ID: 1029852670

View in Genome Browser
Species Human (GRCh38)
Location 7:103481067-103481089
Sequence CAGCATGTTGACAGGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029852664_1029852670 5 Left 1029852664 7:103481039-103481061 CCTGCCGGTGCTCTGACAGCCTC 0: 1
1: 0
2: 1
3: 11
4: 181
Right 1029852670 7:103481067-103481089 CAGCATGTTGACAGGGAGCAAGG 0: 1
1: 0
2: 1
3: 22
4: 257
1029852665_1029852670 1 Left 1029852665 7:103481043-103481065 CCGGTGCTCTGACAGCCTCTAAG 0: 1
1: 0
2: 2
3: 20
4: 195
Right 1029852670 7:103481067-103481089 CAGCATGTTGACAGGGAGCAAGG 0: 1
1: 0
2: 1
3: 22
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029852670 Original CRISPR CAGCATGTTGACAGGGAGCA AGG Intronic
900381733 1:2387530-2387552 CTGCATGTGGACAAGGAGGAGGG + Intronic
901490517 1:9594257-9594279 CAGCATGGAGACAGCGGGCAAGG - Intronic
902542258 1:17163608-17163630 CCCCATGTTGGCAGGGTGCATGG + Intergenic
903481580 1:23657302-23657324 CAGCATGGTGGCTGGGAGCCTGG + Intergenic
904280178 1:29413463-29413485 CAGCAAGTAGAAAGGGAGCCAGG + Intergenic
904840101 1:33367179-33367201 CAGCAGTGTGCCAGGGAGCATGG - Exonic
907054027 1:51348466-51348488 CAGCATGCTACAAGGGAGCAAGG + Intergenic
907811516 1:57875311-57875333 GAGCATGTTCAAAGGCAGCAAGG - Intronic
908118116 1:60961002-60961024 CATGAGGTTGACAGGGAGGAGGG + Intronic
908390910 1:63682804-63682826 GAGAATATTGACAGGGGGCAGGG - Intergenic
909097054 1:71300698-71300720 CACCATGTTATCAGGTAGCAAGG + Intergenic
910017157 1:82539803-82539825 CTGCACTCTGACAGGGAGCATGG - Intergenic
911371901 1:97003877-97003899 CAACATTTTGACAAGTAGCAGGG + Intergenic
912448142 1:109752764-109752786 CAGCATGGTGGGAGGGAGCTGGG + Intronic
912710437 1:111945850-111945872 CAGCATGGAGACAGGCTGCAGGG - Intronic
912859077 1:113196958-113196980 CAGCATGTCCTCAGGGACCAAGG + Intergenic
913326189 1:117630726-117630748 CAGCTTTTAGGCAGGGAGCAGGG - Intergenic
915444891 1:155968987-155969009 CAGAGTGAGGACAGGGAGCAAGG + Intronic
915544765 1:156590742-156590764 CAGTATGGTGACAGAGAGGAGGG + Intergenic
918264314 1:182826473-182826495 CAGGACTCTGACAGGGAGCAGGG - Intronic
918274139 1:182935495-182935517 TAGCAAGTTTACAGGAAGCAAGG - Intronic
920338266 1:205259270-205259292 CAGCAGGCTGACAGGGAGAAAGG - Intronic
921265962 1:213420831-213420853 CTGCATGTTCAGAGGGAGCGTGG - Intergenic
921658038 1:217764004-217764026 CAGGATGTTGACAGTGGGGAAGG - Intronic
922220335 1:223553377-223553399 CAGGACGGTGACAGGGAACAGGG + Intronic
922359312 1:224806796-224806818 CAGCATGTGATCAGGGACCAAGG - Intergenic
923261767 1:232274413-232274435 CGGCATGTTGATTGGTAGCAAGG + Intergenic
1062786270 10:267837-267859 CAGCATGTGTGCAGGGACCACGG - Intergenic
1068800293 10:61132768-61132790 CACCATCTTCACAGGGATCAAGG + Intergenic
1071943496 10:90614652-90614674 CACCACCTTGGCAGGGAGCAGGG - Intergenic
1074529618 10:114288355-114288377 CAGCCTGTTGACAGCAGGCATGG + Intronic
1074604813 10:114951128-114951150 CAGTATGTTGTCAGGGTCCAAGG + Exonic
1075482586 10:122795465-122795487 CAGCAAGATGAAAGGGAGAACGG + Intergenic
1076278813 10:129227858-129227880 CAGCATCTTGAGAGGCAGAAAGG + Intergenic
1076835100 10:133017008-133017030 GAGCGTGGTGACGGGGAGCATGG - Intergenic
1076835108 10:133017038-133017060 GAGCATGGTGACAGTGACCATGG - Intergenic
1076835109 10:133017053-133017075 GAGCATGGCGACAGGGAGCATGG - Intergenic
1078405705 11:11068245-11068267 CAGCAGGCAGCCAGGGAGCATGG - Intergenic
1079312226 11:19377226-19377248 AGGAATGTTGTCAGGGAGCATGG + Intronic
1081716664 11:45255488-45255510 CAACATGTTGTCAGGAAGAAAGG + Intronic
1083492069 11:63020663-63020685 CATCATGTTGCCAGGCAGCCTGG + Intergenic
1084727101 11:70949080-70949102 CAGCTGGTTGGCAGGGAGCTGGG - Intronic
1085526570 11:77167474-77167496 CAGCATTCTGACAGGGAGCTGGG + Intronic
1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG + Exonic
1089134297 11:116237022-116237044 CAGGATGTTGATGGGCAGCACGG + Intergenic
1089579440 11:119472268-119472290 CAGCATGAAGACAGGGAGGATGG - Intergenic
1089978500 11:122753250-122753272 CACCATGTTGACCAGGAGCCAGG - Intronic
1091102837 11:132891846-132891868 GAGGATGTTTACAGGGAACATGG - Intronic
1096798821 12:54095926-54095948 CAGCCTGTTCCCAGGCAGCATGG - Intergenic
1098641251 12:72840144-72840166 CAGCACATTGAGAGGGAGCATGG + Intergenic
1099492213 12:83301285-83301307 CAGAAAGTTGACGGGGAGAATGG + Intergenic
1100046956 12:90393875-90393897 CAGAATTTTGACAGTGAACAGGG - Intergenic
1101580995 12:106040600-106040622 CAGCATGCACCCAGGGAGCATGG + Intergenic
1102036196 12:109771806-109771828 GAGGATGTTGAGAGGGAGCGAGG + Intergenic
1103279463 12:119743884-119743906 CAAGATGATGACAGGGACCAAGG + Intronic
1103587972 12:121970323-121970345 CAGCAGGATGACAGGAGGCAGGG - Intronic
1104965585 12:132507550-132507572 CAGCAGGTTTACAGGGGGCCTGG + Intronic
1104968206 12:132519075-132519097 CAGCACAGTGTCAGGGAGCAGGG - Intronic
1106506889 13:30378350-30378372 CACCATGATGAAAAGGAGCAAGG + Intergenic
1108482952 13:50893773-50893795 TTGCATGTAAACAGGGAGCATGG - Intergenic
1108505359 13:51108019-51108041 CAGCACCTTCAGAGGGAGCATGG - Intergenic
1108862049 13:54872839-54872861 TAGCAAGTTTACAGGGTGCAAGG - Intergenic
1110067256 13:71124411-71124433 CAGCATGTTTTCATAGAGCAGGG + Intergenic
1112121563 13:96418095-96418117 CACCATGCTGACAGGGTGCCCGG - Intronic
1112564420 13:100540970-100540992 TAGCATGGTGAGAGGGGGCAGGG - Intronic
1113587101 13:111472997-111473019 CAGCATCTGGTCAGGAAGCAGGG + Intergenic
1113616023 13:111681209-111681231 CAGCATGTTGAGGAGGTGCAGGG - Intergenic
1113621491 13:111766102-111766124 CAGCATGTTGAGGAGGTGCAGGG - Intergenic
1118380660 14:65214958-65214980 GAGGATATTGACAGAGAGCAAGG + Intergenic
1120525964 14:85577481-85577503 CAGAGTCTTGAAAGGGAGCATGG - Intronic
1120860144 14:89247686-89247708 GAGTAGGTTGACAGGGAACAGGG - Intronic
1121662639 14:95646798-95646820 CAGCAGATTGGCAGGGAGCCTGG - Intergenic
1121698555 14:95933270-95933292 CAGCAGGGAGACAGGGAGCTGGG - Intergenic
1122812088 14:104294062-104294084 CAGCCTCAGGACAGGGAGCACGG - Intergenic
1128442528 15:67725543-67725565 CAGCATGTCATCAGGGACCATGG - Intronic
1130168415 15:81486331-81486353 CAGGGTGTTGGGAGGGAGCAAGG + Intergenic
1130384706 15:83400997-83401019 GTGCATGTGGAAAGGGAGCAAGG + Intergenic
1131864560 15:96693641-96693663 CAGTAACTTGACAGGGAGGAAGG + Intergenic
1132696050 16:1202431-1202453 CCGCATGTGGTCGGGGAGCATGG + Exonic
1133215679 16:4290915-4290937 GAGCCTGTTGACATGGAGGATGG + Intergenic
1135005535 16:18818793-18818815 CAGCCTCTTGACAGGGCACAAGG + Intronic
1137772070 16:51024392-51024414 CAGCTCGTTGACAGGAGGCAGGG - Intergenic
1137895488 16:52207416-52207438 CAGCATGGTGAATGAGAGCAGGG - Intergenic
1140282023 16:73563696-73563718 CTGCATTTTGACAGGTAGAAGGG - Intergenic
1141196032 16:81861999-81862021 CCACATGTTGACAGAGAGCAGGG - Intronic
1141594899 16:85091249-85091271 GGACATGTTGACAGGCAGCATGG + Exonic
1141901189 16:86991924-86991946 AAGTATGTTTACAGTGAGCACGG - Intergenic
1142930120 17:3277214-3277236 CTGGATGTTGACTGGGCGCAGGG - Intergenic
1143471150 17:7177011-7177033 CAGCAACTTCACAGCGAGCACGG - Exonic
1143765238 17:9133408-9133430 CAGCAAGTCGCCTGGGAGCAAGG - Intronic
1144727559 17:17509487-17509509 CAGGATGTTGAAGGGGAACACGG + Exonic
1145063441 17:19746362-19746384 CAGCACTTTGACCGGGAGAATGG + Intronic
1147522791 17:41190367-41190389 CAGCATGTTGGGTGGCAGCAAGG - Exonic
1147526819 17:41232736-41232758 CAGCATGTGGGCTGGCAGCAGGG - Exonic
1147632258 17:41939714-41939736 CAGCATATTGCCAGGGAGAGGGG + Intronic
1147995971 17:44360718-44360740 CAGCAGTTTGAAAGGGAGGATGG + Intronic
1149629366 17:58109372-58109394 CAAGATGTTGGCAGGGAGCCAGG - Intergenic
1149693351 17:58597054-58597076 CAGCAAGTTGAGAGGTGGCAGGG + Intronic
1151829390 17:76540704-76540726 CAGCAGGCGGACAGGGAGCAGGG - Intronic
1153368369 18:4285407-4285429 CAGGATGTTGTCAGAGTGCAAGG + Intronic
1153811477 18:8755726-8755748 CAGAATGTTCACAGGGAGTGGGG + Intronic
1154140447 18:11818992-11819014 CAGCATGGCGAGTGGGAGCAGGG + Intronic
1155044305 18:22090130-22090152 CAGCAAATTGAGAGGGAGCCAGG + Intronic
1157415146 18:47496167-47496189 CAAGATGTTGACAGGGAGAAAGG - Intergenic
1158535947 18:58308610-58308632 CATCAGGGTGACAGGCAGCATGG + Intronic
1158652924 18:59303782-59303804 CTACATGTCTACAGGGAGCATGG - Intronic
1159792316 18:72797743-72797765 CAGCATGGAGCCAGGGACCAAGG - Intronic
1160015084 18:75134085-75134107 CAGCATGTGTGCTGGGAGCAGGG + Intergenic
1160523673 18:79523051-79523073 CAGTCTGTTCACAGGGACCACGG - Intronic
1161914880 19:7221037-7221059 CAGAGTCCTGACAGGGAGCAGGG - Intronic
1162436098 19:10660090-10660112 CAGCATGCTCTCAGGCAGCAGGG - Intronic
1163722611 19:18905400-18905422 CAGTATGTTGCCAGGGAGGAGGG - Intronic
1165406050 19:35631925-35631947 CAGCTGGGTGACAGTGAGCAGGG - Intronic
1166235958 19:41456805-41456827 CAGCATCTCGAGATGGAGCAGGG + Intergenic
1166686072 19:44797043-44797065 CAGCAGGCTGACAGGGACCTCGG + Intronic
1167404332 19:49294478-49294500 AAGCAGGTTGACAGGGGGCTTGG + Exonic
1167515197 19:49919268-49919290 CAGCCTGTCTCCAGGGAGCAGGG - Intronic
1168567360 19:57435963-57435985 CAGGATGTTGAACGGGGGCAGGG + Intronic
925562469 2:5211655-5211677 CAGGATGTTGTCTGAGAGCAGGG - Intergenic
925647033 2:6045679-6045701 CAGAGTATTGAGAGGGAGCACGG + Intergenic
925971274 2:9108189-9108211 CACCATCTTCACAGGCAGCAAGG - Intergenic
926390856 2:12391039-12391061 CATCATGTTGATAGAGATCAAGG + Intergenic
926699692 2:15795542-15795564 CATCCTGTTGACCGGGAGCCAGG + Intergenic
926933175 2:18061037-18061059 CAGCAAGTCCACAGTGAGCAAGG - Intronic
929833214 2:45367057-45367079 CAGCATCTTAACAGGAAGCCTGG - Intergenic
929860774 2:45675631-45675653 TGGCATGTTGAAAAGGAGCAGGG - Intronic
929937276 2:46302562-46302584 CATCATGTGAACAGGCAGCATGG - Intronic
931575374 2:63712902-63712924 CAGCATAATGTCAGGGATCAGGG + Intronic
935209358 2:100925214-100925236 CCGCGTGTTGCCAGGGAGCATGG - Exonic
935666301 2:105516016-105516038 CAGCAGGGAGATAGGGAGCAAGG - Intergenic
936558124 2:113513632-113513654 AAGTATGTTCATAGGGAGCATGG + Intergenic
937203093 2:120218413-120218435 CAGCAAGTTCACAGGGATCCGGG - Intergenic
941344605 2:164352161-164352183 TAGCATCTTCAGAGGGAGCATGG - Intergenic
941553690 2:166948278-166948300 CAGGATGTTGATAATGAGCAGGG + Intronic
941755879 2:169185135-169185157 CAGCGTGATGACAAGCAGCAGGG - Intronic
942042407 2:172079568-172079590 CCACTTGCTGACAGGGAGCAAGG - Intronic
942770291 2:179509460-179509482 TAGCATGATTACAGGGAGCAGGG - Intronic
946089613 2:217209116-217209138 GTGCCTGTTGATAGGGAGCAGGG - Intergenic
947441994 2:230131534-230131556 CACCATGCAGAGAGGGAGCAAGG - Intergenic
947747739 2:232517823-232517845 CAGCTGGATGACAGGGTGCAGGG - Intergenic
947748311 2:232520582-232520604 CAGCATGGTGACCAGGAGCTGGG - Exonic
948031281 2:234819662-234819684 CAGCATGTGGGAAGGGAGGAGGG - Intergenic
948395976 2:237645361-237645383 CAGCATCTTGGCAGTGAGGAGGG - Intronic
1170220906 20:13940630-13940652 CAGCATCATGAGTGGGAGCAGGG + Intronic
1170306324 20:14942085-14942107 CAGAATGTTGGCTGGGTGCAGGG - Intronic
1170695042 20:18650407-18650429 CAGGATGTGGGCAGGGAGGACGG - Intronic
1171386664 20:24774106-24774128 CAGGCTGTTGACAGGTAGCCAGG - Intergenic
1173197263 20:40926006-40926028 CAGCAGACTGACAGAGAGCAGGG - Intergenic
1175712339 20:61231401-61231423 CAGCATGGGGAATGGGAGCAGGG - Intergenic
1176688748 21:9879790-9879812 CAGAATACTGACACGGAGCATGG - Intergenic
1177048702 21:16203966-16203988 TAGCATGTGGACAGGGTGCATGG + Intergenic
1177251978 21:18604404-18604426 AGGCATGTTCACAGGTAGCAAGG + Intergenic
1179681536 21:43024956-43024978 CAGCATGATTTCAGGAAGCAGGG - Intronic
1181737730 22:24894855-24894877 AAGCATGTATACAGGGATCATGG + Intronic
1182073554 22:27479458-27479480 CAGGATGGTGACAGGGGGCTGGG - Intergenic
1182082398 22:27538644-27538666 CAGCTAGTTGTGAGGGAGCAGGG + Intergenic
1184617140 22:45645862-45645884 CAGCAGGTTAGCATGGAGCAGGG - Intergenic
1184891259 22:47380889-47380911 CAGGATGCTGACCTGGAGCAAGG - Intergenic
949397998 3:3635603-3635625 CTGAGTCTTGACAGGGAGCAGGG - Intergenic
949666923 3:6349829-6349851 CAGCATGGTGGCAGAGAGCCTGG - Intergenic
949733457 3:7142711-7142733 CAAAATGTTGACAGGGATCAAGG + Intronic
951025434 3:17823830-17823852 CAGCAGGTTCACAGGCAACAAGG - Intronic
951871337 3:27366011-27366033 CAGCTTGTGGACAGGGTGTATGG - Intronic
952733474 3:36664671-36664693 CTGCAGGCTGACAGGAAGCATGG - Intergenic
954445227 3:50542751-50542773 CAGGATGCTGACCTGGAGCAAGG - Intergenic
955800465 3:62680996-62681018 CAGCAGGATCACAGGGAACATGG - Intronic
956045375 3:65190491-65190513 TAGTATGGTGACAGGGAGCTAGG - Intergenic
956697843 3:71933744-71933766 GAGCATGTTCACAGGTACCAGGG - Intergenic
956935541 3:74096640-74096662 CAGCATGGGGGGAGGGAGCATGG + Intergenic
957287654 3:78237997-78238019 CAGCAAGTTGTGAGGGAGCGTGG - Intergenic
957434831 3:80161330-80161352 CAGCATGTAGAGAGGAACCAAGG - Intergenic
958122469 3:89309289-89309311 CAGCATTTTGATACGGAGAAGGG + Intronic
959343762 3:105165627-105165649 CAGCATGAACACAGGGAGTAAGG - Intergenic
960031029 3:113055136-113055158 GAGGATTTTGACAGGGAGAAAGG - Intergenic
960973754 3:123156760-123156782 GAGCATGGTGTCAGGGAGCGTGG + Intronic
961036339 3:123644593-123644615 GAGCAAGTTGAGAGGGTGCAGGG - Intronic
961152233 3:124648656-124648678 CAGCCTGTTGAGTGGTAGCATGG - Intronic
961774158 3:129272097-129272119 CAGCATGAAGACAGGGAACCTGG + Intronic
961952259 3:130762333-130762355 CAACATGTTGTCTGGGAGCTAGG - Intergenic
962313438 3:134342215-134342237 TAGCATCTTCAGAGGGAGCATGG + Intergenic
963008202 3:140745949-140745971 CAGCATGTTGAAAGGTACCAAGG - Intergenic
965882820 3:173408218-173408240 TACCATGTTGAAAAGGAGCATGG - Intronic
967759920 3:193212221-193212243 CATCATCTTGACAGTGATCATGG - Intergenic
968707264 4:2085567-2085589 CAGAGGGTTGGCAGGGAGCAGGG + Intronic
969054830 4:4395151-4395173 CAGCAAGTGGGCAGGGAGCTAGG - Intronic
969146451 4:5128149-5128171 TAGCACCTTCACAGGGAGCATGG + Intronic
969563108 4:7961905-7961927 CAGCATGAGGAGAGGGATCATGG - Intergenic
969893266 4:10279345-10279367 AAGTATGTGGAGAGGGAGCAAGG + Intergenic
971201581 4:24514029-24514051 CAGCAGGGGGAGAGGGAGCACGG + Intergenic
972731379 4:41798540-41798562 CAGCATGAAGACAGGTGGCACGG + Intergenic
976100574 4:81558489-81558511 CCGCATGGTGAAAGGGAGCATGG + Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977652265 4:99484605-99484627 CAGAATACTGAGAGGGAGCATGG - Intergenic
979745303 4:124205762-124205784 CAGAACATTGATAGGGAGCATGG - Intergenic
979819216 4:125150461-125150483 CTGAAGGTTGACAGGGAGAATGG - Intergenic
980000347 4:127480013-127480035 CAGCATGATGGCTGCGAGCATGG - Intergenic
986110141 5:4707998-4708020 CAGCATGTTTGCAGGATGCAAGG - Intergenic
987257201 5:16168243-16168265 CAGCAAGTAGACAGGAGGCAGGG + Intronic
991614578 5:68482702-68482724 CAGAATAATGACAGGTAGCATGG + Intergenic
999327790 5:150653823-150653845 CAGCTTGATGACTGGGAGCTTGG + Exonic
1001099113 5:168799593-168799615 CAACATGATGCCAGGGAGCCTGG + Intronic
1001495215 5:172183271-172183293 CACAATGTGGACAGGGAGCATGG - Intronic
1002166093 5:177347311-177347333 CAGCATGTTCACGGGGAGGCTGG + Intronic
1003956505 6:11170240-11170262 GGTCATGTTGACAGAGAGCATGG + Intergenic
1004037275 6:11935643-11935665 CAGCATGTCAACAGGCAGCAGGG - Intergenic
1004160579 6:13209286-13209308 AATCATGTTGACAGGCAACAGGG - Intronic
1004523178 6:16381411-16381433 GAGCATCTTCACAGGGAGCATGG + Intronic
1005873599 6:29995128-29995150 CAGCATGTTGACGGACACCAAGG - Intergenic
1006339068 6:33436233-33436255 CAGTGTGTTGAAAGGGAACATGG - Intronic
1006534458 6:34686903-34686925 CAGCATTATGACAGGAAGCAGGG + Intronic
1007905906 6:45460513-45460535 CAGGATGTTTAAAGGGAGCAGGG + Intronic
1012367294 6:98457696-98457718 CAGTATGATAACAGGGAGCTTGG + Intergenic
1017642516 6:156508062-156508084 CAGGATGTTGAAAGAGAGGAAGG - Intergenic
1018122738 6:160652765-160652787 CAACATTTTGAGAGGGAGGAAGG + Intronic
1018855806 6:167674052-167674074 CAGAATGAGGACAGGGACCATGG - Intergenic
1019062217 6:169264773-169264795 CAGCATGGTGGGAGAGAGCAGGG + Intergenic
1020927568 7:14351393-14351415 CAGAATGTTGGCAGGGCACAGGG + Intronic
1021974196 7:25995818-25995840 CAGCCTCTTGATGGGGAGCAGGG + Intergenic
1022152138 7:27618717-27618739 CTGCAGGTTGTCAGGAAGCATGG + Intronic
1023124131 7:36938107-36938129 CAGCATCTTGACTGTGAGCTTGG - Intronic
1023201474 7:37701952-37701974 CAGCCTGTTGAAAGGGAAAAGGG - Intronic
1023662355 7:42482889-42482911 CTTCCTGGTGACAGGGAGCAAGG - Intergenic
1024954532 7:54902656-54902678 CAGCATGAGGACAGGTACCATGG + Intergenic
1028888608 7:95961897-95961919 AACCATGTGGAGAGGGAGCAAGG - Intronic
1029033016 7:97488517-97488539 CACCAAGATGACAGGGAGAAAGG + Intergenic
1029414199 7:100432849-100432871 GAGCAGGTTGCCTGGGAGCAGGG + Intronic
1029852670 7:103481067-103481089 CAGCATGTTGACAGGGAGCAAGG + Intronic
1030161324 7:106511257-106511279 CAGCATGAAGAGAGGAAGCATGG + Intergenic
1030700853 7:112638708-112638730 CAGTATTTTGACAGGCAGCTGGG + Intergenic
1031019797 7:116614707-116614729 CAGCCTTTAGACAGGGAACAAGG - Intergenic
1031037944 7:116808557-116808579 CAGGATGTTGGCAGGGACCCAGG + Intergenic
1031139975 7:117931848-117931870 CAGCATGTTGTAAGTGAGCCTGG + Intergenic
1031974328 7:128084371-128084393 AAGAAAGTAGACAGGGAGCAAGG - Intronic
1032447972 7:132001022-132001044 CAGGGTGTTAGCAGGGAGCAGGG + Intergenic
1034189215 7:149200957-149200979 CAACATATAGAAAGGGAGCAGGG - Intronic
1034214522 7:149394895-149394917 GAGGATGAGGACAGGGAGCAAGG - Intergenic
1034448037 7:151123279-151123301 CAGGAGCTTGACAGGGTGCAGGG + Intronic
1034655631 7:152727446-152727468 CACCACGTTGACAGGAAGTATGG - Intergenic
1035924793 8:3715924-3715946 CATCATGTCCACAGGGAGTAGGG - Intronic
1036212736 8:6855300-6855322 CAGCATTGTGAGATGGAGCATGG - Intergenic
1036637913 8:10564325-10564347 CAGCCTGTTGACAAGTAGCAAGG - Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1039331030 8:36536742-36536764 AAACATGTTAACAGGAAGCAGGG + Intergenic
1042920539 8:73915043-73915065 CCGCAGGTTGGGAGGGAGCAAGG + Intergenic
1044716290 8:95102749-95102771 CAGTGTGTTCACTGGGAGCATGG - Intronic
1044895103 8:96883330-96883352 AAGCATCTTGACAGAGAGAAGGG - Intronic
1048956287 8:139539274-139539296 CACCTTGTTGGCTGGGAGCATGG - Intergenic
1048959261 8:139562308-139562330 GAGCCTGTTGACAGGTACCAGGG + Intergenic
1049692067 8:143965845-143965867 CTGCATGGTCACAGGGGGCATGG - Intronic
1049894737 9:102634-102656 AAGTATGTTCACAGGGAGCATGG - Intergenic
1050390152 9:5134224-5134246 CTGAAAGTTGACAGGGAGAATGG + Intronic
1053461908 9:38277946-38277968 CAGCAAGTTGAGATGGAGCCCGG - Intergenic
1053780581 9:41602110-41602132 CAGAATACTGACACGGAGCATGG + Intergenic
1054156707 9:61645739-61645761 CAGCCTGTTCCCAGGCAGCACGG + Intergenic
1054168524 9:61812267-61812289 CAGAATACTGACACGGAGCATGG + Intergenic
1054176716 9:61880368-61880390 CAGCCTGTTCCCAGGCAGCACGG - Intergenic
1054476479 9:65576748-65576770 CAGCCTGTTCCCAGGCAGCACGG + Intergenic
1054660819 9:67700438-67700460 CAGCCTGTTCCCAGGCAGCACGG + Intergenic
1054669006 9:67768551-67768573 CAGAATACTGACACGGAGCATGG - Intergenic
1055362730 9:75511568-75511590 CAACAAGGTGAAAGGGAGCAAGG - Intergenic
1057114614 9:92508366-92508388 CAGAGTGTTGACAGGAAGCCAGG - Intronic
1058266872 9:102911303-102911325 AAGCCTGTTGACTGGGGGCAGGG + Intergenic
1058770118 9:108222848-108222870 CAGCATGTGCACAGGTGGCATGG - Intergenic
1059090797 9:111355799-111355821 CAAGATGTTGACAGTGGGCAAGG - Intergenic
1060477287 9:123996407-123996429 CACCATTTTGAGAGGCAGCAAGG - Intergenic
1061959220 9:133979528-133979550 GAGGATGTTGACAGGGAGGGAGG + Intronic
1062208138 9:135348493-135348515 CACCTTGTTGACTGGGAGCCGGG - Intergenic
1062386595 9:136314304-136314326 CAGCAGGAGGGCAGGGAGCAGGG - Intergenic
1062675585 9:137741481-137741503 CAGTATGTAGACAGTGGGCATGG + Intronic
1186862972 X:13691305-13691327 CATCATTTTAACAGTGAGCAGGG + Intronic
1188003630 X:25003191-25003213 CGGCATGTTCGCAGGGAGGAGGG - Intergenic
1190256430 X:48766225-48766247 CAGCATGTTGACACTTAACATGG + Intronic
1192620283 X:72672356-72672378 CAGCATGATGAACGGGAGCCAGG - Intronic
1192868426 X:75161335-75161357 TGGCATGGTGACAAGGAGCATGG - Intergenic
1194807194 X:98344454-98344476 GAGCATGTTGTCCGGGAGCCTGG - Intergenic
1197681188 X:129387011-129387033 TAGCATCTTTAGAGGGAGCATGG + Intergenic
1198219410 X:134585961-134585983 CAGCATGTTGAGGGGAAGAAGGG - Intronic
1199207928 X:145170966-145170988 CAGCTTATAGAGAGGGAGCAAGG + Intergenic
1200213269 X:154356307-154356329 CAGAATGGAGACAGGGAGCCCGG - Intronic
1200384367 X:155874904-155874926 CAAGATGGGGACAGGGAGCATGG - Intergenic
1201586700 Y:15569006-15569028 CAGCATGTTGAAAGAGAGCAAGG - Intergenic