ID: 1029848730

View in Genome Browser
Species Human (GRCh38)
Location 7:103440971-103440993
Sequence CACTGTGTATGGAAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 184}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029848721_1029848730 25 Left 1029848721 7:103440923-103440945 CCAAGTGTGTCCAGGCTGCCAGT 0: 1
1: 0
2: 0
3: 23
4: 223
Right 1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG 0: 1
1: 0
2: 1
3: 17
4: 184
1029848722_1029848730 15 Left 1029848722 7:103440933-103440955 CCAGGCTGCCAGTTCACCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 250
Right 1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG 0: 1
1: 0
2: 1
3: 17
4: 184
1029848725_1029848730 -1 Left 1029848725 7:103440949-103440971 CCCCTGGAGACAGCACTGCATGC 0: 1
1: 0
2: 1
3: 18
4: 210
Right 1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG 0: 1
1: 0
2: 1
3: 17
4: 184
1029848724_1029848730 7 Left 1029848724 7:103440941-103440963 CCAGTTCACCCCTGGAGACAGCA 0: 1
1: 0
2: 1
3: 22
4: 196
Right 1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG 0: 1
1: 0
2: 1
3: 17
4: 184
1029848727_1029848730 -3 Left 1029848727 7:103440951-103440973 CCTGGAGACAGCACTGCATGCAC 0: 1
1: 0
2: 1
3: 25
4: 177
Right 1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG 0: 1
1: 0
2: 1
3: 17
4: 184
1029848726_1029848730 -2 Left 1029848726 7:103440950-103440972 CCCTGGAGACAGCACTGCATGCA 0: 1
1: 1
2: 3
3: 31
4: 252
Right 1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG 0: 1
1: 0
2: 1
3: 17
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029848730 Original CRISPR CACTGTGTATGGAAGGCTGC AGG Intronic
905367441 1:37461132-37461154 CACTGTGTTGGCAAGGCTGTTGG + Intergenic
905378965 1:37546157-37546179 CCCTGTGTATGGCAGGGAGCGGG - Intronic
905682321 1:39883156-39883178 CACTGTGTCTGGCATGCGGCGGG + Intronic
910805718 1:91188419-91188441 CACAGTGTAAGCAAAGCTGCTGG - Intergenic
911539764 1:99144602-99144624 CAATGTGTATGGAATCTTGCGGG + Intergenic
913333495 1:117686501-117686523 CACTGTCTAAGGCAGGCAGCTGG + Intergenic
915243707 1:154541725-154541747 CCCTGTCTGGGGAAGGCTGCTGG + Intronic
915734975 1:158078758-158078780 TGCTGTGTCTGGATGGCTGCTGG + Intronic
917520014 1:175740572-175740594 CACTGTGTAGGGGAGACTGCTGG - Intronic
920199856 1:204252854-204252876 TACTGTGCATGGATGGCTCCTGG - Intronic
922189506 1:223305179-223305201 GTCTGTGCATGAAAGGCTGCCGG - Intronic
924710903 1:246529317-246529339 CTCTCTGTATGCAATGCTGCAGG + Intergenic
1064780757 10:18835762-18835784 CACAGTGTCTGGAAGTCTGATGG - Intergenic
1066826614 10:39599196-39599218 CACTCTGTTTGTAAGTCTGCAGG + Intergenic
1066826747 10:39601909-39601931 CACTCTGTTTGTAAGTCTGCAGG + Intergenic
1066900686 10:41097196-41097218 CACTCTGTTTGTAAGTCTGCAGG + Intergenic
1067104665 10:43358129-43358151 CACTGTGTTGGCCAGGCTGCTGG - Intergenic
1067439132 10:46298595-46298617 CCTGGTGTGTGGAAGGCTGCTGG + Intronic
1067716057 10:48691893-48691915 CCCTGTGTGCAGAAGGCTGCAGG + Intronic
1069225280 10:65935818-65935840 CACTGAGTATAGAAGGCTAGGGG + Intronic
1069613197 10:69789163-69789185 CTCTGTGTGGGGAAGGCTGTGGG + Intergenic
1070171154 10:73933551-73933573 GACTGTCTCTGGAAGGTTGCGGG + Intergenic
1071509322 10:86251200-86251222 CACTGCGGAAGGAAGGCGGCAGG + Intronic
1071767870 10:88689388-88689410 CTCTGTTTATGGAAGGGTGAAGG + Intergenic
1073960689 10:108924141-108924163 CGCTGTGTGGGTAAGGCTGCTGG - Intergenic
1076915546 10:133421624-133421646 CAGTGTGGACGGGAGGCTGCAGG + Exonic
1079364383 11:19796653-19796675 CTCTGTGGAGGGAAGGCTGGTGG + Intronic
1079906559 11:26255419-26255441 CACTGTGTATGGAACATTGATGG + Intergenic
1080000602 11:27344851-27344873 AACTGTATATGGAAAGATGCAGG + Intronic
1083629677 11:64089144-64089166 CCCTGTGCCTGGAAGGCTGCTGG - Intronic
1083871070 11:65488921-65488943 CACTGGGCAGGGAAGGCTGCAGG + Intergenic
1084486441 11:69450936-69450958 GGCTGTGTTTGGAAGGCTGATGG - Intergenic
1085324844 11:75598720-75598742 CACTGTCTATGGTAGGCTTTGGG + Intronic
1085410448 11:76287597-76287619 CACTGTGGGTGGAACCCTGCTGG - Intergenic
1086047613 11:82551183-82551205 CCCTGGGAATGGAAGGCTACAGG - Intergenic
1089016233 11:115167601-115167623 CAGTGTGTTTGGAGGGCTCCGGG - Intergenic
1089588516 11:119525000-119525022 CAGTGTGGAGGGAAGGCAGCTGG - Intergenic
1089977489 11:122745112-122745134 CAGTGTGGATGGAAGGCCTCAGG - Intronic
1090644817 11:128758796-128758818 CACTGTGTCTGGGAGGGGGCAGG + Intronic
1094578164 12:31707362-31707384 AAGTGTGTATGGAAGGCTAATGG + Intronic
1096929263 12:55187071-55187093 CACTGTTTTTGGTAGGTTGCAGG - Intergenic
1097253711 12:57656020-57656042 GATTGGGCATGGAAGGCTGCAGG - Intergenic
1098987677 12:77030028-77030050 CATGCTGTATGGAAGTCTGCAGG - Exonic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1103939719 12:124495168-124495190 CACTGGGTAGGAAAGGCTGTGGG + Exonic
1106522817 13:30512833-30512855 CACTCAGTATTGAAGGATGCAGG - Intronic
1107677667 13:42813536-42813558 CACAGAGTGTGGAAGGCTGTAGG - Intergenic
1108854440 13:54775589-54775611 CACTGGGGATGGCAGGCTGATGG - Intergenic
1112551454 13:100424561-100424583 CACAGTGTAGGGGAGGCTGCAGG - Intronic
1115127388 14:30012758-30012780 CACTGTGAATGGAAACCAGCAGG + Intronic
1115499020 14:34033189-34033211 CCTTGTGGATGGAAGGCTGGGGG - Intronic
1118015074 14:61652295-61652317 TATTCTGTATGGAATGCTGCTGG - Intronic
1120549978 14:85858538-85858560 CACTGTATATGGAAGTCTAGAGG + Intergenic
1120654040 14:87168517-87168539 CACTCTGTACACAAGGCTGCAGG + Intergenic
1122069822 14:99198665-99198687 CACTCTGTTTGGAAGGCTGGGGG - Intronic
1122638199 14:103140199-103140221 CACTTTGTGTGCGAGGCTGCCGG + Intergenic
1122999266 14:105283466-105283488 CACTGTGTGGGGGAAGCTGCGGG - Intronic
1123117731 14:105902217-105902239 CACTGTGGAGGGGATGCTGCTGG + Intergenic
1123202384 14:106678953-106678975 CACTGTGTCTGGAAAGCATCTGG + Intergenic
1125354532 15:38803250-38803272 CACAGTGTAAAGAAAGCTGCTGG - Intergenic
1126344059 15:47674579-47674601 CACTGTGCTTGGAAGGGTGAGGG + Intronic
1135182732 16:20289786-20289808 CACAGTGTGTGGGAGGCTGTGGG - Intergenic
1138169390 16:54834639-54834661 CACTGAATAGGGAAGGCTGTAGG - Intergenic
1139372319 16:66476746-66476768 CACTGTTTAGGAAATGCTGCTGG - Intronic
1139719553 16:68841552-68841574 CACTGTGTGGGGAAGGCTTGAGG - Intergenic
1141437000 16:84005545-84005567 CTCTGAGCATGGTAGGCTGCAGG - Intergenic
1142186625 16:88697850-88697872 CACTCGGAATGGATGGCTGCTGG + Intronic
1143520773 17:7443086-7443108 CACTGTGGAGAGAAGGCTCCTGG - Exonic
1143784135 17:9244270-9244292 CAGTCTGTATTGCAGGCTGCAGG + Intergenic
1144624046 17:16835536-16835558 CACTGCGGAAGGAAGGCCGCAGG - Intergenic
1144882380 17:18437179-18437201 CACTGCGGAAGGAAGGCCGCAGG + Intergenic
1145149854 17:20507207-20507229 CACTGCGGAAGGAAGGCCGCAGG - Intergenic
1145360234 17:22205987-22206009 TACTGAGTATGGAAGACTACTGG + Intergenic
1147898614 17:43769109-43769131 CACAGGGTGTGGAAGGCTGTGGG + Exonic
1148111497 17:45147127-45147149 CCCTGTTTATGGAGGGCTGGGGG + Intergenic
1148922155 17:51047236-51047258 CACTGTGGTTGGAATGCTGCAGG - Intronic
1149641585 17:58206289-58206311 CATTGTGAATGGAACTCTGCTGG + Exonic
1151353103 17:73543149-73543171 CCCAGTAAATGGAAGGCTGCCGG - Intronic
1152450805 17:80378374-80378396 TACTGTGTATGGAGGGCTCTAGG - Intronic
1153307887 18:3649533-3649555 CACAGTGTACGGAAGGCAGTAGG - Intronic
1153767456 18:8387898-8387920 CAATGTGCAGGTAAGGCTGCGGG - Intronic
1156055280 18:32994757-32994779 CATTGTGTTTAGAAGGCTGGAGG + Intronic
1159376521 18:67600328-67600350 GACTCTGTGTGGAATGCTGCAGG - Intergenic
1160529358 18:79554546-79554568 CACTGGGCCGGGAAGGCTGCAGG - Intergenic
1162029870 19:7912657-7912679 CACTGTGAACGGAAGACAGCAGG + Exonic
1162777650 19:12989740-12989762 GTGTGTGTATGGAAGGCTGGGGG + Intergenic
1163685368 19:18709248-18709270 CCCTGTGTGAGGGAGGCTGCGGG - Intronic
1163875349 19:19863177-19863199 GACTGTGCATGAAGGGCTGCAGG - Intergenic
1163889692 19:19999910-19999932 CACTGTGTATGGTAGGAGGCTGG + Intronic
1164869732 19:31632732-31632754 CACAGTGCATGGATGGCTGCAGG + Intergenic
1166118054 19:40667656-40667678 CACTGGGTATGGCAGGGGGCGGG + Exonic
925249957 2:2423867-2423889 TACTGTGTGGGGAAGGCTACAGG + Intergenic
925283796 2:2703099-2703121 GACTGTGCTTGGGAGGCTGCAGG - Intergenic
925844056 2:8020049-8020071 CACTGTCTGTGGAGGGCTCCCGG + Intergenic
926251566 2:11157944-11157966 CGCAGTCCATGGAAGGCTGCAGG - Intronic
926775415 2:16417523-16417545 CAATGTCTGTGGATGGCTGCAGG + Intergenic
927742694 2:25586592-25586614 CACTGGGGATGGAAAGCTGAAGG + Intronic
929483167 2:42331781-42331803 CACGCTGTATGGAAGGGTGTGGG + Exonic
931748456 2:65310626-65310648 CTCAGTGAAAGGAAGGCTGCAGG - Intergenic
932197683 2:69798334-69798356 CTCTCTGTATGCAATGCTGCAGG - Intronic
932232586 2:70094894-70094916 TATTTTGTATGGAAGGCTGAAGG - Intergenic
932814572 2:74851646-74851668 CACCCTCTATGGAAGGCTTCAGG - Intronic
935238718 2:101159868-101159890 CACTGTGCTTGGAAGAATGCTGG - Intronic
936448302 2:112614666-112614688 CACAGTGTAAGCAAAGCTGCTGG - Intergenic
937040537 2:118817279-118817301 CACTGAGTTTTGAAGGATGCAGG - Intergenic
942811126 2:180002322-180002344 CACTGTATATAGGAGGCTGGGGG + Intronic
943263447 2:185695975-185695997 CCCTTTATGTGGAAGGCTGCAGG - Intergenic
945295368 2:208165565-208165587 CATTGTGACTGGAAGACTGCTGG - Exonic
1170042661 20:12054375-12054397 GACTGTGAATGGAACGCTGCTGG - Intergenic
1171303445 20:24084276-24084298 CACTGGGTAGGGAAAGCAGCTGG - Intergenic
1172130594 20:32652376-32652398 CCCTTTGCATGGAGGGCTGCTGG - Intergenic
1172368426 20:34367557-34367579 CACTGTGTTTGGAAGGATTCTGG + Intronic
1174431277 20:50471334-50471356 CACTGTGTTGGCAAGCCTGCAGG - Intergenic
1174465488 20:50713947-50713969 CAATGTGTGTGAAAGGCTCCTGG - Intergenic
1174772249 20:53311535-53311557 CACTGTGTGTGCCAGGCTGAGGG - Intronic
1175312889 20:58024245-58024267 CACTGTGGATGGCAGGTTGATGG - Intergenic
1175634508 20:60569317-60569339 CCCAGTGTAGGGAAGGCTGTGGG + Intergenic
1175745616 20:61454770-61454792 CAGTGTATATGGTAGCCTGCAGG + Intronic
1178134034 21:29605890-29605912 CATTGTGTATGGAAGGCTCATGG + Intronic
1179501953 21:41815645-41815667 CACTGTGTAGGGAAGCCAGGTGG - Intronic
1179546244 21:42114070-42114092 GACTGCGCCTGGAAGGCTGCGGG + Intronic
1180723324 22:17925741-17925763 CACTGTGGAAGGAGGGGTGCCGG - Intronic
1182755731 22:32677365-32677387 CATTGTTCATGGAAGACTGCAGG + Intronic
1185182372 22:49370819-49370841 CATTGTCTCTGGAAAGCTGCGGG + Intergenic
949325893 3:2863921-2863943 CACTGTTTAGGAAATGCTGCAGG + Intronic
949530161 3:4947658-4947680 AGCTGTGTTTGGAAGGCTTCTGG - Intergenic
951006342 3:17620006-17620028 CACTCTGTTTGCAAGGCTGTAGG + Intronic
953536625 3:43781996-43782018 CACAGTGGATGGGAGGCTGTGGG - Intergenic
954419553 3:50411453-50411475 CACTGTGTCTGGAATGGAGCTGG - Intronic
955411659 3:58659381-58659403 CCCTGTGTACAGAAGGCCGCAGG - Intronic
955515128 3:59718873-59718895 CACTGACTCTGGAAGGCTGTTGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
960908802 3:122628129-122628151 AACTGAGTATGGAAGGATGTAGG - Intronic
963113025 3:141702113-141702135 CACAGTGAATGGAAGGGGGCTGG + Intergenic
964276702 3:155016209-155016231 CACTTTGTAAGGCAGGCTGAAGG + Intergenic
967975914 3:195034766-195034788 CACTGTGCGTGGAGGGATGCAGG + Intergenic
969472747 4:7399272-7399294 CCCTGTGGATGGAAGGCTGGCGG + Intronic
969630469 4:8332970-8332992 CACTGCGTCTGGAAGGCCCCAGG + Intergenic
970210326 4:13703280-13703302 CAGTGTGTGGGGAAGGCTGGTGG - Intergenic
973956441 4:56068014-56068036 CAGTGTGTGTGTGAGGCTGCAGG + Intergenic
977028456 4:91851727-91851749 CAGGGTCTTTGGAAGGCTGCGGG - Intergenic
978890976 4:113827193-113827215 CACTGTATATGGATGGCTGCTGG + Intergenic
981179260 4:141719382-141719404 CATTGTGGATGGATGGCTGCTGG + Exonic
983281928 4:165691976-165691998 CACTGAGTCTAGAAGGCTGGAGG - Intergenic
984169464 4:176343406-176343428 CACTGTGCATGGCAGGTTGATGG - Intergenic
986401678 5:7388173-7388195 CAATGTTTAGGGAAGGTTGCTGG - Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
989396622 5:40963825-40963847 CTATATGTATGGAATGCTGCTGG - Intronic
990710130 5:58571622-58571644 CACTGTGAATGGTATGCTGGAGG + Intergenic
996174136 5:120333673-120333695 CACTGTGGAAGGTAGGCTGTGGG + Intergenic
996421831 5:123270922-123270944 CACTATGTTTGGATGGCTGTGGG + Intergenic
998566761 5:143222811-143222833 CACTGTGTAGCTAAGCCTGCTGG + Exonic
998837444 5:146216688-146216710 CACTGTGTATCCCAGGCTGGAGG + Intronic
999646534 5:153723197-153723219 CAATGTGTAAGGAAAGCTGTGGG + Intronic
1000988690 5:167889305-167889327 CACTGTGGACGGAGGGCTGTGGG + Intronic
1002162774 5:177325940-177325962 CACTGTGTATGCATTGTTGCAGG - Intergenic
1003385621 6:5664923-5664945 CACTGTATATGAAAGGATACAGG - Intronic
1004286645 6:14327267-14327289 CACTTAGTATGGACAGCTGCAGG + Intergenic
1005900176 6:30210494-30210516 TACAGTGTATGCAAAGCTGCAGG - Intronic
1006244098 6:32715100-32715122 CACTGTGTATTGAGTGCTGATGG + Intergenic
1008439057 6:51511530-51511552 GACTGTTTATGGTAGGCTGGGGG - Intergenic
1011293966 6:85807491-85807513 CACTGTGTTGGCCAGGCTGCTGG + Intergenic
1011390528 6:86847532-86847554 CACTGTCTTGGGAAGGATGCAGG + Intergenic
1014968576 6:127786900-127786922 TACTGTGATTGCAAGGCTGCTGG - Intronic
1015708312 6:136111999-136112021 CATTTTGGAAGGAAGGCTGCAGG - Intronic
1021766581 7:23955938-23955960 CTGACTGTATGGAAGGCTGCTGG + Intergenic
1022247645 7:28575879-28575901 CCCCGTGAGTGGAAGGCTGCCGG - Intronic
1024164130 7:46713365-46713387 CACTGTATATGGAACCCTGGTGG - Intronic
1028608629 7:92683152-92683174 CACAGGATATGGCAGGCTGCAGG + Intronic
1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG + Intronic
1032058875 7:128706892-128706914 CAATGGGGTTGGAAGGCTGCAGG + Intergenic
1033111634 7:138583669-138583691 CAGTGTGTGTGGAAGGCAGTGGG + Intronic
1033714901 7:143990474-143990496 CACTGTGTTTGGAAAACTGAAGG + Intergenic
1034400020 7:150856192-150856214 CCCTGAGTAAGGAAGGCTGCAGG + Intronic
1036637486 8:10561731-10561753 CACTGTGTCTTGGAGGCTGAGGG + Intergenic
1037581263 8:20247209-20247231 CTCTGTGTATGGAAGGTACCGGG + Exonic
1038069087 8:23993373-23993395 CAGTGGGTTTGGAAGGCTGCAGG - Intergenic
1038578759 8:28728634-28728656 CACTTTTTTTGGAAGGCTGAGGG + Intronic
1039593320 8:38768867-38768889 GACTGTGTATGTAAGACTGTCGG + Intronic
1039906729 8:41791831-41791853 CATGGTGTCTGGAAGGCAGCGGG - Intronic
1040394363 8:46982068-46982090 CAATGTGTATTAAAGGATGCAGG - Intergenic
1044608229 8:94065668-94065690 CACTGTGTCACCAAGGCTGCTGG - Intergenic
1045636711 8:104199765-104199787 CTCCGTATATGCAAGGCTGCTGG + Intronic
1048518743 8:135134886-135134908 CAATGTGTATGGATGCCTCCTGG - Intergenic
1048522204 8:135167056-135167078 CATTGTGTATGGGAGGGTGTGGG + Intergenic
1049302341 8:141878287-141878309 CACTGTGCAGAGAAGGCTGAGGG - Intergenic
1049606851 8:143533549-143533571 CACTGTGCCTGGCAGCCTGCCGG - Intronic
1050028113 9:1356787-1356809 CACTGTGACTGGAGGGCTGGGGG - Intergenic
1052617793 9:30864826-30864848 TACTGTGTATATGAGGCTGCAGG - Intergenic
1054715146 9:68549844-68549866 CACTCTGTTGGCAAGGCTGCAGG + Intergenic
1057503427 9:95613885-95613907 CACAATGCAAGGAAGGCTGCAGG - Intergenic
1062235164 9:135504438-135504460 CACGGTGAAGGGAGGGCTGCTGG - Exonic
1062589952 9:137269611-137269633 TACTGAGTACTGAAGGCTGCTGG - Intronic
1185708876 X:2286457-2286479 CAGGGTGGATGGAAAGCTGCAGG - Intronic
1186188279 X:7043010-7043032 CACTGTTTATGGAGGGTGGCCGG - Intergenic
1187326388 X:18294721-18294743 CACTGTGTATGGTAGAGTGCTGG - Intronic
1189066555 X:37815942-37815964 CACTGGGTAAGGAATGCAGCAGG - Intronic
1190942683 X:55057490-55057512 CAGTGAGAATGGAAGGCGGCAGG - Intergenic
1193697178 X:84723642-84723664 CACTGTGAATGGAAGGCCACAGG - Intergenic
1196269791 X:113697689-113697711 CACAGTGTAAAGAAAGCTGCCGG - Intergenic
1197584911 X:128334506-128334528 GACAGTGTATGGCAAGCTGCTGG + Intergenic
1200081031 X:153576439-153576461 CACTGGGATGGGAAGGCTGCTGG + Intronic
1200232838 X:154453008-154453030 CACTGTGTGGGCAAGGCTGGGGG - Intergenic