ID: 1029849520

View in Genome Browser
Species Human (GRCh38)
Location 7:103447363-103447385
Sequence ACTCTCCGCGTCCCTAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029849512_1029849520 22 Left 1029849512 7:103447318-103447340 CCTCCCTACTCCACACGAGGGCG No data
Right 1029849520 7:103447363-103447385 ACTCTCCGCGTCCCTAGCTGAGG No data
1029849515_1029849520 12 Left 1029849515 7:103447328-103447350 CCACACGAGGGCGATCTCTTCAA No data
Right 1029849520 7:103447363-103447385 ACTCTCCGCGTCCCTAGCTGAGG No data
1029849514_1029849520 18 Left 1029849514 7:103447322-103447344 CCTACTCCACACGAGGGCGATCT No data
Right 1029849520 7:103447363-103447385 ACTCTCCGCGTCCCTAGCTGAGG No data
1029849513_1029849520 19 Left 1029849513 7:103447321-103447343 CCCTACTCCACACGAGGGCGATC No data
Right 1029849520 7:103447363-103447385 ACTCTCCGCGTCCCTAGCTGAGG No data
1029849511_1029849520 23 Left 1029849511 7:103447317-103447339 CCCTCCCTACTCCACACGAGGGC No data
Right 1029849520 7:103447363-103447385 ACTCTCCGCGTCCCTAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029849520 Original CRISPR ACTCTCCGCGTCCCTAGCTG AGG Intergenic