ID: 1029860077

View in Genome Browser
Species Human (GRCh38)
Location 7:103561689-103561711
Sequence AGGTGTGACCGGGGCTTTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029860077_1029860083 -10 Left 1029860077 7:103561689-103561711 CCACCAAAGCCCCGGTCACACCT 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1029860083 7:103561702-103561724 GGTCACACCTAAGAAAGAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 262
1029860077_1029860084 -5 Left 1029860077 7:103561689-103561711 CCACCAAAGCCCCGGTCACACCT 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1029860084 7:103561707-103561729 CACCTAAGAAAGAGAGGGAGTGG 0: 1
1: 0
2: 4
3: 50
4: 1144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029860077 Original CRISPR AGGTGTGACCGGGGCTTTGG TGG (reversed) Exonic
905052184 1:35061088-35061110 AGGTGTGTCCTGGCTTTTGGGGG - Intronic
905245733 1:36612022-36612044 AGGTGAGAATGGGGCTGTGGGGG + Intergenic
905488745 1:38327205-38327227 AGGTGGGACTGAGGCCTTGGAGG + Intergenic
906157112 1:43620237-43620259 AGGTATGACAGGGGCCCTGGGGG - Intronic
916515553 1:165513169-165513191 AGGGGTCACCGGGGCTGTGAGGG + Intergenic
917522605 1:175760609-175760631 AGGTGTGAGCCGGGCGTTAGTGG - Intergenic
918151013 1:181798379-181798401 AGGAGGGGCCGGGGCTTTGGCGG - Exonic
919925262 1:202188788-202188810 AGGGGTGTCCGGGGATGTGGCGG - Intergenic
920388466 1:205584099-205584121 AGGTGTGACTGAAACTTTGGGGG - Exonic
1063078315 10:2739058-2739080 ATGTGTGATGGGGGCATTGGTGG + Intergenic
1064142997 10:12806042-12806064 ACCTGTGCACGGGGCTTTGGGGG + Intronic
1066489056 10:35876378-35876400 AGATGTGAGCGGGACCTTGGCGG + Intergenic
1067291626 10:44947802-44947824 AGCTGAGCCCGGGGCTTTGAGGG - Intergenic
1070734113 10:78851854-78851876 AGATGTGTGCTGGGCTTTGGTGG + Intergenic
1073058805 10:100720324-100720346 AGGTGTGACAGGGCATTTTGGGG + Intergenic
1074687732 10:115975350-115975372 GGGTGTCTCCAGGGCTTTGGGGG - Intergenic
1077015625 11:397944-397966 AGGTGTGTGCGGGGGTATGGAGG - Intronic
1080243639 11:30155427-30155449 TGGCGTGACCTGGGCTTTGAAGG - Intergenic
1081997719 11:47375911-47375933 AGGGGTGACAGGGACCTTGGGGG + Intronic
1083611341 11:64005849-64005871 AGGTGTGAGCTGGGGTTTGAGGG + Intronic
1083995445 11:66269323-66269345 GGGTGTGACGGTGGCGTTGGGGG - Intronic
1084463131 11:69307346-69307368 AGGTGAGGGCGGGGCTTTGCTGG + Intronic
1084486165 11:69449562-69449584 AAGTGTCACCGGGGCCCTGGGGG + Intergenic
1084497740 11:69514797-69514819 CAGTGTGACTGGGGCTTTGGTGG + Intergenic
1085624747 11:78063484-78063506 AGGAGTGAACTGTGCTTTGGAGG + Intronic
1088162328 11:106887578-106887600 AGGTCTCAGCAGGGCTTTGGTGG - Intronic
1088727638 11:112653694-112653716 AGGTCTGAATAGGGCTTTGGGGG - Intergenic
1088833606 11:113558906-113558928 AGCTGTTACCAGGGCTGTGGAGG - Intergenic
1095961657 12:47838681-47838703 GGATGTGATTGGGGCTTTGGGGG + Intergenic
1104997077 12:132664781-132664803 AGGTGAGAATGGGGCTTGGGAGG - Intronic
1105502227 13:20982659-20982681 AGGTGTCACGGGGCCTTTGTGGG - Intronic
1106587441 13:31069710-31069732 AGGTGGGATCCTGGCTTTGGGGG - Intergenic
1111354270 13:87079181-87079203 AGGTGTGCCGGCGGCTGTGGTGG + Intergenic
1112369854 13:98784952-98784974 AGGTCTGCCCGGGGCTGTGTGGG + Intergenic
1113782807 13:112986444-112986466 AGGTGTGAATGGGGCGGTGGTGG - Intronic
1114617144 14:24074387-24074409 AGGAGTGACAGGGGAGTTGGGGG - Intronic
1115827472 14:37293740-37293762 AGGTGGCAGCGAGGCTTTGGTGG + Intronic
1119989810 14:79183703-79183725 AGCAGTGAGCCGGGCTTTGGCGG - Intronic
1121842158 14:97143764-97143786 AGCTTTGACAGGGGTTTTGGAGG + Intergenic
1121918315 14:97856437-97856459 AGGTGTGAACAAGGCTTTCGGGG - Intergenic
1122136900 14:99638593-99638615 AGGTGAGACCAGGCCTTTGCTGG - Intergenic
1122255848 14:100475606-100475628 AGGTGTTACCAGGGGTTTGGGGG + Intronic
1126352558 15:47759633-47759655 TGGTGGGAGAGGGGCTTTGGAGG + Intronic
1128478047 15:68014082-68014104 AGGTGTGGCCTGGGCTTTGTGGG - Intergenic
1130060517 15:80566556-80566578 AGGTGGGAGGGGAGCTTTGGTGG - Intronic
1132363147 15:101235107-101235129 AGGTGTGTCCGGAGGTTTGCAGG - Exonic
1133617697 16:7493728-7493750 AGGTGTCACCAGGGCTCTGGAGG - Intronic
1133750484 16:8721410-8721432 AGGTGTGACCTGGGCACCGGGGG - Intronic
1142670254 17:1484804-1484826 ACGTGTGACAGGTGCTTTGGAGG + Intronic
1145788764 17:27611251-27611273 AGGTTTGACCGGAGCCTTGGTGG - Intronic
1147157555 17:38551922-38551944 AGGAGTGTCCAGGCCTTTGGTGG + Exonic
1147396317 17:40145543-40145565 AGGTGTGACTGGAGCATTGTTGG + Intronic
1147493701 17:40895760-40895782 AGGTGTGATCTGGGCTTGGATGG + Intergenic
1147560811 17:41507808-41507830 TTGTGTTACTGGGGCTTTGGAGG - Intergenic
1151828801 17:76537948-76537970 AGGTGTGGCCGGGGCGCTGGGGG + Intronic
1152444772 17:80335366-80335388 AGGTGTGCTCGGGGGTCTGGGGG + Intronic
1152876558 17:82789820-82789842 AGGTGTGACCTGGGACTTGCGGG - Intronic
1154277160 18:12972067-12972089 AGGTGTGACAAGTGTTTTGGAGG + Intronic
1155202607 18:23530456-23530478 AGGTTTATCCGGGGCATTGGTGG + Exonic
1155279981 18:24229512-24229534 TGGTGTGACCAAGGCTTTGAAGG - Intronic
1157330587 18:46701024-46701046 AGCTGTGACAGGGGCTGTTGTGG + Intronic
1158518146 18:58147886-58147908 AGCAGTCACTGGGGCTTTGGGGG - Intronic
1159936112 18:74368942-74368964 AGGGGTGACCGAGGCTTTGAGGG + Intergenic
1160710355 19:548578-548600 AGGTGAGACCGGGGCTGTCCAGG - Exonic
1162726784 19:12694778-12694800 AGGTGAGACGGGGTCTGTGGGGG - Exonic
1162732479 19:12727142-12727164 AGGTGTGACTTTGGCCTTGGGGG - Intergenic
1163762744 19:19146218-19146240 AGCAGCGGCCGGGGCTTTGGAGG + Intronic
1163830959 19:19546971-19546993 AGGTGTGGCCGGGGTTCAGGTGG - Intergenic
1167122917 19:47529600-47529622 AGGTGTGTCCGTGGCTTGTGGGG + Exonic
1167679415 19:50909947-50909969 AGGTGGGACCAGGGCTTCTGGGG + Intronic
926606483 2:14903831-14903853 AGGTGTGACAGGGGGATGGGGGG - Intergenic
928669464 2:33585903-33585925 AGGAGTGACAGGGACTGTGGGGG + Intronic
930017551 2:46981433-46981455 AGGCTTGATCTGGGCTTTGGTGG + Intronic
933200774 2:79445735-79445757 AGTTGTGAAAGGGGCTATGGGGG - Intronic
935736674 2:106111922-106111944 AGGAGTGACCGGGGAGCTGGGGG + Intronic
940323425 2:152400703-152400725 AGGTGTGTCCTGTGCTTTGTAGG + Intronic
940959841 2:159772985-159773007 AGGTGTGAGGGTGGATTTGGTGG + Intronic
948685406 2:239666710-239666732 AGGAGTGTCTGGGTCTTTGGTGG - Intergenic
1169354763 20:4897257-4897279 AGGTGTGCTGGGGACTTTGGTGG - Intronic
1169355345 20:4900741-4900763 AGGTGTGGCGGGGGGTTGGGGGG - Intronic
1172175481 20:32969691-32969713 AGGGGTGACCGGGTATTTGAGGG - Intergenic
1174346977 20:49937230-49937252 GGCTGTGGCCGGGGCTTTCGAGG + Intronic
1175005944 20:55683455-55683477 AGGCGGGACCTGGGCTGTGGAGG + Intergenic
1175908532 20:62393555-62393577 GTGTGTGACCAGGGCGTTGGTGG + Exonic
1176024273 20:62977923-62977945 AGGAGGGACCGAGGCTGTGGAGG + Intergenic
1176386126 21:6139322-6139344 GGGTGTGAGGGGTGCTTTGGGGG - Intergenic
1179152158 21:38818286-38818308 AGTGGAGACCCGGGCTTTGGTGG - Intronic
1179737347 21:43398930-43398952 GGGTGTGAGGGGTGCTTTGGGGG + Intergenic
1180905139 22:19405149-19405171 TGGTGTGAATGGGGATTTGGAGG - Intronic
1181052299 22:20243616-20243638 AAGTGTGTCCAGGGCTTAGGAGG + Intronic
1181441569 22:22938652-22938674 AGGTGTGACCTTAGCATTGGAGG + Intergenic
1182353283 22:29710728-29710750 AGGTGAGGCCAGGGCTCTGGTGG + Intergenic
1183381663 22:37493299-37493321 AGGTGTGACCTAGGCTCTGAAGG - Intronic
953226237 3:41024206-41024228 AGGTGGGTCTGGGGCTTTGCAGG + Intergenic
953694356 3:45146185-45146207 AGGTGAGTGCCGGGCTTTGGAGG - Exonic
954108174 3:48420174-48420196 AGGGGTGGCCAGGGCTTTGGGGG + Exonic
957132435 3:76239928-76239950 AGGTGTAAATGGGGCTTTGCAGG + Intronic
962799710 3:138879763-138879785 AGGTGTGGCCGGGACCTGGGAGG + Intergenic
966715903 3:183012664-183012686 ATGTCTGAACTGGGCTTTGGAGG - Intergenic
968506372 4:973119-973141 AGGTGGCACCGGCGCTTTCGGGG - Intronic
968903100 4:3440295-3440317 AGGGGAGGCCGGGGCCTTGGGGG + Intergenic
969269998 4:6093135-6093157 AGGTGTGAGCTGGGTTTTGAAGG - Intronic
972352270 4:38246721-38246743 AGCAGTTACCGGGGGTTTGGAGG - Intergenic
975441667 4:74418425-74418447 GGGTGTGAGCGAGGGTTTGGGGG - Intergenic
976720330 4:88163187-88163209 AGCTGTGAGCTGGGCTGTGGGGG - Intronic
980006579 4:127549735-127549757 ATGTGTGACTGTGGTTTTGGTGG - Intergenic
981045560 4:140261858-140261880 ATGTGTGACCAGGGCTTGGAAGG + Intronic
981479021 4:145217416-145217438 GGGTTTGACTGGGGCTTGGGGGG + Intergenic
984663473 4:182399172-182399194 AGGTGTGAACCGGGCATTTGAGG - Intronic
988320347 5:29686633-29686655 AGGTGTGGCATGGGCCTTGGTGG - Intergenic
995737074 5:115312910-115312932 AGATGTGACCCGGGCTTTCCAGG + Intergenic
998158889 5:139801991-139802013 AGGTGTGAAAGGGGCTGTGCTGG - Intronic
1002070498 5:176676592-176676614 AAGTGTGACCTGGGCCCTGGCGG - Intergenic
1002123387 5:177022912-177022934 AGGTGAGTCGGGGGCTTTGGAGG + Exonic
1003422197 6:5968632-5968654 GGGTGTGGCCTGGGCATTGGGGG - Intergenic
1003759985 6:9168651-9168673 AGGTGTGAATTGGGGTTTGGTGG - Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007389295 6:41541077-41541099 AGCTGTGCCAGGGGCTGTGGAGG - Intergenic
1007394178 6:41568075-41568097 ATGTGTGAACGAGGCTTTTGGGG + Intronic
1007656308 6:43453115-43453137 AGGTGTGACCCGGGCTGGGAGGG - Exonic
1008611924 6:53192201-53192223 AGTTGTGACAAGGGTTTTGGTGG - Intergenic
1017985112 6:159436656-159436678 AGGTGGGAACGGGGGTTTAGGGG + Intergenic
1018906385 6:168078687-168078709 AGGGGTGAGCAGGGCTGTGGGGG - Intronic
1019166283 6:170099693-170099715 AGGAGTGACCTGTTCTTTGGAGG - Intergenic
1021062520 7:16131485-16131507 AAATGTGACCTGGGCTCTGGTGG + Intronic
1022752906 7:33250950-33250972 AGGTGGGACAGGGGCTCTGTGGG + Intronic
1024234425 7:47387241-47387263 AGGTGGGGCTGGGGCTGTGGAGG + Intronic
1029478499 7:100799431-100799453 AGGTGTGGGAGGGACTTTGGGGG - Intergenic
1029860077 7:103561689-103561711 AGGTGTGACCGGGGCTTTGGTGG - Exonic
1032078641 7:128847943-128847965 AGGTGTGGCCGAGCCTGTGGAGG + Exonic
1033283875 7:140024605-140024627 GGGTGTGACCGAGGGCTTGGAGG + Exonic
1034274903 7:149819752-149819774 TGGTGTGACCGCAGCTGTGGGGG + Intergenic
1034432910 7:151049879-151049901 GGCTGTGCCCTGGGCTTTGGTGG + Intronic
1035353533 7:158263744-158263766 AGGTGCCACGGGTGCTTTGGAGG - Intronic
1040079638 8:43274357-43274379 AGGTGTGACTGAGGCTGAGGAGG - Intergenic
1041880637 8:62745815-62745837 AGGAATGATCAGGGCTTTGGAGG + Intronic
1046569614 8:115946811-115946833 AGATCTGCCTGGGGCTTTGGTGG + Intergenic
1049178720 8:141209452-141209474 GTGGGTGACCGGGGCTCTGGCGG - Intronic
1052970782 9:34376230-34376252 ATCTGGTACCGGGGCTTTGGGGG + Intronic
1057270431 9:93647308-93647330 AGGTGAGCCCAGGGCCTTGGTGG - Intronic
1057884874 9:98822541-98822563 AGGTGGCAGCGGGGATTTGGGGG + Intronic
1059238722 9:112784777-112784799 AGGTTTGACCTGGGCTTGGCAGG - Intronic
1060074558 9:120579899-120579921 AGGTGCGGCCGGGGCATTGGTGG - Exonic
1061533568 9:131233452-131233474 AGGTCTGTCCAGGGTTTTGGTGG + Exonic
1062371464 9:136241311-136241333 AGGTGTCAGCGGGCATTTGGCGG - Intronic
1062490729 9:136803718-136803740 AGGTGTGGCCAGGGCTAGGGAGG + Intronic
1185736551 X:2500658-2500680 AGGTGTGGCCGGGGGTGGGGGGG - Intronic
1186088794 X:6021596-6021618 AGGTGTGGACAGGTCTTTGGTGG - Intronic
1187682725 X:21784168-21784190 AGGGGTTACTGGGGCTTTGTGGG - Intergenic
1189146066 X:38656161-38656183 AGGTATGGCTGAGGCTTTGGTGG + Intronic
1192573920 X:72227713-72227735 AGGTGTGAGGGGGGAATTGGGGG - Intronic
1194000661 X:88424739-88424761 AGGATTGGCAGGGGCTTTGGCGG + Intergenic
1194957939 X:100203016-100203038 AGGTGTGGTTGGGGCCTTGGAGG - Intergenic
1195869662 X:109472890-109472912 AGGTGTGACAGGGGGAATGGTGG - Intronic
1200248964 X:154542089-154542111 ATGAGTCACCGGGGCTTTGGGGG + Intronic