ID: 1029863978

View in Genome Browser
Species Human (GRCh38)
Location 7:103605583-103605605
Sequence CTGTGGTTCTTTTGGTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029863973_1029863978 -2 Left 1029863973 7:103605562-103605584 CCTGTAGGAATTTTCAGGGACCT 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1029863978 7:103605583-103605605 CTGTGGTTCTTTTGGTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029863978 Original CRISPR CTGTGGTTCTTTTGGTCAAA GGG Intronic
No off target data available for this crispr