ID: 1029854696

View in Genome Browser
Species Human (GRCh38)
Location 7:103503735-103503757
Sequence GACACTGCTGTTAATACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029854692_1029854696 6 Left 1029854692 7:103503706-103503728 CCCTTCGTTGATGGTGATAGCCA 0: 1
1: 0
2: 0
3: 0
4: 48
Right 1029854696 7:103503735-103503757 GACACTGCTGTTAATACAGTGGG No data
1029854693_1029854696 5 Left 1029854693 7:103503707-103503729 CCTTCGTTGATGGTGATAGCCAT 0: 1
1: 0
2: 1
3: 1
4: 48
Right 1029854696 7:103503735-103503757 GACACTGCTGTTAATACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029854696 Original CRISPR GACACTGCTGTTAATACAGT GGG Intronic
No off target data available for this crispr