ID: 1029853092

View in Genome Browser
Species Human (GRCh38)
Location 7:103485048-103485070
Sequence CAGAGTACCTAATTTAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029853090_1029853092 24 Left 1029853090 7:103485001-103485023 CCTTTTAGGCATGGGAAATAAAT 0: 1
1: 0
2: 4
3: 27
4: 284
Right 1029853092 7:103485048-103485070 CAGAGTACCTAATTTAAAGTAGG 0: 1
1: 0
2: 1
3: 21
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029853092 Original CRISPR CAGAGTACCTAATTTAAAGT AGG Intronic
906740446 1:48177755-48177777 CAGAGTGTCTAATGTAAACTTGG + Intergenic
907004869 1:50902007-50902029 CAAAGTACCTAATTTTCATTAGG + Intronic
907176798 1:52531549-52531571 CACAGTGCCTAATACAAAGTAGG + Intronic
908778205 1:67662387-67662409 CAGAGTATCTAACTTACAGTTGG + Intergenic
908806794 1:67940085-67940107 CAGAGTTTCTAGTTTAAAGCTGG + Intergenic
908863427 1:68517381-68517403 CATAGTACCTAGTATAAAGTAGG - Intergenic
909347452 1:74608374-74608396 CAGAGAACTGAATTTATAGTGGG + Intronic
909394209 1:75151337-75151359 CAGAGTGCCAAATTTTAAGAAGG + Intronic
909943605 1:81638163-81638185 CAGGGTACAGAATTCAAAGTTGG - Intronic
910146751 1:84088763-84088785 CATAGTGCCTGGTTTAAAGTAGG - Intronic
910277149 1:85461998-85462020 CATAATTCCTATTTTAAAGTTGG - Intronic
911570100 1:99510097-99510119 CTGCGTACCTGATTTAAAATTGG - Intergenic
912074947 1:105862322-105862344 AAGACAACCTAATTTGAAGTTGG - Intergenic
912592566 1:110840144-110840166 AAGACAACCTAATTTAAAGCTGG + Intergenic
915199782 1:154218894-154218916 CTTATTACCTATTTTAAAGTAGG - Intronic
916955551 1:169830054-169830076 CACAGTACTTAATGTATAGTAGG + Intronic
918180310 1:182081558-182081580 CACAGCACCTGATTTAAAGAGGG - Intergenic
919102808 1:193114469-193114491 GAGAGTATTTAATTTAACGTAGG + Intergenic
921345874 1:214184710-214184732 CAGAGACCTTAACTTAAAGTGGG + Intergenic
922456670 1:225778955-225778977 CACAGAACCTAATTTAACTTGGG - Intronic
923673174 1:236058518-236058540 CAGAGCACCTAACTTATAATGGG + Intronic
1064818966 10:19301924-19301946 CAGATAACCTACTTTAAAATAGG + Intronic
1067254319 10:44620563-44620585 CAGAGTACGTAATTCTAGGTTGG - Intergenic
1068448483 10:57154681-57154703 AAGAATATCTAATTGAAAGTGGG - Intergenic
1069356506 10:67592664-67592686 CTGAGTAAATAATTTTAAGTTGG - Intronic
1070697474 10:78573657-78573679 CAGAGTACCATCTTTAGAGTAGG - Intergenic
1072099940 10:92219663-92219685 CAGAGTAGCTATTTTAAGGTAGG - Intronic
1073882287 10:107996946-107996968 CACAATACCTAATCTGAAGTTGG - Intergenic
1074146632 10:110722429-110722451 CAGAGTCCGTAGTTTACAGTGGG + Intronic
1075770667 10:124931841-124931863 CAAAGTACATAATTTACAGTAGG + Intergenic
1077866831 11:6229365-6229387 CAGAGTACCTTCTTTATGGTTGG - Intronic
1080994560 11:37582914-37582936 CAGCTTACCTGATTTAAATTTGG + Intergenic
1085430478 11:76444087-76444109 CAAAGTACAAAATTTAAAGAGGG + Intergenic
1085703965 11:78769552-78769574 CAGAGTTCTTATTTTAGAGTTGG - Intronic
1085899018 11:80675538-80675560 AAAAGTACCCAATTTAAAATGGG - Intergenic
1087744919 11:101932729-101932751 CTGTTTACCTTATTTAAAGTGGG + Intronic
1090648143 11:128782921-128782943 CATAGTACCTGGTTTAAAGGAGG + Intronic
1090779315 11:129993122-129993144 CTGTATACCTAAATTAAAGTTGG - Intronic
1093176863 12:15922625-15922647 CAGGATACCTAATTTCAACTTGG - Intronic
1093563287 12:20569967-20569989 CTGAGTACATAATTTCAAGAAGG + Intronic
1093606021 12:21088657-21088679 CAGGGTACATAATTGTAAGTTGG + Intronic
1093616969 12:21237357-21237379 CAGAGTACAGAATTTTAAGTTGG + Intronic
1094123474 12:26998386-26998408 CAGAGTACATAATTTAAATAAGG - Intronic
1094396418 12:30011334-30011356 CTGAGTGCCTATTTTAGAGTAGG + Intergenic
1099903269 12:88738882-88738904 CAGAATACCTAATCTAGACTTGG + Intergenic
1103421114 12:120783918-120783940 AAAAGTACCTGATTTGAAGTAGG + Intronic
1104654649 12:130564816-130564838 CAGAGTACCTTATTAACTGTAGG - Intronic
1107374703 13:39789670-39789692 CCGATTAGCTAATTTAAAGAGGG - Intronic
1107672723 13:42762653-42762675 CAGAGTAAATAATATAAAGAAGG + Intergenic
1107943121 13:45392340-45392362 CAGAGTCCATAGTTTACAGTAGG - Intergenic
1108125976 13:47243193-47243215 CAGAGTCCCTAGTTTACATTAGG + Intergenic
1110299849 13:73913665-73913687 CAAAGTAACAAATTTAAACTTGG + Intronic
1110931519 13:81224227-81224249 AAAAGTATTTAATTTAAAGTGGG + Intergenic
1111818841 13:93189515-93189537 AACAGTACCTAATATAGAGTAGG - Intergenic
1112079721 13:95956472-95956494 CAAAGAACCCAATTTAAAATGGG + Intronic
1115424892 14:33246615-33246637 AAGAGTATCTACTTTGAAGTTGG + Intronic
1115844403 14:37510658-37510680 CAGAGTACTTACTTTACAGCAGG - Intronic
1116615543 14:47132638-47132660 CAGGGGACCTAATTTGAATTGGG - Intronic
1116678101 14:47931535-47931557 CAGAGTAAGTAGTTTAAATTGGG - Intergenic
1118099549 14:62581192-62581214 CAGAGATCCAACTTTAAAGTGGG - Intergenic
1120032234 14:79655127-79655149 TAAAGTAACTAATTTAGAGTTGG + Intronic
1120661150 14:87252651-87252673 AATAGTACCTAATTTATTGTGGG - Intergenic
1120961098 14:90125719-90125741 CAGAATAAGTAAATTAAAGTTGG + Intronic
1125866647 15:43057040-43057062 TAAAGTATCTAACTTAAAGTAGG - Intronic
1126368691 15:47922794-47922816 CAGACCATCTAATTTAGAGTTGG + Intergenic
1128708136 15:69852199-69852221 CAGAGTACCTACTGTAAGGTTGG - Intergenic
1128929947 15:71695263-71695285 TAAAGGACCTAATTTAAAATGGG - Intronic
1129081516 15:73045218-73045240 CTGAGTAACTAGTTTGAAGTGGG + Intergenic
1129601069 15:76998571-76998593 CACAGTACCTGATATACAGTTGG + Intronic
1130142512 15:81240285-81240307 TATAGTCTCTAATTTAAAGTAGG - Intronic
1135463193 16:22662810-22662832 CAGACTACCTAATTTTAAAAAGG - Intergenic
1135778204 16:25275710-25275732 CAAAGTCCCTAATTTACATTAGG - Intergenic
1139104303 16:63808036-63808058 CACAGTACCTAGTTCATAGTGGG - Intergenic
1139274309 16:65713389-65713411 CAGAGTTCATAAATGAAAGTGGG + Intergenic
1141106083 16:81234914-81234936 CAGAGTAAGTACTTTGAAGTCGG + Intergenic
1142857630 17:2740706-2740728 CAGAGGACCTAGTTTAAAAATGG + Intergenic
1149269615 17:54963530-54963552 CATAATACCTAATCTAATGTAGG + Intronic
1151071088 17:71212308-71212330 TAGAGTACCTAATTCTAAGTTGG - Intergenic
1152968698 18:140836-140858 CAGAGTTCATAGTTTAAATTAGG - Intergenic
1153166751 18:2270218-2270240 CAGAGAACCAAAGTTAATGTGGG - Intergenic
1153687924 18:7565542-7565564 CAGAGTAACTTCTTTAAATTAGG - Intergenic
1155186098 18:23387906-23387928 GAGATTACATATTTTAAAGTTGG + Intronic
1155981108 18:32180700-32180722 CAGAGTTCATAATTTACATTAGG + Intronic
1158090302 18:53703401-53703423 CAGAGTACCCAATTGAAAAATGG - Intergenic
1159156976 18:64596778-64596800 CAGATTACCTCATTTAAGGTTGG + Intergenic
1160001104 18:75023778-75023800 AATAGAACCTACTTTAAAGTGGG + Intronic
1163159293 19:15455245-15455267 CAGAGTACAAGATATAAAGTAGG + Intronic
925777834 2:7352282-7352304 GAGAGAACCTATTTGAAAGTGGG - Intergenic
925793485 2:7518034-7518056 CAGGGTAACTGATTTAATGTGGG + Intergenic
927350843 2:22112399-22112421 CAGATAACCTAATTTAAAAATGG + Intergenic
927700584 2:25265888-25265910 CATAGTGCCTGATGTAAAGTAGG + Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930664962 2:54092709-54092731 CAGGGTAGCTAATTTCAAATGGG + Intronic
931487582 2:62708311-62708333 CACAGTACCTGGTATAAAGTAGG - Intronic
932205594 2:69878697-69878719 AAGAGTACCTGACTTAAAGGAGG - Intronic
936754075 2:115683476-115683498 CAGAGTCCATAATTTACACTAGG - Intronic
937100137 2:119262161-119262183 CAGAGTAAATAATTTACAGATGG - Intronic
939138865 2:138329398-138329420 CAGAGTACATAGTTTACATTAGG - Intergenic
939649004 2:144739199-144739221 CAGAGTCCCTTATTGAGAGTGGG + Intergenic
940193580 2:151068110-151068132 CACAGTACCTATTAAAAAGTAGG - Intergenic
940359765 2:152784876-152784898 CAGAAGACCTAATGTAAAATAGG - Intergenic
941630948 2:167883559-167883581 CACAGGAACTAATTTCAAGTGGG - Intergenic
942690505 2:178580026-178580048 CAGAGTAGCTAATTTGGAGGAGG - Exonic
945444742 2:209922972-209922994 CAAATTGCCCAATTTAAAGTGGG - Intronic
945679745 2:212899427-212899449 CAGAATACATAATTTATTGTAGG + Intergenic
946039830 2:216773975-216773997 CCAAGCACCTAATCTAAAGTGGG - Intergenic
946595534 2:221301972-221301994 CAGAGTAACTAATACAAAGGAGG - Intergenic
947415992 2:229896950-229896972 CAGAGTCCCTAGTTTACATTAGG - Intronic
1170193687 20:13669040-13669062 CAGAGTACAGAATTTTAGGTTGG + Intergenic
1172355765 20:34278566-34278588 CAGAGTTCCTGATCTAATGTTGG + Intergenic
1174492899 20:50914906-50914928 CAGTGGACCAAATTTTAAGTTGG + Intronic
1174996972 20:55580981-55581003 CAGAGTACTTAATATAAATTTGG + Intergenic
1177775334 21:25560951-25560973 CATAGTACTTAATTTACAGATGG - Intergenic
1178150762 21:29790986-29791008 CAGACCACCCAATTTAAAGTTGG - Intronic
1178553607 21:33565232-33565254 ATGAGTAGCTAATTTATAGTTGG + Intronic
1178675748 21:34630504-34630526 CAAACCACCTGATTTAAAGTGGG + Intergenic
1179947904 21:44690998-44691020 CAGCTTCTCTAATTTAAAGTGGG + Intronic
1180666361 22:17515979-17516001 CAAAGTAACTAATTTAAGGCTGG - Intronic
1184614036 22:45625776-45625798 AAGAGGACCTGATTTAAATTGGG - Intergenic
949734308 3:7153741-7153763 CAGAGTACCTTCTTTATAGCAGG + Intronic
950061392 3:10074344-10074366 CAGAGCACCTAATTTAAGATGGG - Intronic
950302931 3:11897756-11897778 CAGAGCACCTAATTTAAGATGGG - Intergenic
951828119 3:26891330-26891352 TTGAGTACCTTATTTGAAGTAGG + Intergenic
953803168 3:46044405-46044427 CTGACAACCTAATTAAAAGTGGG - Intergenic
953865364 3:46578836-46578858 ATAAGTACCTAATTTTAAGTAGG - Intronic
954486018 3:50851804-50851826 CAGAGTACCTGTTCTGAAGTAGG - Intronic
955883950 3:63577665-63577687 CTGAGTAAATTATTTAAAGTTGG + Intronic
956455111 3:69413096-69413118 CACAGTGCCTAATGTATAGTAGG + Intronic
956573262 3:70720741-70720763 CAGAGTACCACATTAAAAGCAGG - Intergenic
956771413 3:72529211-72529233 CAGAGTCCATAGTTTACAGTGGG - Intergenic
957296018 3:78333481-78333503 CAAAGTACATAGTTTAAATTAGG + Intergenic
957335577 3:78823795-78823817 CTGATTACCAAATTTAAAATAGG + Intronic
958558535 3:95711017-95711039 CAGAGTCCATAGTTTACAGTAGG - Intergenic
962360525 3:134738801-134738823 CATATAACCTAATTTAAAATGGG + Intronic
963073538 3:141325390-141325412 CAGTGTATGTCATTTAAAGTTGG - Intronic
966857933 3:184208429-184208451 AACAGTCCCTAATTTGAAGTGGG - Intronic
970382465 4:15521887-15521909 CAGAGTGCCAAATCAAAAGTTGG + Intronic
971738155 4:30484376-30484398 CAGATAACCCAATTTAAAATTGG - Intergenic
973550951 4:52035688-52035710 AAGAGGACCTAAACTAAAGTGGG + Intronic
974217009 4:58861199-58861221 CAAAATAGCTAATTCAAAGTAGG + Intergenic
974675414 4:65081536-65081558 GAGACTCCCTAATTTAAATTAGG - Intergenic
976705644 4:88016228-88016250 CAGAGTACATCATCTAAAGCAGG - Intronic
977934605 4:102786759-102786781 CAGAGTCCCTCCTTTAACGTGGG - Intergenic
978167208 4:105623752-105623774 CAGAGTTACTAATATAAATTGGG - Intronic
979513379 4:121579488-121579510 AAGAGTAGATATTTTAAAGTGGG + Intergenic
979707659 4:123739592-123739614 CAGGGTACAAATTTTAAAGTGGG - Intergenic
980732524 4:136841216-136841238 CAGAGTACCTTTTTTGAAGAAGG + Intergenic
984641154 4:182165604-182165626 CAGAGTTCCTGATGGAAAGTTGG - Intronic
984695129 4:182771346-182771368 CACAGTGCCTGATTTAAAGCTGG - Intronic
986060293 5:4182633-4182655 CGTGGTACCTAATTTAATGTTGG + Intergenic
986331877 5:6722678-6722700 CCGTGTAACTCATTTAAAGTTGG + Intronic
986941022 5:12949507-12949529 CAGAATACAGAATTTTAAGTTGG - Intergenic
989215627 5:38901805-38901827 CAAAGAACCTCATTTAAAATTGG + Intronic
989740911 5:44770785-44770807 AAAATTGCCTAATTTAAAGTTGG + Intergenic
990035834 5:51318426-51318448 CAGAGTACCTAACTTTAGGTTGG + Intergenic
990972246 5:61521248-61521270 CAGAGCACCTAATTTAAAGGAGG - Exonic
991382767 5:66049161-66049183 CACAGTACCTTATGTATAGTAGG + Intronic
991445700 5:66698108-66698130 CAGACTACATACTCTAAAGTGGG - Intronic
991629357 5:68639502-68639524 CAGAGTCCATAATTTACATTAGG + Intergenic
992857830 5:80881363-80881385 CAGAGTTCGTAATTTACATTGGG + Intergenic
992883046 5:81129829-81129851 CAGATTTCCTAATTTAAATATGG + Intronic
993022132 5:82604908-82604930 CAGAGTATGTAATTTTAGGTTGG - Intergenic
994044495 5:95292737-95292759 CAGAGTCCCTAGTTTACATTGGG - Intergenic
995443401 5:112216836-112216858 CATAGTACCTAGTCTAAAGTTGG - Intronic
996583870 5:125063045-125063067 AAGACAACCTAATTTAAAATGGG + Intergenic
997144151 5:131413728-131413750 CAGAAAACCCAATTTAAAATGGG - Intergenic
997863369 5:137439657-137439679 TGGGGTACCTCATTTAAAGTAGG + Intronic
1000022487 5:157330528-157330550 CAGAGTTTCTAAGTTAAAGATGG - Intronic
1000903374 5:166935259-166935281 AAGAATACCTAATTTACAATAGG - Intergenic
1005238757 6:23798536-23798558 CATATTACATAATTTACAGTAGG - Intergenic
1009538066 6:64916210-64916232 CTGAGTACATAATTTCAACTTGG + Intronic
1009812343 6:68684558-68684580 AAGAGGGCCTAATTAAAAGTAGG - Intronic
1011027339 6:82883741-82883763 CATAGTCCCAAACTTAAAGTTGG + Intergenic
1011078455 6:83463370-83463392 AAAAGTTCCTAATTTATAGTAGG - Intergenic
1011718731 6:90133410-90133432 AAGATTACCTGATTTAACGTAGG - Intronic
1012545458 6:100413997-100414019 CAGAGTGCCTTATTTCAAATAGG - Intronic
1014411004 6:121120765-121120787 CATAATACCTAATTTAAAAGAGG + Intronic
1015441397 6:133250989-133251011 CACAGTATCTAATTTATACTTGG - Intronic
1017073071 6:150593706-150593728 CAGAGCACGTAATGTAGAGTTGG + Intergenic
1017675454 6:156809112-156809134 CAGAGTAAGTAACGTAAAGTAGG - Intronic
1018078015 6:160233480-160233502 CAGAGTCCTTTTTTTAAAGTTGG - Intronic
1020824803 7:13013436-13013458 CAGTGTAGCTAGTATAAAGTTGG - Intergenic
1022118698 7:27285953-27285975 CAGACTACACTATTTAAAGTAGG - Intergenic
1024381555 7:48702767-48702789 CTGAGCACCTAACTTAAATTAGG + Intergenic
1027837970 7:83270317-83270339 CAGACCACCCAATCTAAAGTGGG - Intergenic
1027978949 7:85192565-85192587 CAAAGTGCCCAATTTAACGTCGG + Intergenic
1028096020 7:86762017-86762039 CAGAATAGCTAATTAAAAGAAGG - Intronic
1029853092 7:103485048-103485070 CAGAGTACCTAATTTAAAGTAGG + Intronic
1030311391 7:108072732-108072754 CACAGTGTCTAATTTATAGTAGG + Intronic
1030767364 7:113427664-113427686 CAGACAACTTAATTTAAAATAGG + Intergenic
1031113645 7:117642819-117642841 CAGAAGACCAAATTTACAGTGGG + Intronic
1032588637 7:133171748-133171770 TAGAGTAAATTATTTAAAGTAGG - Intergenic
1033800593 7:144897423-144897445 CAGTATACCTGACTTAAAGTAGG - Intergenic
1036064809 8:5368015-5368037 CAGAGTACCTAGTTTACATTAGG - Intergenic
1037234245 8:16697748-16697770 CAGAGTCCATAATTTACATTAGG - Intergenic
1037548334 8:19945532-19945554 CAGAGTATGTAATGAAAAGTAGG - Intronic
1038599086 8:28920280-28920302 CATAGTACCTTGTTTATAGTAGG - Intronic
1040719498 8:50300506-50300528 CAAAGTACTTAAGTTAAAATTGG + Intronic
1042677459 8:71337696-71337718 TAAAGTACCTGATATAAAGTAGG + Intronic
1043378509 8:79677272-79677294 CAGAGTGCCTAGTTTATAGCAGG + Intergenic
1044439893 8:92210627-92210649 CTGAGTTCCTAAATTAATGTGGG - Intergenic
1050225909 9:3455112-3455134 AAGAGTACCTGATTTAAATTTGG - Intronic
1050438488 9:5634538-5634560 CAGATAACCTAATTTAAAAATGG - Intronic
1050973244 9:11904939-11904961 CACAGTATCTATTTTGAAGTGGG + Intergenic
1052332403 9:27283090-27283112 CTGAGTACCTACTTTATAATAGG - Intergenic
1053407395 9:37889290-37889312 CAGAGGACCTAGTTCATAGTAGG - Intronic
1053448694 9:38174003-38174025 CAGAGTTCCTTATTTAAAAAGGG - Intergenic
1055895680 9:81172588-81172610 CAAACAACCTAATTAAAAGTGGG - Intergenic
1056490862 9:87105636-87105658 CACAGTGCCTGGTTTAAAGTAGG - Intergenic
1057186461 9:93059917-93059939 CAGAGTCCCTAATTTGGTGTTGG + Intronic
1058031661 9:100205813-100205835 CACAGTGCCTCATTTATAGTAGG - Intronic
1058393044 9:104519360-104519382 CAGATTACCTTATGTAATGTGGG - Intergenic
1058688265 9:107497422-107497444 CAAAGTACATAATTTCAAATTGG - Intergenic
1059218133 9:112585958-112585980 CAAAGTACCTAATCTGAACTTGG - Intronic
1060679546 9:125549425-125549447 CAGAGGACTTATTTTAAAGCAGG - Intronic
1186195234 X:7104513-7104535 CATTTTACCTATTTTAAAGTGGG - Intronic
1186863785 X:13699168-13699190 AATAGTACTTATTTTAAAGTGGG + Intronic
1188436030 X:30159607-30159629 CAGAGTGCCTCATTTAAAATAGG - Intergenic
1190357500 X:49619306-49619328 AAGAGAACATAATGTAAAGTGGG + Intergenic
1193233874 X:79082612-79082634 CAGAGTACCTAATTTGGGCTAGG - Intergenic
1194359561 X:92932677-92932699 CAGAGTACATAGTTTAAATTAGG - Intergenic
1195925511 X:110020713-110020735 TAGAGTAAATATTTTAAAGTGGG - Intronic
1196405395 X:115356946-115356968 CAGAGTACATGAATCAAAGTGGG - Intergenic
1197006148 X:121501077-121501099 AAGAGTACCTCATTTAACGTGGG - Intergenic
1197530850 X:127624097-127624119 AAGAATGCATAATTTAAAGTTGG - Intergenic
1198959111 X:142165223-142165245 TAGAAAACCCAATTTAAAGTAGG - Intergenic
1199236270 X:145498020-145498042 CACAGTACCTGATTTTAAATAGG + Intergenic
1200667761 Y:6048509-6048531 CAGAGTACATAGTTTAAATTAGG - Intergenic