ID: 1029861132

View in Genome Browser
Species Human (GRCh38)
Location 7:103573329-103573351
Sequence TTGGCTAAATTTTTCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029861129_1029861132 30 Left 1029861129 7:103573276-103573298 CCATATTTGTTTAGAGTCAGATA No data
Right 1029861132 7:103573329-103573351 TTGGCTAAATTTTTCACAGCAGG No data
1029861130_1029861132 3 Left 1029861130 7:103573303-103573325 CCTGTCAGTTGCTGATTTAGACT 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1029861132 7:103573329-103573351 TTGGCTAAATTTTTCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029861132 Original CRISPR TTGGCTAAATTTTTCACAGC AGG Intronic