
917110207 1:171539845-171539867 CGAGAGAAAGATTCTCATTATGG + Intronic
917320947 1:173780912-173780934 ATAGAGATGGGGTTTCACTATGG + Intronic
917551830 1:176040499-176040521 GTAGAGACAGGGTCTCATGCAGG + Intronic
918891792 1:190282138-190282160 ATAGAGAAAGGGAATCATTAGGG - Intronic
919570822 1:199244670-199244692 ATAGAGACAGGGTTTCACCATGG - Intergenic
919577804 1:199333476-199333498 GTAAAGACAGGGTCTCATTTTGG - Intergenic
919771660 1:201164653-201164675 ATAGAGAAATGGTATCCTGAGGG + Intronic
920820688 1:209377908-209377930 TTTGAGACAGGGTCTCATTCTGG - Intergenic
920906276 1:210172962-210172984 GTAGAGACAGGGTCTCACTATGG + Intergenic
921563171 1:216683062-216683084 ACAGAGACAGGGTGTCATTATGG + Intronic
921627798 1:217397423-217397445 ATAGAGATAGGGTCTGAGAAGGG - Intergenic
922522867 1:226272567-226272589 GTAGAGACAGGGTCTCACTATGG + Intronic
922683573 1:227621066-227621088 ATAGAGATGAGGTCTCAGTATGG - Intronic
923049841 1:230383255-230383277 GTAGAGACAGGGTCTCACTATGG + Intronic
923255842 1:232220643-232220665 ATAGAGACAGTGTCTCACTTAGG - Intergenic
923302627 1:232656034-232656056 TTTGAGACAGGGTCTCATTCTGG + Intergenic
923814537 1:237361022-237361044 GTAGAGACAGTGTCTCACTATGG + Intronic
924520332 1:244800850-244800872 ATAGAGATGGGGTCTTGTTATGG + Intergenic
1063311794 10:4959517-4959539 GTAGAGACAGGGTTTCACTATGG - Intronic
1063316005 10:5006955-5006977 GTAGAGACAGGGTTTCACTATGG + Intronic
1063513385 10:6669563-6669585 ATAGTTAAATGTTCTCATTATGG + Intergenic
1063584805 10:7342592-7342614 ATAGAGACAGGGTTTCACCATGG + Intronic
1063647294 10:7897842-7897864 GTAGAGACAGGGTCTCACTTTGG + Intronic
1063825256 10:9890092-9890114 GTAGAGACAGGGTTTCATTATGG - Intergenic
1064247528 10:13680858-13680880 GTAGAGCAGGGGTCTCACTATGG - Intronic
1064275254 10:13899643-13899665 ATAGAGACAGGGTCTCGCTCTGG - Intronic
1065003011 10:21354257-21354279 GTAGAGACAGGGTCTCACTCCGG + Intergenic
1065236759 10:23659989-23660011 GTAGAGATAGGGTTTCATCATGG - Intergenic
1065249058 10:23792087-23792109 AAATAGAAAGTCTCTCATTAGGG + Intronic
1065290187 10:24221961-24221983 TTAGAGACGGGGTCTCATTTTGG - Intronic
1066069061 10:31786586-31786608 GTAGAGAAGGGGTCTCACTGTGG + Intergenic
1066099760 10:32107295-32107317 ACAGAGACAGGGTCTCATTATGG + Intergenic
1066378966 10:34885263-34885285 TTAGAGACAGAGTCTCACTATGG - Intergenic
1066570855 10:36770223-36770245 AAAGAGAAAGGGCCTTACTAAGG - Intergenic
1068132608 10:52913123-52913145 GTAGAGGCAAGGTCTCATTATGG - Intergenic
1069003792 10:63295279-63295301 GTAGAGACAGGGTCTCACTCAGG + Intronic
1069063119 10:63914689-63914711 TTAGAGAAAGGGTCTTAAAAGGG + Intergenic
1069401356 10:68050173-68050195 TTTGAGAAAGGGTCTCACTTTGG - Intronic
1070065907 10:73034194-73034216 TTAGAGATAGGTTCTCATTCTGG - Intronic
1071225129 10:83520184-83520206 TTAGAGACAGGGTCTCACTCTGG - Intergenic
1071456499 10:85855315-85855337 AGAGAGAAAGGGGCTCACCACGG - Intronic
1071485789 10:86101835-86101857 GTAGAGACAGAGTCTCATTATGG + Intronic
1072278709 10:93846711-93846733 ATAGAGACAGTGTCTCACTCTGG - Intergenic
1072417042 10:95257196-95257218 ATAGAGACAGGGTCTCAGGCTGG - Intronic
1072649545 10:97283949-97283971 TTAGAGACAGGGTCTCACTCTGG + Intronic
1073739569 10:106391413-106391435 TTAAAGAAAGGGTCTAGTTATGG + Intergenic
1074118805 10:110478013-110478035 TTAGAGACAGGGTCTCACTATGG - Intergenic
1074688205 10:115979222-115979244 GTAGAGACAGGGTCTCACTATGG - Intergenic
1075059228 10:119243053-119243075 GTAGAGACAGGGTTTCATCATGG - Intronic
1075120459 10:119660660-119660682 TTAGAGACAAGGTCTCACTATGG - Intronic
1075450152 10:122545556-122545578 CTAGAGGCAGGGTCTCATTATGG + Intergenic
1077128453 11:956154-956176 ATAGAGACAAGTTCTCACTACGG - Intronic
1078033029 11:7772953-7772975 ATAGATAAAGGGGTTCAGTATGG + Intergenic
1078076322 11:8164758-8164780 AGAGAGACAGGGTCTCACTCTGG - Intronic
1078311397 11:10246889-10246911 GTAGAGACAAGGTCTCACTATGG - Intronic
1080474610 11:32578017-32578039 ATAGAGACAGGGTTTCACCATGG - Intergenic
1080936036 11:36864812-36864834 AAATAGAAAGTATCTCATTAAGG - Intergenic
1081197516 11:40179186-40179208 CTAGAGACAGGGTCTCTCTATGG + Intronic
1081944273 11:46975090-46975112 GTAGAGACAGGGTCTCACTATGG - Intronic
1082173013 11:49028489-49028511 CTAGAGAAAGGGTCTCCTTCTGG - Intronic
1082186406 11:49187124-49187146 AGAGAGAAAAGGTCTCATTAAGG - Intronic
1082826293 11:57582133-57582155 TTAGAGATAGGGTCTCACTATGG - Intergenic
1082862481 11:57869185-57869207 CTAGAGACAGGGTCTCACTAGGG + Intergenic
1082911581 11:58382048-58382070 AAAAAGAAAGGGACACATTAAGG + Intergenic
1083974907 11:66110587-66110609 TTTGAGAAAGGGTCTCACTCTGG + Intronic
1083984604 11:66204956-66204978 ATAGAGATGGGGTTTCACTATGG - Intronic
1084856551 11:71991919-71991941 GTAGAGATGGGGTCTCACTATGG - Intronic
1086679930 11:89658251-89658273 AGAGAGAAAAGGTCTCATTAAGG + Intergenic
1086692758 11:89807563-89807585 CTAGAGAAAGGGTCTCCTTCTGG + Intronic
1086713044 11:90032096-90032118 CTAGAGAAAGGGTCTCCTTCTGG - Intronic
1087036627 11:93762585-93762607 ATAGAGATGGGGTCTCACCATGG - Exonic
1087433138 11:98079117-98079139 GTAGAGACAGAGTCTCACTATGG - Intergenic
1088672781 11:112159672-112159694 AAAGAGAAAGGGTTTCAGGAGGG + Intronic
1089133884 11:116234056-116234078 TTAGAGACAGGGTCTCACTATGG + Intergenic
1089990906 11:122858710-122858732 ATAGAGACAGAATCTCATTATGG + Intronic
1090450317 11:126800424-126800446 CTACAGAAACGGTCTCATTAGGG + Intronic
1091576725 12:1743643-1743665 TTAGAGATAGGGTCTCACTCTGG - Intronic
1093201176 12:16188053-16188075 ATAGAAAAAGGTGCTCATTGTGG - Intergenic
1094021016 12:25914406-25914428 TTAGAGACAGGGTCTCACTCTGG - Intergenic
1094768589 12:33626657-33626679 ATAGAGAGGGGGTCTCACTATGG - Intergenic
1096057841 12:48669704-48669726 GTAGAGACAGGGTTTCATTGTGG + Intronic
1096241946 12:49964304-49964326 ACAGAGAAAGGGACACAGTAGGG + Intronic
1099609365 12:84848174-84848196 TTAGAGAAAAGGTCTCTCTATGG - Intergenic
1100296302 12:93265227-93265249 TTAAAGACAGGGTCTCACTATGG - Intergenic
1100387794 12:94119686-94119708 TTTGAGACAGGGTCTCACTATGG + Intergenic
1100921296 12:99491118-99491140 ATAGAGATGGGGTTTCACTATGG - Intronic
1102092126 12:110200051-110200073 AAAAAGAAAGGGTAACATTATGG - Intronic
1102293250 12:111718346-111718368 ATAAAGAAAGGATATCACTAGGG - Intronic
1102392332 12:112559360-112559382 ATAGAGACAGGGCCTCACTATGG + Intergenic
1102433616 12:112902932-112902954 TTAGAGACAGGGTCTCACTATGG + Intergenic
1102498783 12:113337162-113337184 AAAGAGATAGGGTGTCATCAGGG - Intronic
1102511200 12:113416686-113416708 GTAGAGATGGGGTCTCAGTATGG + Intronic
1102781741 12:115571486-115571508 TTAGAGACAGGGTCTCACTGTGG + Intergenic
1102863686 12:116357583-116357605 ATAGAGAAAGAGATTTATTATGG + Intergenic
1103307489 12:119977039-119977061 TTTGAGACAGGGTCTCATTCTGG + Intergenic
1103405194 12:120670018-120670040 TTAGAGACAGGGTCTCACTCTGG + Intergenic
1103435925 12:120925288-120925310 GTAGAGACAGGGTCTTGTTATGG - Intergenic
1103541922 12:121672274-121672296 GTAGAGATAAGGTCTCACTATGG - Intronic
1104195466 12:126532974-126532996 ATAGAGACAGGGTTTCACCATGG + Intergenic
1104459880 12:128946529-128946551 ATAGAGACAGGGTTTCACCATGG + Intronic
1105399291 13:20074247-20074269 AGAGAGACAGGGTCTCACTCTGG + Intronic
1105903493 13:24780056-24780078 AGAGAGAAAGAGACTCACTAAGG - Intronic
1106523202 13:30516732-30516754 GTATAGACAGGGTCTCACTATGG - Intronic
1107263614 13:38524944-38524966 ATGGAGAAAGGGGCCCACTAGGG + Intergenic
1107337275 13:39368396-39368418 ATAGAGACAGGGTTTCACCATGG - Intronic
1107922044 13:45218707-45218729 CAAGAAAAAGGGTCTCATTTAGG + Intronic
1108375683 13:49811881-49811903 ATAGGGATGGGGTCTCACTATGG - Intergenic
1108428816 13:50333523-50333545 GTAGAGAAGGGGTCTCACTATGG - Intronic
1108467163 13:50727871-50727893 AGAGAGAAGGTGTCTCATTCTGG - Intronic
1108871068 13:54986935-54986957 GTAAAGACAGGGTCTCACTATGG + Intergenic
1109089189 13:58017353-58017375 ATAGAGATGGGGTCTCACTATGG - Intergenic
1109627160 13:64990973-64990995 ACAGATAAAGGGTTTCATTTTGG - Intergenic
1109671868 13:65619404-65619426 ATAGATTAAGGATCTCAGTAAGG + Intergenic
1109902622 13:68794274-68794296 AGAGAGAAAGGTTCCCATAAAGG - Intergenic
1111382571 13:87478192-87478214 AGAGTGAGAGGGTGTCATTATGG + Intergenic
1112421748 13:99257963-99257985 ATAGAGACGGGGTCTCACTATGG + Intronic
1112601787 13:100862795-100862817 GTAGAGACAAGTTCTCATTATGG + Intergenic
1112875820 13:104037223-104037245 ATACAGAATGGGTATCATCAAGG - Intergenic
1113018781 13:105858615-105858637 ATTAACAAAGGGTCTCTTTAAGG + Intergenic
1113059279 13:106303905-106303927 ATAGTGAAATGGGCTCTTTAAGG + Intergenic
1113060585 13:106317964-106317986 ATAGAGAATGGGTTTAATTTGGG + Intergenic
1115154766 14:30325626-30325648 GTAGAGACAGGATCTCACTATGG - Intergenic
1115773389 14:36689230-36689252 ATAGTGAATGGGTTTCATGAAGG - Intronic
1117211066 14:53500632-53500654 ATGGAGCCAAGGTCTCATTAAGG + Intergenic
1117296213 14:54381751-54381773 TTAGAGACAGGGTCTCCTTCTGG - Intergenic
1117375977 14:55118536-55118558 TTAGAGAAAAGGTCTTAGTAAGG - Intergenic
1118170983 14:63388322-63388344 ATAGAGACAGGGTTTCACCATGG + Intronic
1119187922 14:72657187-72657209 TTAGAGAAATGGTCTCTTTGGGG - Intronic
1119251380 14:73157800-73157822 ATAGAGAAGGGGTTTCATGTTGG - Intronic
1120219922 14:81720289-81720311 CAAAAGAAAGGGTCTCTTTAAGG + Intergenic
1120466024 14:84858813-84858835 TTAGAGAAGGGGTTTCATTTAGG - Intergenic
1120794672 14:88619398-88619420 ATAGAGGCGGGGTCTCACTATGG + Exonic
1121633123 14:95435815-95435837 ATAGTGAAAGGTTTTCATTAGGG + Intronic
1122180048 14:99948265-99948287 ATAGAGACAGGGTTTCACCATGG - Intergenic
1122364580 14:101187076-101187098 GCAGGGAAGGGGTCTCATTAAGG - Intergenic
1123993951 15:25705247-25705269 GTAGAGACAGGGTCTCACTCAGG - Intronic
1124514681 15:30356558-30356580 ATAGAGACAGGGTTTCAATTTGG + Intergenic
1124728240 15:32174204-32174226 ATAGAGACAGGGTTTCAATTTGG - Intergenic
1125869828 15:43089623-43089645 ATAGAGAAGGGGTCTCACCTAGG + Intronic
1126617085 15:50595018-50595040 AAATAGACAGGGTCTCACTATGG - Intronic
1126683128 15:51223385-51223407 AGAGAGAAAGGGGCACTTTAAGG - Intronic
1126749972 15:51866701-51866723 TTAAAGAAAGATTCTCATTAAGG - Intronic
1127237934 15:57076036-57076058 GTAGAGACAGGGTCTCACTTAGG + Intronic
1127258015 15:57307538-57307560 ATAGAGAAAGGAGTTCATGAAGG + Intergenic
1128060055 15:64729742-64729764 GTAGAGACAGGGTCTCACTATGG - Intergenic
1128476239 15:67999279-67999301 CAAGATAAAGGGTCTCCTTATGG + Intergenic
1128660383 15:69496794-69496816 GTAGAGACTGGGTCTCGTTATGG + Intergenic
1128710229 15:69866193-69866215 TTAGAGACAGGGTCTCACTCTGG + Intergenic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129796749 15:78383481-78383503 ATAGAGACAAGGTCTCTCTATGG + Intergenic
1129972184 15:79788482-79788504 ATAGAGACAGGGTCTCACCGTGG - Intergenic
1133005451 16:2878770-2878792 ATAGAGACAGGGTTTCACCATGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1134448622 16:14349338-14349360 ATAGAGAGAGAATCTCATTCAGG - Intergenic
1134541251 16:15067773-15067795 TAAGAGACAGGGTCTCATTCTGG + Intronic
1134584829 16:15401128-15401150 TTCGAGACAGGGTCTCATTCTGG + Intronic
1135025958 16:18999181-18999203 GTAGAGACAGGGTCTCACTATGG + Intronic
1135436709 16:22432328-22432350 TAAGAGACAGGGTCTCATTCTGG + Intronic
1135665188 16:24329635-24329657 ATGAAGAAAGTGTCACATTAGGG + Intronic
1135764760 16:25167941-25167963 ATAGAGACAGGGTTTCATGTTGG + Intronic
1136263550 16:29099589-29099611 TAAGAGACAGGGTCTCATTCTGG - Intergenic
1136341241 16:29645015-29645037 AGAGAGACAGGGTCTCCCTATGG + Intergenic
1136462466 16:30420187-30420209 GTAGAGACAGGGTCTCGCTATGG + Intronic
1137805878 16:51304949-51304971 ATAGAGATGGTGTCTCACTATGG + Intergenic
1138244534 16:55457541-55457563 AAACAGAGAGGGTCTCATGAAGG + Intronic
1139586234 16:67905671-67905693 AGAGAGAAAGGGTTTCATGTTGG - Intronic
1139848743 16:69938195-69938217 ATAGAGACAGGGTCTTGCTATGG + Intronic
1140448534 16:75051390-75051412 GTAGAGAAAGGGTTTCCTCATGG + Intronic
1141618598 16:85224270-85224292 GTAGAGATAGGGTTTCATAAGGG - Intergenic
1142330651 16:89450678-89450700 AGAGAGACAGGGTCTCACTATGG + Intronic
1143066277 17:4250816-4250838 GTAGAGACAGGGTCTCAGTATGG + Intronic
1143604119 17:7971392-7971414 TTAGAGACAGGGTCTCACTGTGG + Intergenic
1143859034 17:9874473-9874495 AAAGAAAAAGGGTCTCACTCTGG - Intronic
1144023558 17:11258192-11258214 AAAGAGAAAGGGCATGATTAGGG + Intronic
1144048219 17:11472380-11472402 GTAGAGACAGGGTCTCACTATGG + Intronic
1144308280 17:13989192-13989214 ATACAGAAAGGTTCTCAAAAGGG + Intergenic
1146031977 17:29373965-29373987 GTAGAGACAGGGTTTCACTATGG + Intergenic
1146067843 17:29651141-29651163 ACTGAGAAAGTGTCTGATTATGG - Intronic
1146089705 17:29864118-29864140 ATAGAGATGGGGTTTCATCATGG - Intronic
1146110897 17:30088302-30088324 TAAGAGACAGGGTCTCTTTATGG + Intronic
1146509240 17:33431418-33431440 GTAGAGACAGGGTTTCATCATGG - Intronic
1146714194 17:35070351-35070373 GTAGAGATGGGGTCTCAATATGG + Intronic
1146783899 17:35701798-35701820 ATAGAGACAAGGTCTCACTTAGG + Intronic
1147878505 17:43638719-43638741 ATAGGCAAAGGGTCTCAGTTTGG + Intergenic
1147983836 17:44292744-44292766 GTAGAGACAAGGTCTCACTATGG - Intergenic
1148005683 17:44427257-44427279 GTAGAGACAGGGTTTCATCATGG + Intronic
1148604586 17:48919397-48919419 ATATAAACAGGGTCTCACTATGG - Intronic
1148606020 17:48929385-48929407 CTAAAGGAAGGGTCTCAGTATGG + Exonic
1148625048 17:49062842-49062864 ATAGAGACAAGGTCTCACTATGG - Intergenic
1148952584 17:51326871-51326893 ATAGAGATGGGGTCTCCTTCTGG + Intergenic
1149258343 17:54852274-54852296 ATTGAGACAGGGTCTCACTCTGG + Intergenic
1149533053 17:57411019-57411041 TTAGAGACAGGGTCTCACTATGG + Intronic
1149716557 17:58796225-58796247 GTAGAGACAGGGTCTCATTATGG + Intronic
1149905037 17:60518535-60518557 AGAGAGACAGGGTCTCACTCTGG + Intronic
1150136810 17:62700499-62700521 GTAGAGACAGGGTCTCGCTATGG + Intergenic
1150988009 17:70221157-70221179 ATAATGAAAGGGACTCATTGGGG - Intergenic
1151363848 17:73604660-73604682 AGAGAGAAAGGATAGCATTAGGG + Intronic
1151536472 17:74741723-74741745 ATAGAGAAAAGGTCTCACCCTGG + Intronic
1151659498 17:75511319-75511341 AAAGAGATAGGGTCTCACTTTGG - Intronic
1151775357 17:76197584-76197606 TTTGAGATAGGGTCTCAATATGG + Intronic
1151779628 17:76235989-76236011 TTAGAGACAGGGTCTCACTCTGG - Intronic
1151895737 17:76979636-76979658 ATAGAAACAGGGTCTCACTATGG + Intergenic
1154065882 18:11106595-11106617 GTAAAGAAGAGGTCTCATTATGG + Intronic
1156942984 18:42793498-42793520 TTAAGGAAAAGGTCTCATTAAGG + Intronic
1158133549 18:54180924-54180946 TTTGAGACAGGGTCTCATTCTGG + Intronic
1159019756 18:63133472-63133494 GTAGAGAAAGGGTTTCATGTTGG + Intronic
1159692872 18:71512612-71512634 GTAGAGATGGGGTCTCACTATGG - Intergenic
1161815959 19:6500315-6500337 GTAGAGACAGGGTCTCACCATGG + Intronic
1162754789 19:12851442-12851464 GTAGAGACAGGGTCTCGCTATGG + Intronic
1162979738 19:14230866-14230888 GTAGAGACAGGGTTTCACTATGG + Intergenic
1163213816 19:15861797-15861819 GTAGAGACAGGGTCTCACCATGG + Intergenic
1163413333 19:17170625-17170647 GTAGAGATGGGGTCTCACTATGG - Intronic
1163800152 19:19359748-19359770 GTAGAGACAGGGTTTCACTATGG - Intergenic
1163838334 19:19590187-19590209 ATAGAGACGGGGTATCTTTAGGG - Intronic
1164147332 19:22519977-22519999 ATAGAGAAAGAATCTCTGTAGGG - Intronic
1164207047 19:23067786-23067808 GTAGAGACAAGGTCTCAGTATGG - Intergenic
1165024537 19:32950036-32950058 ATACAGACAGGATCTCACTATGG + Intronic
1166159106 19:40938409-40938431 GTAGAGACAGGTTCTCCTTATGG + Intergenic
1167160328 19:47763397-47763419 TTTGAGAAAGGGTCTCATTCTGG + Intergenic
1167889166 19:52526376-52526398 ATAGAGACGGGGTATCACTACGG - Intergenic
1168051139 19:53830840-53830862 AGAGAGAAAGGGATTTATTATGG + Intergenic
1168188778 19:54722634-54722656 ATAGAGACGGGGTCTCACTATGG - Intergenic
1168286574 19:55337852-55337874 GTAGAGACAGGGTCTCTCTAGGG - Intergenic
1168490839 19:56807605-56807627 GTAGAGACAGGATCTCAATATGG - Intronic
1168564671 19:57413059-57413081 ATAGAGACAGGGTTTCACCATGG + Intronic
1168600022 19:57709877-57709899 GTAGAGACAGGGTTTCACTATGG + Intronic
926100854 2:10116640-10116662 ATAGAGACAGGGTCTCACTATGG - Intergenic
926143615 2:10383657-10383679 TTTGAGAAAGGGTCTCACTCAGG - Intronic
927970132 2:27300490-27300512 ATAGAGACAGGGTCTCAGGCAGG + Intronic
930104246 2:47627760-47627782 GTAGAGATGGGGTCTCACTATGG + Intergenic
930155280 2:48100712-48100734 ATAGAAACAGGGTCTCAGAAAGG - Intergenic
930646323 2:53912647-53912669 GTAGAGACAGGGTCTCGCTATGG + Intronic
931036921 2:58254268-58254290 GTAGAGACAGGGTCTCCCTATGG + Intergenic
931529284 2:63195479-63195501 TTTGAGACAGGGTCTCATTCTGG + Intronic
932134033 2:69212988-69213010 GTAGAGAGAGGGTCTCACTATGG + Intronic
932511277 2:72294467-72294489 GTAGAGACGGGGTCTCATTATGG + Intronic
932726458 2:74183768-74183790 GTAGAGACAGGGTCTCACTATGG + Intergenic
933518135 2:83331975-83331997 GTAGAGACAGGGTTTCATCATGG + Intergenic
934491475 2:94764224-94764246 GCATAGAGAGGGTCTCATTAGGG - Intergenic
934547224 2:95227799-95227821 GTAGAGATAGGGTCTCGCTATGG + Intronic
936444599 2:112585876-112585898 TTAGAGACAGGGTCTCACTGTGG - Intronic
937373906 2:121322170-121322192 TTTGAGACAGGGTCTCATTCTGG - Intergenic
937938686 2:127267922-127267944 AAAGAGACTGGGTCTCACTATGG + Intronic
938472291 2:131575871-131575893 ATAGAGACAGGGTTTCACCATGG + Intergenic
938679921 2:133679008-133679030 AGTGAGAAAGGGTCTCAGCATGG + Intergenic
938863462 2:135394040-135394062 GTAGAGACAGGGTTTCACTATGG + Intronic
939051821 2:137316576-137316598 ATAGAGACAGGGTTTCACTGTGG - Intronic
939208523 2:139140541-139140563 ATAGCGAAAGGTTCTCATCTGGG - Intergenic
939933772 2:148263234-148263256 ATAGAGAAAAGGACTAATCAGGG + Intronic
941668646 2:168266976-168266998 GTAGAGACAGGGTCTCACCATGG + Intergenic
941975386 2:171398865-171398887 ATAGATAAAGAGTTTCATTTAGG + Intronic
943659623 2:190544902-190544924 GTAGAGACAGTGTCTCACTATGG - Intergenic
944782818 2:203037771-203037793 GTAGAGACAGGGTCTTGTTACGG - Intronic
944803278 2:203257127-203257149 GTAGAGACAGGGTCTCATCACGG - Intronic
945135734 2:206625840-206625862 ATTGAGACAGGGTCTCAATCTGG + Intergenic
945391314 2:209268377-209268399 ATAGAGAATGTGTCTGCTTATGG - Intergenic
946042064 2:216791071-216791093 ATAGAGACAGGGTTTCACCATGG - Intergenic
946218604 2:218206419-218206441 TTTGAGACAGGGTCTCATTCTGG + Intergenic
947337346 2:229101099-229101121 ATGGAGAAAGGATCTCACCACGG + Intronic
947426504 2:229987802-229987824 GTAGAGACAGGGTCTCACTATGG + Intronic
947693872 2:232166050-232166072 GTAGAGACAGGGTCTCACTAAGG - Intronic
947781920 2:232774848-232774870 ATACAGAAAGGCTCTAAGTAAGG - Intronic
948028179 2:234794988-234795010 GTAGAGACAGGGTCTCACTATGG + Intergenic
1169008086 20:2225923-2225945 TTAAAGACAGGGTCTCACTATGG + Intergenic
1169372954 20:5042829-5042851 ATTGAGACAGGGTCTCACTCTGG + Intergenic
1170025234 20:11882042-11882064 GTAGAGACAGGGTTTCATCATGG - Intergenic
1170117965 20:12881505-12881527 AGAGAGAATGGGTCACATTGAGG - Intergenic
1170307050 20:14950156-14950178 GAAGAGACAGGGTCTGATTAAGG + Intronic
1170372973 20:15669651-15669673 GGAGAGAACGGGTATCATTAGGG + Intronic
1170750721 20:19142317-19142339 TTAGAGGAAGGGTCCCATGAAGG - Intergenic
1170795452 20:19542984-19543006 TTAAAGAAAGGGTTACATTAAGG + Intronic
1170943480 20:20868538-20868560 ATAGCAAAAGGGTTTTATTATGG - Intergenic
1171755640 20:29105690-29105712 ATAGAGACAGGGTCTCAGGCTGG - Intergenic
1172157708 20:32840506-32840528 ATAGAGATAGGGTCTCACTATGG + Intronic
1172260001 20:33555881-33555903 TTAGAGACAGGGTCTCATTCTGG + Intronic
1172675679 20:36669680-36669702 ATAAAGACAGGGTCCCACTATGG + Intronic
1173033435 20:39383753-39383775 AAAGAGAATGGGTCTGATTAGGG + Intergenic
1173641153 20:44602919-44602941 AGAGAGAAGGGGACTCATCAAGG + Intronic
1173975629 20:47184433-47184455 TTAGAGATAGGGTCTCACTCTGG + Intronic
1174602187 20:51733855-51733877 GTAGAGTGAGGGTCTCACTATGG + Intronic
1174690016 20:52494809-52494831 ATAGAAAATAGGTTTCATTATGG - Intergenic
1176156455 20:63624231-63624253 GTAGAGACAGGGTTTCATCATGG - Intronic
1176453294 21:6883446-6883468 ATAAAGAAAGGGTCTAGTGAGGG - Intergenic
1176831468 21:13748494-13748516 ATAAAGAAAGGGTCTAGTGAGGG - Intergenic
1178232539 21:30803226-30803248 GTAGAGATAGGGTTTCATTGTGG + Intergenic
1179019688 21:37627263-37627285 ATTGAAAAAGGGTCACATTTCGG - Intronic
1179626325 21:42651509-42651531 TTAGAGATGGGGTCTCACTATGG + Intergenic
1179772817 21:43636024-43636046 GTAGAGATGGGGTCTCACTATGG - Intronic
1180846753 22:18987128-18987150 ATAGAGATGGGGTCTCACTATGG - Intergenic
1181139201 22:20791738-20791760 TTTGAGACAGGGTCTCATTCTGG - Intronic
1181476841 22:23173647-23173669 TTAGAGATGGGGTCTCACTATGG + Intergenic
1182187277 22:28418629-28418651 AGAGAGAAAGAGTCTCTTAAAGG + Intronic
1183850283 22:40580214-40580236 TTTGAGACAGGGTCTCATTCTGG + Intronic
1184061085 22:42081953-42081975 ATAGAGAAAGGGGATCACAATGG - Exonic
1184733649 22:46385279-46385301 ATAGAGACAGGGTCTCACTATGG + Intronic
949482736 3:4509605-4509627 GTAGAGACAAGGTCTCACTATGG - Intronic
949767568 3:7543937-7543959 ATAGTGAAAAGCTCTGATTAAGG - Intronic
950453926 3:13081450-13081472 ATAGAGATAGGGTCTCCCTTTGG + Intergenic
950746175 3:15091191-15091213 TTTGAGACAGGGTCTCATTCTGG - Intronic
950946018 3:16947139-16947161 TTAGAGACAGGGTCTCACTCAGG + Intronic
953248163 3:41215691-41215713 GTAGAGGAAGGTTATCATTATGG + Intronic
953593261 3:44281159-44281181 ACAGAGAAAGAATCTCATCAGGG - Intronic
953804706 3:46058426-46058448 ACAGAGACAGGGTTTCTTTAAGG - Intergenic
954026356 3:47786345-47786367 GTAGAGACAGGGTTTCACTATGG - Intergenic
954063410 3:48088183-48088205 AGTGCGAAAGGGTCACATTAGGG - Intronic
954160772 3:48720177-48720199 GTAGAGACAGGGTTTCATCATGG - Intronic
954552655 3:51494997-51495019 ATAGAGACAAGGTCTCACTAAGG - Intronic
955262636 3:57409103-57409125 TTATAGAAAGGGACCCATTAGGG + Intronic
956261540 3:67348813-67348835 CTGGAGAAATGATCTCATTATGG + Intergenic
956571064 3:70695613-70695635 AAAGAGAAAAGCTCTCCTTAAGG - Intergenic
956803312 3:72783495-72783517 GTTGAGACACGGTCTCATTATGG + Intronic
957967350 3:87339499-87339521 GTAGAGATAGGGTTTCATCATGG - Intergenic
958649510 3:96920272-96920294 ATAGAAAAAGGGACTATTTATGG + Intronic
958780085 3:98530445-98530467 TTTGAGACAGGGTCTCACTAGGG - Intronic
959103269 3:102038325-102038347 CTAGAGAGAGTGTCTCACTATGG + Intergenic
960275001 3:115718975-115718997 TTAGAGAAATGGGGTCATTAAGG - Intronic
961225693 3:125243707-125243729 ATAGAGACAGGGTCTTGTTACGG + Intronic
961266728 3:125649010-125649032 ATTCAGAAAGGGTTTCCTTATGG - Intergenic
962518547 3:136176496-136176518 TTTGAGAGAGGGTCTCATTCTGG - Intronic
963298002 3:143568158-143568180 ATAAATAGAGGGTCTCAATAGGG + Intronic
963968870 3:151406816-151406838 TTTGAGATAGGGTCTCATTCTGG + Intronic
964111686 3:153094727-153094749 GTAAAGACAGGGTCTCATTGTGG - Intergenic
964361887 3:155907396-155907418 GTAGAGATGGGGTCTCACTATGG - Intronic
964465343 3:156985648-156985670 ATAGAGACAGGGTTTCACCATGG - Intronic
966343450 3:178951344-178951366 ATAGAGAAAGAGATTTATTATGG + Intergenic
966730049 3:183143294-183143316 ATAGAGATGGGATCTCACTATGG + Intronic
966802460 3:183776766-183776788 ATAGAGACAGGGTTTCACCATGG - Intronic
966814079 3:183874886-183874908 ATAGAGACAGGATCTCACTATGG - Intronic
966909011 3:184547752-184547774 GTAGAGACAGGGTTTCATCATGG - Intronic
967674358 3:192278362-192278384 CTAGAGAAAGGGCTTCAATAGGG + Intronic
967700574 3:192587630-192587652 ACAGTGATAGGGTCTCACTATGG - Intronic
968034390 3:195534130-195534152 GTAGAGATAGTGTCTCACTATGG - Intronic
968350420 3:198047984-198048006 GTTTAGAGAGGGTCTCATTAGGG - Intergenic
968433666 4:574685-574707 ATACAGAAATGGTCACATCAGGG + Intergenic
969224305 4:5784789-5784811 GTAGAGAAGGGGTTTCATCATGG + Intronic
969332677 4:6488498-6488520 GTAGAGACAGGTTCTCACTATGG - Intronic
969966013 4:10996224-10996246 CTAGAAAGATGGTCTCATTATGG - Intergenic
970918888 4:21369577-21369599 TTAGAGACAGGGTCTCACTCTGG - Intronic
971326757 4:25650738-25650760 GTAGAGACAGGGTTTCACTATGG - Intergenic
972471573 4:39410802-39410824 ATAGAGAAAAGGTTTCATAGTGG + Intronic
972646634 4:40974035-40974057 GTAGAGACGGGGTTTCATTACGG + Intronic
972673648 4:41238243-41238265 AGAGATAGAGGGCCTCATTATGG - Intergenic
973338281 4:48978075-48978097 TTAGAGACAGGGTCTCACTCTGG - Intergenic
974877295 4:67715515-67715537 TTAGAGACAGGGTCTCACTCTGG + Intergenic
975576540 4:75868677-75868699 TTTGAGACAGGGTCTCATTCTGG - Intronic
976054166 4:81043770-81043792 GTAGAGACAGGGTTTCACTATGG + Intronic
976491717 4:85678183-85678205 GTAGAGATGGGGTCTCACTATGG - Intronic
976742482 4:88370328-88370350 ACAGAGAAATGGAGTCATTAAGG + Intergenic
977262296 4:94812514-94812536 AAAGCAAAAGGGTCTCAGTATGG - Intronic
977708924 4:100102153-100102175 ATAGAGATAAGGTCTCACTAAGG + Intergenic
979079947 4:116324257-116324279 GAAGAGAAAGGGTGTCATTTTGG - Intergenic
980978143 4:139630863-139630885 ACAGAGAAAGGGTTTAATAATGG + Intergenic
981335515 4:143564889-143564911 GTAGAGACAGGGTTTCATCATGG + Intergenic
981757173 4:148153359-148153381 GTAGAGACAGGGTTTCATGATGG + Intronic
981894626 4:149783731-149783753 AGAGAGAGAGGCTCTCATTGTGG + Intergenic
982732200 4:158968210-158968232 ATAGAGACAGGGTTTCACCATGG + Intronic
983143747 4:164187295-164187317 ATAGAGAAAGGGTCTCCCTCTGG + Intronic
983549437 4:169000989-169001011 ATAGAGACAGGGTCTCAACAGGG + Intronic
983616377 4:169710028-169710050 TTAGAGACAGGGTCTCACTCTGG - Intronic
983873040 4:172843873-172843895 GTAGAGACATGGTCTCACTATGG - Intronic
984598427 4:181698027-181698049 GTAGAGACAGGGTTTCACTATGG - Intergenic
984655574 4:182314113-182314135 GTAGAGACAGGGTTTCATCATGG - Intronic
984890177 4:184484852-184484874 ATAGAGACAGGGTTTCACCATGG + Intergenic
985511489 5:316483-316505 ATAGAGAAAAGGTCAGATTGTGG + Intronic
985689919 5:1301936-1301958 GTAGAGACAGGGTTTCATCATGG + Intergenic
985750905 5:1673943-1673965 GTAGAGACAGGGTCTCACTAAGG + Intergenic
986206126 5:5627085-5627107 ATAGATAAAGGGAGTCAGTATGG - Intergenic
986211927 5:5682101-5682123 GTAGAGATGGGGTCTCACTATGG - Intergenic
986287206 5:6368333-6368355 ATAGAGACAGGGACTCACTCTGG - Intergenic
987269189 5:16287738-16287760 ATAAAGAAAGTGTCTCAAGAAGG + Intergenic
987523926 5:19023539-19023561 ATAGAGGATGGGTATAATTAGGG - Intergenic
987883481 5:23781187-23781209 GTAGAGAAGGGGTCTCATTTTGG + Intergenic
988560355 5:32275294-32275316 ATGAAGACAGGGCCTCATTAGGG + Intronic
988976744 5:36523463-36523485 TTAAAGAAAGGGACTCATAAAGG + Intergenic
989302913 5:39915612-39915634 GTAGAGACAGGGTCTCACTATGG - Intergenic
989603225 5:43219422-43219444 GTAGAGACAGTGTCTCACTATGG + Intronic
990601355 5:57361622-57361644 ATGGAGAAAGGGACTCATAGTGG + Intergenic
992327857 5:75681295-75681317 AAAGTGAAAGGGTATCATTAGGG - Intronic
992401907 5:76419309-76419331 GTTGAGACAGGGTCTCACTAGGG + Intronic
992698738 5:79317864-79317886 GTAGAGACAGGGTCTCCTTATGG + Intronic
993116912 5:83730077-83730099 GTAGAGAAGGGGTTTCACTACGG - Intergenic
993327069 5:86553589-86553611 TTAGAGACAGGGTCTCACTCTGG - Intergenic
993846815 5:92954123-92954145 ATAAAGAAAGGGGCTCAAGATGG - Intergenic
996205765 5:120733331-120733353 AAAGAGATGGGGTCTCACTATGG + Intergenic
996741404 5:126802625-126802647 ATAGAGACAGGGCTTCATTTTGG + Intronic
997635630 5:135402756-135402778 ATAGAAGAAGGGACTCATGAAGG + Intergenic
997927374 5:138043178-138043200 ATAGAGACAGGGTCTCACTATGG - Intronic
999422375 5:151456190-151456212 GTAGAGGCAGGGTCTCACTATGG + Intronic
999565223 5:152852198-152852220 TTAAAGACAGGGTCTTATTATGG + Intergenic
999775447 5:154809294-154809316 ATAGAAACAGGGTCTTACTATGG - Intronic
1000018844 5:157301743-157301765 AAAGAGACGGGGTCTCATTATGG - Intronic
1000051772 5:157569439-157569461 GTAGAGATAGGATCTCAGTATGG + Intronic
1000484647 5:161825860-161825882 ATACAGATAGTGTCTCATTCTGG - Intergenic
1001456817 5:171868664-171868686 AGGGAGAACGGGTCTCATTCTGG + Exonic
1001739375 5:174038439-174038461 GTAGAGATGGGGTCTCACTATGG + Intergenic
1002307577 5:178292892-178292914 GTAGAGAAAGTGTCTCAGGAGGG + Intronic
1002383965 5:178851798-178851820 GTAGAGAAGGGGTTTCATTATGG - Intergenic
1002615889 5:180455813-180455835 GTAGAGACAGGGTCTCACTGAGG + Intergenic
1002627330 5:180539259-180539281 AAAGAGATAGGGTCTCACTCTGG - Intronic
1003034793 6:2633247-2633269 TTAGAGAAAGGGGCAAATTATGG - Intronic
1003082299 6:3031317-3031339 GTAGAGATAGGGTCTCACTATGG - Intergenic
1003740322 6:8929734-8929756 GTAGAGATGGGGTCTCACTATGG + Intergenic
1003867787 6:10379500-10379522 ATAGAGAAATGATCCCATTAAGG + Intergenic
1004341279 6:14809830-14809852 GTAGAGATAGGGTCTCACCATGG + Intergenic
1005893284 6:30157501-30157523 TTTGAGAAAGGGTCTCACTCTGG + Intronic
1008033519 6:46722478-46722500 AGAGAGAAGGGGTGGCATTAAGG + Intronic
1008347649 6:50448453-50448475 GTAGAGAAGGAGTCTCACTATGG + Intergenic
1008631215 6:53364139-53364161 ATGGCGAAAGAGTGTCATTATGG - Intergenic
1008713446 6:54257990-54258012 GTAAAGAAATGTTCTCATTATGG + Intronic
1009636360 6:66269673-66269695 TTTGAGACAGGGTCTCATTCTGG - Intergenic
1009714015 6:67363896-67363918 ATAGAGACAGGGTTTCACTATGG + Intergenic
1010945414 6:81968802-81968824 ATAGAGAAAAGCTTTAATTAAGG - Intergenic
1011567852 6:88697674-88697696 GTAGAGACAGTGTCTCATCATGG - Intronic
1011597241 6:89027641-89027663 GTAGAGACAGGGTCTCACTATGG + Intergenic
1012455317 6:99396799-99396821 ATAGAGACAGGGTTTCATGTTGG - Intergenic
1013144063 6:107369819-107369841 GTAGAGACAGAGTCTCACTATGG - Intronic
1013221487 6:108081448-108081470 AGAGAGAAAGAGTATCAATAGGG - Intronic
1013272184 6:108555646-108555668 GCAGAGAAAGGGTCTAATGAGGG + Intergenic
1013892915 6:115046709-115046731 ATAGAGAAATGATTTCAATAGGG - Intergenic
1014069023 6:117159956-117159978 ATAGAGACAAGGTCTCATTATGG - Intergenic
1014601575 6:123419392-123419414 TTAGAGACAGGGTCTCACTCTGG + Intronic
1014890935 6:126845426-126845448 CAAGAGAAAGGGTTACATTAAGG + Intergenic
1015430707 6:133127837-133127859 AGACAGAAAGGGTCTCTCTAAGG + Intergenic
1016059991 6:139620206-139620228 ATAGAGACAGGGTTTCACCATGG - Intergenic
1017377790 6:153790841-153790863 ATAGAGAATAAGTCTCATGATGG - Intergenic
1017687206 6:156925488-156925510 TTAGAGAAAGGGTCTCACTGTGG - Intronic
1018033392 6:159862167-159862189 AAAGAGAAAAGGACTCATCATGG - Intergenic
1018074969 6:160203926-160203948 ATAGAGAAATGGTCTCTTCTGGG + Intronic
1019678763 7:2332568-2332590 GTAGAGATGGGGTCTCAGTATGG - Intronic
1019735409 7:2647788-2647810 CTTGAGAAAGGCTCCCATTAGGG - Intronic
1020863890 7:13531629-13531651 ATAGAGAAAGGGGCTTGTAAAGG - Intergenic
1020886802 7:13828425-13828447 GTAGAGACAGGGTTTCATCATGG + Intergenic
1020991891 7:15208239-15208261 ATAGAGAGAGGGTTGCAATAAGG + Intronic
1021300484 7:18966514-18966536 GTAGAGACAGGGTTTCATCATGG - Intronic
1021458008 7:20850541-20850563 CTAGACATGGGGTCTCATTATGG - Intergenic
1021727683 7:23565228-23565250 ATAGAGATGGGGTCTCATTATGG + Intergenic
1022380863 7:29858779-29858801 ATATACAAAGAGTGTCATTAAGG + Intronic
1022538685 7:31115031-31115053 ATGGAAAAAGTGTCTCAATAGGG - Intergenic
1023101218 7:36720630-36720652 TTAGAGAAAGGGTATTATCAAGG + Intronic
1023283568 7:38595435-38595457 ATAGATAAAGGGTATCACAATGG + Intronic
1023316612 7:38944280-38944302 GTAGAGACAGGGTCTCACCATGG - Intergenic
1023818877 7:43969465-43969487 GTAGAGACAGGGTCTCACCATGG + Intergenic
1025962877 7:66239169-66239191 AAAGAGACAGGGTCTCAGTGTGG + Intronic
1025979965 7:66397326-66397348 GTAGAGATGGGGTCTCACTATGG + Intronic
1026008821 7:66620859-66620881 GTAGAGACAGGGTCCCACTATGG - Intergenic
1026689713 7:72541049-72541071 GTAGAGATGGGGTCTCACTATGG - Intergenic
1027131731 7:75596053-75596075 ATAGAGATGGGGTCTCACTGTGG - Intronic
1027268535 7:76507154-76507176 ACAGAGAAAGGGGCTCACCAAGG - Intergenic
1028240647 7:88415818-88415840 ATACATGAAGGGTCTCAGTAAGG - Intergenic
1029384227 7:100233158-100233180 GTAGAGACGGGGTCTCACTATGG + Intronic
1029522052 7:101069109-101069131 GTAGAGACAGGGTTTCATCATGG + Intergenic
1029613235 7:101639033-101639055 ATAGAGACAGGGTTTCACCATGG + Intergenic
1029700498 7:102243606-102243628 GTAGAGACAGGGTCTCACTGAGG - Intronic
1029743925 7:102506428-102506450 GTAGAGACAGGGTCTCACCATGG + Intronic
1029761914 7:102605591-102605613 GTAGAGACAGGGTCTCACCATGG + Intronic
1029847867 7:103431507-103431529 ATAGAGAAAGGGTCTCATTATGG + Intronic
1030528470 7:110681853-110681875 AGAGAGACAGGTTCTCATTGGGG + Intronic
1031415533 7:121491733-121491755 GTAGAGACAGGATCTCACTATGG + Intergenic
1031832611 7:126646025-126646047 AGAGAGAAAGTGTTACATTAAGG + Intronic
1033455216 7:141496885-141496907 ATAAAGAAAGCATCTCAGTATGG + Intergenic
1033704231 7:143869183-143869205 ATAGAGATAGCGTTTCACTATGG + Intronic
1034118064 7:148601930-148601952 GTAGAGACAGGGTCTCACTATGG + Intronic
1034539995 7:151751706-151751728 GTAGAGACAGGGTCTCGCTACGG + Intronic
1035177665 7:157063604-157063626 TTAGAGATGGGGTCTCACTATGG - Intergenic
1035908004 8:3535135-3535157 ATAGAGACAGGGTCTCACCATGG + Intronic
1036721385 8:11178851-11178873 TTAGAGACAGGGTCTCACTCAGG + Intronic
1037437276 8:18876108-18876130 AGAGAGACAGGGTCTCTCTATGG + Intronic
1038028371 8:23613334-23613356 ATAGACAAATGGTCTCATTGGGG + Intergenic
1038169909 8:25121530-25121552 ATCGTGAAAGGGTCTCTGTAGGG + Intergenic
1038187847 8:25291767-25291789 GTAGAGACAGGGTCTCACCATGG - Intronic
1038264322 8:26025987-26026009 GTAGAGACAGGGTCTCACTCTGG - Intronic
1039196389 8:35036219-35036241 CTGGAGAAAGAGTCACATTAAGG + Intergenic
1039361488 8:36882072-36882094 AGAGAGAATGGGTCTCTTTTTGG - Intronic
1039416305 8:37397178-37397200 ATAGTCAAAGGGGCTCATAAAGG + Intergenic
1039537248 8:38328016-38328038 GTAGAGACAGGGTCTCACTATGG - Intronic
1039851575 8:41370873-41370895 TTTGAGACAGGGTCTCACTATGG - Intergenic
1039993285 8:42508293-42508315 ATGGAGATAGGGTCTCAATATGG - Intronic
1040038578 8:42895283-42895305 TTTGAGAAAGGGTCTCGTTCTGG - Intronic
1040558039 8:48498499-48498521 GTAGAGACAGGGTTTCATCATGG + Intergenic
1041336431 8:56789577-56789599 ATAGATAAGGGGCCTCATTGTGG + Intergenic
1041669928 8:60481701-60481723 ATAGAGATAAGGTCTCACTATGG + Intergenic
1042497686 8:69473021-69473043 TTAGAGACTGGGTCTCACTATGG + Intronic
1043109995 8:76169070-76169092 GTAGAGACAGGGTCTCATTGTGG + Intergenic
1043286777 8:78541984-78542006 GTAGAGATAGGGTCTTACTATGG - Intronic
1043388897 8:79771899-79771921 ACAGAGACAGGGCCTCATGAAGG - Intergenic
1044972652 8:97634777-97634799 TTAGAGACAGGGTCTCACTCTGG - Intergenic
1045139598 8:99266233-99266255 GTAGAGACAGGGTCTCACTATGG - Intronic
1045617297 8:103932852-103932874 ATAGAGATAGGGTCACATTACGG - Intronic
1046768876 8:118098905-118098927 AGAGAGACAGGGTCTCCTTTCGG - Intronic
1047236801 8:123048753-123048775 AGAGTGACAGGGTCTCATTTAGG - Intronic
1047335528 8:123932290-123932312 GTAGAGACAGGGTTTCATTATGG + Intronic
1048110059 8:131458122-131458144 AGAGAGAAAGTGTATCTTTAAGG - Intergenic
1048983756 8:139718363-139718385 TTAGAGATGGGGTCTCACTACGG + Intergenic
1049921028 9:364447-364469 GTAGAGACAGGGTCTCACCATGG - Intronic
1050201265 9:3148427-3148449 ACAGAGCAAGGGTCTCATACAGG - Intergenic
1050525426 9:6542421-6542443 GTAGAGATGGGGTCTCACTATGG + Intronic
1050602362 9:7265838-7265860 ATGGAGACAGAGTCTCACTATGG - Intergenic
1050988794 9:12119431-12119453 GTAGAGATAGGGTTTCACTATGG - Intergenic
1051269605 9:15342674-15342696 ATAGAGACAGGGTCTCACTATGG - Intergenic
1051383949 9:16486741-16486763 GTAGAGACAGGGTCTCACTCTGG + Intronic
1052306193 9:27012407-27012429 GTAAAGACAGGGTCTCGTTATGG + Intronic
1052837182 9:33260011-33260033 TTTGAGATAGGGTCTCACTACGG + Intronic
1052880310 9:33597806-33597828 ACTTAGAGAGGGTCTCATTAGGG + Intergenic
1052936815 9:34100045-34100067 TTAGAGACAGGGTCTCACTTTGG + Intronic
1053207769 9:36201926-36201948 GTAGAGATAGGGTCTCACTATGG - Intronic
1053501687 9:38601805-38601827 ATAGAGTCAGGGTTTCACTATGG - Intergenic
1057890479 9:98866354-98866376 AAAGAGAATGGGTCCCATTTAGG + Intergenic
1058336609 9:103837172-103837194 ATAGAGGAAGGGTCACTTTAGGG + Intergenic
1058959878 9:109982804-109982826 GTAGAGATGGGGTCTCACTATGG + Intronic
1059215741 9:112560383-112560405 ATAGAGAAAGGGTCTCCAGCTGG + Intronic
1059314753 9:113414573-113414595 ATAGGGAGAGGGGCTCAGTATGG - Intronic
1059951767 9:119471534-119471556 ATAGAGACAAGGTTTCATCATGG + Intergenic
1060111123 9:120907051-120907073 GTAGAGACAGGGTTTCGTTATGG + Intronic
1061932337 9:133839632-133839654 GTAGAGACAGGGTTTCACTATGG + Intronic
1202802849 9_KI270720v1_random:17466-17488 ATAGAGACAGGGTCTCAGGCTGG + Intergenic
1203515887 Un_GL000213v1:1069-1091 ATAAAGAAAGGGTCTAGTGAGGG + Intergenic
1203447635 Un_GL000219v1:74681-74703 ATAGAGACAGGGTCTCAGGCTGG + Intergenic
1185650631 X:1645584-1645606 GTAGAGACAGGGTTTCATTGTGG + Intergenic
1185898163 X:3875373-3875395 ATAGAGAGAGGATCTCACCATGG + Intergenic
1185928200 X:4170821-4170843 GTAGAGATAGGGTCTCACTATGG - Intergenic
1186809627 X:13175417-13175439 CTTGAGACAGGGTCTCACTATGG - Intergenic
1187450241 X:19389565-19389587 ATAAGGAAGGGGTCTCATTTTGG - Intronic
1187515735 X:19968343-19968365 ATAGAGATAGGGTCTCACTCAGG + Intronic
1187949065 X:24454225-24454247 ATAGAGACAGGGTTTCATGTTGG + Intergenic
1188232158 X:27677795-27677817 TTAGAGTCAGTGTCTCATTAAGG - Intronic
1189458765 X:41219796-41219818 GTAGAGATAGGGTCTCCCTATGG - Intronic
1189563284 X:42213259-42213281 ATAGAGAAAGGGGCCCAAGAAGG + Intergenic
1189884205 X:45523682-45523704 ATAGAGGAAGGGACCCATGAAGG + Intergenic
1191777328 X:64829669-64829691 AAAGGGAAAGGGTGTAATTAAGG + Intergenic
1192780235 X:74286635-74286657 GTAGAGAAGGGGTCTCGTTATGG - Intergenic
1192802817 X:74483692-74483714 ATAGAGCAGGGGTGTCATTCTGG - Intronic
1192865690 X:75129650-75129672 ATAGTGAAAGGGTTTCCTTGTGG - Intronic
1193391509 X:80934753-80934775 ATAGAGATGGGTTCTCACTATGG + Intergenic
1194653690 X:96546046-96546068 ATGGAGAAAGGGACCCATGAAGG + Intergenic
1195401975 X:104470558-104470580 ACAGTGAAAGGGTCTCAGCACGG - Intergenic
1198464865 X:136895959-136895981 GTAGAGACAGGGTCTCGCTATGG + Intergenic
1201583410 Y:15534818-15534840 AGAGAGACAGGGTCTCCTTCTGG - Intergenic
1201745341 Y:17366210-17366232 ATAGAGAGGGAGTCTCATTATGG + Intergenic