ID: 1029861130

View in Genome Browser
Species Human (GRCh38)
Location 7:103573303-103573325
Sequence AGTCTAAATCAGCAACTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029861130_1029861132 3 Left 1029861130 7:103573303-103573325 CCTGTCAGTTGCTGATTTAGACT 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1029861132 7:103573329-103573351 TTGGCTAAATTTTTCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029861130 Original CRISPR AGTCTAAATCAGCAACTGAC AGG (reversed) Intronic