ID: 1029864653

View in Genome Browser
Species Human (GRCh38)
Location 7:103614382-103614404
Sequence AGATATAAGTAAAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029864645_1029864653 30 Left 1029864645 7:103614329-103614351 CCAGTGATTGGTCTAGGGGTGGC 0: 1
1: 0
2: 6
3: 34
4: 152
Right 1029864653 7:103614382-103614404 AGATATAAGTAAAAGGTGGAAGG 0: 1
1: 0
2: 3
3: 39
4: 338
1029864648_1029864653 8 Left 1029864648 7:103614351-103614373 CCATGTGTCCAGCAGTGGGTTCT 0: 1
1: 0
2: 3
3: 16
4: 183
Right 1029864653 7:103614382-103614404 AGATATAAGTAAAAGGTGGAAGG 0: 1
1: 0
2: 3
3: 39
4: 338
1029864649_1029864653 0 Left 1029864649 7:103614359-103614381 CCAGCAGTGGGTTCTCACCAATG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 1029864653 7:103614382-103614404 AGATATAAGTAAAAGGTGGAAGG 0: 1
1: 0
2: 3
3: 39
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029864653 Original CRISPR AGATATAAGTAAAAGGTGGA AGG Intronic
900894321 1:5472830-5472852 ACAGATAAGTAAACTGTGGAAGG + Intergenic
904975096 1:34449831-34449853 AGATTTCAGTAAATGTTGGATGG - Intergenic
906037776 1:42763262-42763284 ACATTTAGGGAAAAGGTGGATGG + Intronic
906631504 1:47372834-47372856 AACCATAAGTAAAGGGTGGAGGG - Intronic
907779262 1:57550622-57550644 AGATATATGGTAAAGTTGGATGG - Intronic
908064842 1:60391732-60391754 AGATAAAAGGAAAAGGTCTAGGG - Intergenic
909135297 1:71791519-71791541 ATATATAGGTAAAAGTTGGTAGG - Intronic
909287710 1:73841218-73841240 AGAAATAGGTTAAAAGTGGAGGG + Intergenic
909605288 1:77501672-77501694 AGAAAAAAGTAAAAGGAGAAGGG - Intronic
909982736 1:82123320-82123342 ATATATAAATAAAAGATGAAAGG + Intergenic
911152995 1:94612938-94612960 AGATAAAAGTGAGAGGTGAAAGG + Intergenic
911286855 1:96005484-96005506 ATAAATAAGTAAAAGGAAGATGG - Intergenic
913049369 1:115103423-115103445 AGGTACATATAAAAGGTGGATGG - Intergenic
913363804 1:118013061-118013083 ACATATATGTGAAAGGAGGAGGG - Intronic
913392613 1:118331219-118331241 AAATATGAGGAAAAGCTGGAAGG - Intergenic
916228484 1:162514884-162514906 AGTTATAAGTAAAAGTAGGTAGG + Intronic
916299374 1:163256954-163256976 AGATAAAAGGGAAAGGTGGTTGG - Intronic
918320968 1:183364608-183364630 ATATATAAGTAGAAGCTGCAGGG + Intronic
918550034 1:185732344-185732366 AAAAATAAGTTAAAGGTGAAAGG + Intergenic
918626529 1:186661907-186661929 AGATATAATTGACAGGTGGGGGG - Intergenic
918759549 1:188385582-188385604 TGATATATGTAAAAAATGGAAGG - Intergenic
919036645 1:192319294-192319316 TGATATAAAAAAAAGTTGGAAGG - Intronic
919412053 1:197257796-197257818 AAGGATAAGTAATAGGTGGAGGG - Intergenic
919757493 1:201075032-201075054 AGATATGAGGGTAAGGTGGATGG - Intronic
919997882 1:202770759-202770781 TGAGAGAAGTAACAGGTGGAAGG + Intronic
920098715 1:203503231-203503253 AGATAAAATAAAATGGTGGAGGG - Intronic
920927488 1:210356589-210356611 AGAAATAAACAAAAGGTAGAAGG - Intronic
923647802 1:235841765-235841787 AGATATAGAAAACAGGTGGAAGG + Intronic
923826987 1:237511383-237511405 AGATATAAGCAAATGCTGCAAGG + Intronic
924076295 1:240341044-240341066 AGATAATAGCAAAAGGTGGAAGG - Intronic
1065634061 10:27712499-27712521 AGGTAAAAGGAAAAGGTGGGAGG + Intronic
1067466883 10:46507220-46507242 ATATATATGTAATAGGTGGATGG + Intergenic
1067620303 10:47877385-47877407 ATATATATGTAATAGGTGGATGG - Intergenic
1067991299 10:51215712-51215734 AGAAAGAAGTGGAAGGTGGAAGG - Intronic
1068154321 10:53177404-53177426 AAATATAAGTAAAATGAGCAAGG + Intergenic
1069154093 10:65003075-65003097 GGATAAAAGAAAAAGGTGGAAGG - Intergenic
1069493484 10:68881926-68881948 AGATTTAAAAAAAAGGGGGAGGG - Intronic
1072536327 10:96366620-96366642 AAGTATATGTAAAAGGTGAAAGG - Exonic
1073741341 10:106410740-106410762 AGATTTAAGCAAAAGTTGTACGG + Intergenic
1074167639 10:110898636-110898658 ACAGTTAAGTAAAAGGTGGCTGG + Exonic
1074354691 10:112771681-112771703 AGATATAGCTAAAAGGTACAGGG - Intronic
1074981248 10:118621508-118621530 AGATACACGTGAAAGGAGGAGGG - Intergenic
1075311472 10:121417484-121417506 AGAGACAAGCAAAAGCTGGAAGG + Intergenic
1076178670 10:128388299-128388321 AGATATGAATAAAAAGTGAATGG - Intergenic
1076890759 10:133282115-133282137 AGATGGAAGTAAAAGGGGGGAGG + Intronic
1078255572 11:9655767-9655789 AGAAAAAAGAAAAAGGTGGAAGG + Intergenic
1079068362 11:17319189-17319211 TGATATAAGTAGAAGGTCGAGGG - Intronic
1080121768 11:28686182-28686204 AGATATAAGGAAAAAGGTGAGGG - Intergenic
1080159972 11:29162074-29162096 ACATATTAGTAAAGGGAGGAAGG - Intergenic
1080183600 11:29452811-29452833 AGATAGAATTCTAAGGTGGATGG + Intergenic
1080225817 11:29958925-29958947 AGATATAGGTGAAAGGAGGGAGG - Intergenic
1080675046 11:34418387-34418409 AGAAGGAAGTAAGAGGTGGAGGG + Intergenic
1081957167 11:47103530-47103552 AGACATATGAGAAAGGTGGAAGG - Intronic
1082199223 11:49343065-49343087 AGAAGAAAGTAAAAGGTGGGAGG + Intergenic
1082276277 11:50225247-50225269 AGGTAGAATTTAAAGGTGGAAGG + Intergenic
1083102814 11:60327723-60327745 AGAAATAATTAAAAACTGGAGGG + Intergenic
1085415497 11:76316738-76316760 ACATAGAAGTCAAAGGTAGAAGG - Intergenic
1085425123 11:76397714-76397736 AGATACAAATAAAAGTTGCATGG + Intronic
1086218452 11:84411603-84411625 AGAAATAAGTAAGAGGTGGATGG + Intronic
1088272673 11:108050935-108050957 AGATATATGGAAAATGAGGACGG - Intronic
1089252162 11:117172585-117172607 AGTTCAAAGTAAAGGGTGGAAGG - Intronic
1089715642 11:120356611-120356633 AGAAATAAGTAAAAGGTTGAGGG - Intronic
1090368882 11:126232529-126232551 AGATGAAAGTAAAATGTAGAGGG - Intronic
1091843327 12:3635874-3635896 TGATATAAAGAAAAGTTGGAAGG - Intronic
1092067508 12:5604129-5604151 AGGTAGAATTAAAAAGTGGATGG + Intronic
1092370971 12:7916320-7916342 TGAGACAAGGAAAAGGTGGAGGG - Intergenic
1093929580 12:24942252-24942274 AGAAAGAAGTAAAAGATGGCTGG + Intronic
1095308914 12:40672162-40672184 AAAAAAAAGTAAAAAGTGGAAGG - Intergenic
1095503886 12:42871306-42871328 ACATATATGTGAAAGGGGGAGGG - Intergenic
1095576101 12:43741184-43741206 ACATTTAAGCAAAAGCTGGATGG - Intronic
1095644652 12:44529278-44529300 AGATATGAGGAAAAGAAGGAAGG + Intronic
1095992107 12:48042269-48042291 AGACATATTTAAAAGCTGGAGGG + Intergenic
1096046040 12:48563265-48563287 AGACATAAGTAAAAGGGAGAGGG - Intergenic
1096958325 12:55549856-55549878 AGAGAAAGGTAAAATGTGGATGG + Intergenic
1098040096 12:66345365-66345387 TGTTATAAGTAAATGGGGGAAGG + Exonic
1098811903 12:75105191-75105213 ACATATAAGGAAAAGGCTGAAGG + Intronic
1098929478 12:76394051-76394073 AGATAAAAGTAAACTTTGGAAGG + Intronic
1099194611 12:79600764-79600786 AGAATTAAGTAAAATGTGGCTGG - Intronic
1099350364 12:81560358-81560380 AACTATATGTGAAAGGTGGAAGG + Intronic
1101047842 12:100828679-100828701 AGATAAAAGCAAAGGGTGGAAGG + Intronic
1101189560 12:102317413-102317435 AGAGAAAAGTAAAAGATAGATGG - Intergenic
1101375200 12:104165427-104165449 AGATATAATGAACAGATGGATGG - Intergenic
1102660936 12:114527712-114527734 AGATATAAGTAAAGGAAGGAAGG - Intergenic
1102669349 12:114604049-114604071 AAATCTAAGAGAAAGGTGGATGG - Intergenic
1102775382 12:115514347-115514369 ATATATGAGGAAAATGTGGAAGG - Intergenic
1104392928 12:128406479-128406501 AGATATAAAAAAGAGGTGCATGG + Intronic
1104643297 12:130480895-130480917 AAAAATGAGTAAAAGGTGGTCGG - Intronic
1104858898 12:131914722-131914744 AGACAGAAGTAAATGGTGGGAGG + Intronic
1106232534 13:27832106-27832128 TGATAAACGTAAATGGTGGATGG + Intergenic
1106712514 13:32353257-32353279 AGAGATAAGTGAAAAGAGGAGGG - Intronic
1106839068 13:33666909-33666931 ACATATATTTAAAAAGTGGATGG + Intergenic
1106905754 13:34407396-34407418 AGAAATAATGAAGAGGTGGAAGG - Intergenic
1108094445 13:46886374-46886396 AAATATAAATATAAGATGGAAGG + Intronic
1108504025 13:51093707-51093729 AGCATTAAGTAAAAGGTAGATGG - Intergenic
1108877709 13:55068106-55068128 ACATATAAATAAATGGTGGAGGG - Intergenic
1109498760 13:63211053-63211075 AGATAAAACAAAAAGGAGGAAGG - Intergenic
1109764412 13:66874968-66874990 AGAGATATGTAGAAGGGGGAGGG + Intronic
1109880144 13:68461711-68461733 AGATAAAAGCAAAAGCTTGAAGG - Intergenic
1110831455 13:80036432-80036454 AGAGATAAGTTAAAGATAGATGG - Intergenic
1110914979 13:81010074-81010096 AGATATAAGGAAAAGTGGGCTGG - Intergenic
1111514344 13:89308547-89308569 AAATACAATTAAAAGCTGGAAGG - Intergenic
1112052557 13:95657329-95657351 AAATCTCAGCAAAAGGTGGAAGG - Intergenic
1112165577 13:96916569-96916591 AAATAAAAGTAAAAATTGGATGG - Intergenic
1112289211 13:98130279-98130301 AGAGGTAAGAAACAGGTGGAGGG - Intergenic
1112838865 13:103550520-103550542 AGTTATAAGTAAAAGTTATAAGG - Intergenic
1113019460 13:105867629-105867651 AAAGATTAGTAAAGGGTGGAGGG - Intergenic
1114992068 14:28299390-28299412 AGATGTAACTACCAGGTGGAGGG - Intergenic
1116171164 14:41404869-41404891 AGACATAAGGAAGAGATGGAAGG - Intergenic
1116991738 14:51284522-51284544 AGAGATAAGTAAAAGGAGGCAGG - Intergenic
1119146608 14:72320777-72320799 TAATATAAGGATAAGGTGGAAGG + Intronic
1120646007 14:87075149-87075171 AGATGTAGGTCAAATGTGGATGG - Intergenic
1124909893 15:33909300-33909322 AGACAAAAGTAAAATGTGCAGGG + Intronic
1126557215 15:50002726-50002748 AGAAAAAAGTAAAAGATGGTAGG + Intronic
1128280838 15:66392956-66392978 ATAAATAAGTAAAATGTGGCAGG - Intronic
1129733642 15:77946731-77946753 AAATAAAGTTAAAAGGTGGATGG + Intergenic
1129841952 15:78749270-78749292 AAATAAAGTTAAAAGGTGGATGG - Intergenic
1130324042 15:82864761-82864783 AGATATTAATAAAAAGTGGAGGG - Intronic
1134310642 16:13072432-13072454 AGAGATAACTAAAAGGTAGCAGG - Intronic
1135017468 16:18935845-18935867 AGATATAGGAAAAGGCTGGAAGG + Intergenic
1135549497 16:23387280-23387302 AAAAAGAAGTAAAAGGTGGCTGG - Intergenic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139304884 16:65976767-65976789 AAATGAAAGGAAAAGGTGGAAGG - Intergenic
1139310002 16:66020413-66020435 AGAAATGAAGAAAAGGTGGAGGG + Intergenic
1139934474 16:70559123-70559145 AGCTGTAAGTAAAGGGTTGACGG - Intronic
1141052033 16:80776548-80776570 ATATATAAATAAAAGATGGATGG - Intronic
1141848049 16:86624463-86624485 AGATAGAGGTAATAGGTGGATGG - Intergenic
1142707757 17:1707481-1707503 AGCTATCAGTAAAGGGTGGCAGG - Exonic
1144964782 17:19070124-19070146 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144983185 17:19182054-19182076 AAATAGAAGGAAAAGGAGGAGGG + Intergenic
1144985040 17:19196185-19196207 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1150873931 17:68947159-68947181 AGATATAATTAAAATGTTTATGG + Intronic
1155069746 18:22304216-22304238 AGAAATAAGGAAATAGTGGAGGG - Intergenic
1156076984 18:33290761-33290783 AGATCAAAGTAAAAAGTGAATGG + Intronic
1156137237 18:34057225-34057247 AAATATAAGTACATGGTGGTGGG - Intronic
1156309031 18:35905842-35905864 AGATAAAAGTAGAAGGAAGAGGG + Intergenic
1156335268 18:36165891-36165913 AAAAATAAGTTAAAGTTGGACGG + Intronic
1156487500 18:37475838-37475860 AGAAATGAGTAAGAGGAGGAAGG - Intronic
1157503042 18:48204117-48204139 AGGTATAAATCAGAGGTGGAAGG - Intronic
1158988910 18:62848883-62848905 ACAAATAAGTAAAAGGAGTAAGG - Intronic
1160094166 18:75855987-75856009 AGAGATAAGTTATAGATGGATGG - Intergenic
1161894034 19:7066836-7066858 GGATATAAGAAAAAGGAGCAGGG + Intergenic
1163384507 19:16991291-16991313 AGCTGTAATTAAAAGGTGGTAGG + Intronic
1164149690 19:22540739-22540761 AGATAGAAGAAAAAGAGGGAAGG + Intergenic
1164447057 19:28326882-28326904 GGATCTAAGTAAAAGCTGGAGGG - Intergenic
1165561742 19:36686428-36686450 AGATGGAAGTAAAAGGGAGATGG + Intergenic
1167165548 19:47797527-47797549 AGACAGAAGAAAAAAGTGGAAGG + Intergenic
925225857 2:2183724-2183746 AGATATAACTAAAAGAAGGAAGG + Intronic
925794471 2:7527337-7527359 AGTTATAGGAAAAAGGTGCATGG + Intergenic
926070081 2:9880698-9880720 AGAGATAAGTAAGAGATGAAGGG - Intronic
926540888 2:14179916-14179938 TGATATATGTAAAAATTGGAAGG + Intergenic
926582458 2:14646083-14646105 TTCTATAAGAAAAAGGTGGAGGG - Intronic
927017347 2:18978980-18979002 ATAAATAAATAAAAGGAGGAGGG - Intergenic
927098414 2:19766308-19766330 AGATATAAGTCAAAGGATGTAGG - Intergenic
928356016 2:30615234-30615256 AGATAGAAGACATAGGTGGAGGG + Intronic
928657279 2:33465399-33465421 ACATAAAAGTACAAGGTGGAAGG + Intronic
928846381 2:35678366-35678388 ACTTATAAGAGAAAGGTGGAAGG - Intergenic
930953152 2:57169239-57169261 AAATATAAATATGAGGTGGATGG + Intergenic
931208184 2:60167678-60167700 AGATATAAATAATAGGCCGAGGG - Intergenic
931465123 2:62479251-62479273 TCATAGAAGTAAAAAGTGGAAGG - Intergenic
931798795 2:65737974-65737996 AGGTATAAGCAAAGGATGGAGGG - Intergenic
931977789 2:67662355-67662377 AGATATAAAGAAAAGTTGCAAGG + Intergenic
935948600 2:108308474-108308496 AAATAAAATTAAAAGGTGGATGG + Exonic
936615087 2:114040333-114040355 AGACAGATGTAAAAGTTGGAGGG - Intergenic
936921532 2:117694012-117694034 ACAAATAAATAAAAGGTAGAGGG - Intergenic
937619817 2:123972631-123972653 AGACTTAAGTCCAAGGTGGAAGG - Intergenic
937638335 2:124183023-124183045 ATAAATAAGCAAAAGGTGGAGGG - Intronic
938316642 2:130333970-130333992 ACAAATAACTAAAACGTGGAAGG + Intergenic
938717469 2:134034061-134034083 AGGTATAAATAAATGGTGGGGGG - Intergenic
939698335 2:145356758-145356780 TTATATAAATAAAAGTTGGAGGG - Intergenic
939721826 2:145663240-145663262 AAATATAAAGAAAAGGTGGCCGG - Intergenic
940016461 2:149111206-149111228 AGATTTTATTAAAAGGGGGATGG + Intronic
940564030 2:155337850-155337872 ACATATAAGTAAAATGTTTAGGG + Intergenic
940685791 2:156848968-156848990 ACATAAAAGTACAAGGTGGTTGG + Intergenic
942628925 2:177935244-177935266 AGGTGTTGGTAAAAGGTGGAGGG - Intronic
945150898 2:206790050-206790072 AAATATAACGAAAATGTGGAAGG - Intronic
946616830 2:221518993-221519015 AGATAGCAGTAAAGGTTGGAGGG + Intronic
946914993 2:224509661-224509683 AGATGTATGTAAAAGGTGTCAGG - Intronic
1168999959 20:2161658-2161680 ATAAATAAATAAAAGCTGGAGGG + Intronic
1169484142 20:6012458-6012480 AGACAGAAGTAATATGTGGATGG + Intronic
1169666313 20:8040579-8040601 AGATATAAATAAATGGAGGGTGG - Intergenic
1169783589 20:9334695-9334717 GGATGGAAGTAAAAGGAGGAGGG + Intronic
1169971049 20:11269966-11269988 AAATATTAATAAAAGTTGGATGG - Intergenic
1170071269 20:12371651-12371673 AGATATAAGTTAAAGTCTGAAGG - Intergenic
1170461851 20:16584905-16584927 AGATATAACTGAAAGTTGGGAGG - Intergenic
1175792435 20:61748989-61749011 AGATATACCTAAAAGGTATAAGG + Intronic
1177241307 21:18461719-18461741 CTATATAATTAAAAGGAGGATGG - Intronic
1177275032 21:18899582-18899604 AAATGTAAGTAAAATTTGGAGGG - Intergenic
1177743289 21:25179558-25179580 ACTTATAAGTAAAAGTTGAAAGG - Intergenic
1177826594 21:26091244-26091266 AGACACAGGTAAAAGGTGGTAGG + Intronic
1177982497 21:27931800-27931822 GGATATAAGCAGAAGATGGATGG - Intergenic
1178128375 21:29541604-29541626 AGATACAATGAAAAGGTTGATGG + Intronic
1181577174 22:23802435-23802457 AGACAGAAGGAAAAGGAGGAGGG - Intronic
1181928740 22:26381707-26381729 AGGTATAAAGAGAAGGTGGAGGG + Intronic
1183153212 22:36053884-36053906 AAATGAAAATAAAAGGTGGAGGG - Intergenic
1183799941 22:40154142-40154164 AGATATAAAGAAAAGGCTGAGGG - Intronic
1184368133 22:44065454-44065476 AGAAATAAGAAAGAGGTGGGAGG - Intronic
1184538304 22:45102563-45102585 AGATTTTAGTAAAAAGTGCAGGG + Intergenic
949685596 3:6566165-6566187 AGAGATGAACAAAAGGTGGAGGG - Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950271860 3:11623045-11623067 ATCCATAACTAAAAGGTGGATGG - Intronic
951005150 3:17607371-17607393 AGTTGGAAGTAAAAGCTGGAGGG - Intronic
953503060 3:43456667-43456689 TTAAATAAGTGAAAGGTGGAAGG + Intronic
953541035 3:43818398-43818420 AGATATAAGTGGAGGCTGGAAGG - Intergenic
953673694 3:44983492-44983514 AGATTTAAGTATAATTTGGAAGG + Intronic
954736044 3:52707149-52707171 ATAAATAAATAAAAGGTGAAGGG - Intronic
955650007 3:61183966-61183988 AGAAAGAAGTAAAAAATGGAGGG - Intronic
955979852 3:64513917-64513939 AGATATAAGTAAAATTTGTTAGG + Intergenic
955982190 3:64538391-64538413 AAAAATAAATAAAAGTTGGACGG - Intronic
957311038 3:78519188-78519210 AGAGGTAAGTAAAAGATGTAAGG + Intergenic
957759403 3:84535388-84535410 AGACACTAGTAAAAGGTTGAGGG - Intergenic
960443499 3:117718616-117718638 AGATATAGTAAAATGGTGGAGGG + Intergenic
963004122 3:140710233-140710255 TGATAATAGTAAAGGGTGGAGGG - Intergenic
963190393 3:142464500-142464522 ATAGATAAATAAAATGTGGATGG + Intronic
963597479 3:147346591-147346613 AGAAATAAGTAAAAGGGGAGAGG + Intergenic
963719704 3:148848087-148848109 CAATATAAGAAAAAGTTGGAAGG - Intronic
964932450 3:162043542-162043564 ATATATAAGTAAGAGCTGAATGG - Intergenic
965097111 3:164244456-164244478 GAATATAACAAAAAGGTGGAGGG - Intergenic
965777539 3:172247655-172247677 AGTTATGAATAAAATGTGGATGG - Exonic
967456532 3:189693078-189693100 AGATATAAGCCAAAGGTTGTAGG - Intronic
968344090 3:197985870-197985892 ACCTATAATTAAAAGGTGGGAGG - Exonic
969141152 4:5074072-5074094 AGAGACAAATAAAAGGGGGAGGG - Intronic
971410450 4:26365779-26365801 AAATAAAAGTAAAAGATGGTAGG - Intronic
971997566 4:33984922-33984944 ATATATATTTAAAAGGAGGATGG - Intergenic
972152709 4:36114363-36114385 AGATATCATTAAATGGTGGATGG - Intronic
972259199 4:37391480-37391502 AGAGATAAGTAAAGGCTTGAAGG + Intronic
974149526 4:57988964-57988986 AGATTTCAGTAAAAGATAGAAGG + Intergenic
974822334 4:67082849-67082871 AGATAGAAATAAAATGTGAAAGG - Intergenic
974978346 4:68920531-68920553 AGATGTAAGTGAAAGCTGTATGG + Intergenic
975356883 4:73417180-73417202 AGATACAAGTAGAAAATGGAAGG - Intronic
975383272 4:73727033-73727055 AGATGTGAGTGAAAAGTGGAGGG + Intergenic
975450315 4:74518044-74518066 AGACAGAAGTAAAAGGTGTGTGG - Intergenic
975837978 4:78444221-78444243 AGAAAAAAGTAAAAATTGGAAGG + Intronic
975860101 4:78668168-78668190 AGATAGATGTAAAAGGTTGTAGG + Intergenic
975951474 4:79777279-79777301 GGACATAAGGAAAAGGTGGTGGG + Intergenic
975986374 4:80203988-80204010 AGATATAAAGTAAAGGAGGAGGG + Exonic
976119818 4:81767662-81767684 ATATATAACTAAAAAGTTGAGGG - Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977123701 4:93137562-93137584 AGATAGAAATAAAAGGTACAAGG + Intronic
977561833 4:98540632-98540654 AGATATAAGAAAGAGGGGGCTGG - Intronic
977980778 4:103318938-103318960 AGATATAAGCAAAAGTTGTAGGG - Intergenic
978157405 4:105505618-105505640 AGATAATAGTAAAATGTGGGTGG - Intergenic
978308805 4:107363287-107363309 AGAAATAAGAAAAAGCTGAATGG + Intergenic
978597361 4:110392735-110392757 AGAGATGAGTGAAAGGTGGCTGG + Intronic
979234990 4:118389748-118389770 AGATATAATAAAAAAGTGCAGGG + Intergenic
979433892 4:120665820-120665842 AGTTTTAAGTTAAAAGTGGAAGG + Intergenic
980624846 4:135361425-135361447 ATAAAGAAATAAAAGGTGGAAGG + Intergenic
981176165 4:141686328-141686350 ATAAATAAATAAAAGGTGGGAGG + Intronic
982046940 4:151457571-151457593 ACATATATGTGACAGGTGGAGGG - Intronic
982675748 4:158373941-158373963 GGAAATAAGAAAAAGGGGGAAGG + Intronic
982946873 4:161635660-161635682 AGAAATAAGTAAAAGAGGGATGG + Intronic
983288563 4:165770986-165771008 ATATATAGGAAAAGGGTGGATGG + Intergenic
984100312 4:175476565-175476587 AAATATAAGTAAAAAGTCCAAGG + Intergenic
984830597 4:183969267-183969289 GGATAAAAGTAAAATGTGGAAGG + Intronic
987050120 5:14142428-14142450 AGACAAATGTAAATGGTGGATGG - Intergenic
987364470 5:17136682-17136704 AGATATGAGAGAAAAGTGGAAGG - Intronic
988054375 5:26074425-26074447 AGAAATAATTAAAAGTTGAAAGG + Intergenic
988393147 5:30661703-30661725 AAATATAAGTCAAAAGTGCACGG + Intergenic
990195893 5:53315993-53316015 AGTTAAAAGTAAAAGGATGAAGG + Intergenic
991340837 5:65606705-65606727 AGATTCAAGTAAAAAGTTGAAGG - Intronic
991980466 5:72225216-72225238 AGACATAAGTATAAGGTGACAGG + Intronic
993503275 5:88684912-88684934 AGAGAGAAGTAAAAGGGGGATGG + Intergenic
995077181 5:107999695-107999717 GGATATAAGCAAAAGGAGGCAGG + Intronic
995351727 5:111184242-111184264 AGATATATGTATAAAGTAGATGG - Intergenic
995608523 5:113884692-113884714 AGAGAAAAATAAAAGGAGGAAGG + Intergenic
995733248 5:115268565-115268587 AGATAAAAGTAAAAGTAGGTCGG - Intronic
995758414 5:115537733-115537755 AGAGAAAAATAAAAGGGGGAAGG - Intronic
995896703 5:117021177-117021199 AGATATAATTAGAAGATGAAGGG - Intergenic
996760135 5:126978489-126978511 AGATTTATGAAAAAGGTGAAAGG + Intronic
996988177 5:129593937-129593959 ATATATAGGTCAAAGGTGAATGG - Intronic
997977588 5:138449428-138449450 AGATGTCAGAAATAGGTGGATGG + Intergenic
999845356 5:155473630-155473652 AAATATAAGGAAAAGGTAGGAGG + Intergenic
1001696357 5:173673291-173673313 AGAGATAGGGAAAGGGTGGATGG + Intergenic
1005005283 6:21281742-21281764 AGCTATCTGTAAAAGGGGGAGGG - Intergenic
1005289241 6:24362113-24362135 AGATAGTAGTAAAATGTAGATGG + Intergenic
1005397677 6:25400072-25400094 AGATATAATTGTAAGGTGAATGG - Intronic
1006970845 6:38043463-38043485 AGCTAAAAGAAAAAGGTGGAGGG - Intronic
1007517242 6:42422545-42422567 AGCTAGAAGTGAAAGGTGGAAGG - Intronic
1007828922 6:44623225-44623247 AGAAAGAAGAAAAAGGAGGAAGG - Intergenic
1008879720 6:56369206-56369228 AAATACTAGTAAAAAGTGGAAGG + Intronic
1009732012 6:67620977-67620999 AGAAATAACTATAAGGTGTAAGG - Intergenic
1011351124 6:86425180-86425202 AGGTCCAAGTAAAAGGTAGAAGG - Intergenic
1011519821 6:88193367-88193389 ATATAAAACTAAAAAGTGGAAGG + Intergenic
1011803499 6:91045529-91045551 AGAGATAAGTAAAAGTTTGGGGG - Intergenic
1012346415 6:98193044-98193066 AATTATAACAAAAAGGTGGAGGG - Intergenic
1012621102 6:101344876-101344898 AGATAAAAGGAAAGGGTGGAGGG + Intergenic
1012720974 6:102744566-102744588 AAATAAAAGTAAAAGGTTTAAGG + Intergenic
1013796891 6:113898288-113898310 AAATATAACTAAAATGTGAATGG + Intergenic
1015247635 6:131092448-131092470 ATATATAAAAAAAAGATGGAAGG + Intergenic
1015617713 6:135095109-135095131 AGAGAGAAGTAAAAGGTGGGAGG + Intronic
1016106284 6:140167233-140167255 AAATGTAAGTAAAAAGTGAAAGG - Intergenic
1016357980 6:143238457-143238479 AGATAAAAGGAAAAGTTGGCTGG - Intronic
1016453047 6:144203272-144203294 AGAGATAAGAAAAAGCTGGTTGG - Intergenic
1017533519 6:155321886-155321908 TCACATAAGTAAAAGGAGGATGG - Intergenic
1018670066 6:166169746-166169768 AGATAAAAGGGAAAAGTGGAGGG + Intergenic
1018919944 6:168165409-168165431 AAATTTAATTAAAGGGTGGATGG + Intergenic
1020440774 7:8214482-8214504 ACATAATAGGAAAAGGTGGATGG - Intronic
1020828961 7:13069066-13069088 GGATATAAGTAAAATATGTATGG - Intergenic
1023193216 7:37606065-37606087 AGCTATTAGTAAAGTGTGGAGGG + Intergenic
1023387422 7:39674077-39674099 ATAAATAAATAAAAGGTTGAGGG + Intronic
1026264778 7:68786659-68786681 AGATTAAATTAAAAGATGGAGGG + Intergenic
1027638232 7:80702428-80702450 AGATCAGAGTTAAAGGTGGAAGG - Intergenic
1028221853 7:88206628-88206650 AGATATGAGTAAATGATAGATGG + Intronic
1028328960 7:89564280-89564302 AGCTATAAATAAAAGATAGAAGG + Intergenic
1029864653 7:103614382-103614404 AGATATAAGTAAAAGGTGGAAGG + Intronic
1030615814 7:111737138-111737160 ATATTTAAGTAAAAGGGGGTGGG + Intronic
1030680776 7:112431543-112431565 AGATATAAGGAATAGGTGGTGGG - Intronic
1030855095 7:114545914-114545936 ACATATAAGTAATATATGGAAGG - Intronic
1030940550 7:115641876-115641898 GGACAAAAGTATAAGGTGGAAGG + Intergenic
1031323303 7:120360792-120360814 AGATATAAGAAAACAATGGATGG + Intronic
1031388359 7:121181190-121181212 ATATATTTGTAAAAGGTGAATGG + Intronic
1031391110 7:121216304-121216326 AGCCATAAGGAAAAGGAGGAGGG + Intronic
1031647052 7:124239423-124239445 AGAGCAAAGTAAAAGCTGGAAGG - Intergenic
1031667392 7:124501642-124501664 ACATATAAATATTAGGTGGAGGG + Intergenic
1031718148 7:125134354-125134376 AGATCTAAGCAAAATGTTGAGGG + Intergenic
1032719967 7:134542845-134542867 ATATATAATAAAAATGTGGATGG - Intergenic
1033165661 7:139036364-139036386 AGAAATAGGTAAAAGGTGGTAGG + Intergenic
1036960095 8:13235365-13235387 AAATACAAGGAAAATGTGGAGGG + Intronic
1038560285 8:28571208-28571230 AGAAATAGGAAAATGGTGGATGG - Exonic
1038883547 8:31639851-31639873 ATAAATAAATAAAAGGAGGAGGG + Intronic
1039345823 8:36704276-36704298 AGATAAAAGTAAAATGTGGGTGG - Intergenic
1039871512 8:41549678-41549700 ATACAGAAGTAAAAGTTGGATGG - Intergenic
1041602815 8:59741305-59741327 AGATATAAGTTGATGGTGTAGGG - Intergenic
1041745955 8:61209683-61209705 AGATTTAAGGAAAAGGTGATTGG + Intronic
1042915470 8:73871085-73871107 AGAGATAAGTAAACGGATGAGGG + Intronic
1044327869 8:90880905-90880927 AGCTATAAGTGAAAACTGGAAGG - Intronic
1044792071 8:95857972-95857994 AGAGATAAGGAAAATGTAGAAGG + Intergenic
1045396557 8:101766434-101766456 ATATATAAGAAAAATCTGGAAGG - Intronic
1046592730 8:116225450-116225472 AGAAATAAATGGAAGGTGGAAGG - Intergenic
1047120368 8:121896711-121896733 AGACATAATTAAGAGTTGGAAGG + Intergenic
1047134282 8:122057894-122057916 AGATGTAAGTGAAAAGTAGAAGG + Intergenic
1047376967 8:124308587-124308609 ATAAATAAATAAATGGTGGAGGG + Intergenic
1047804099 8:128341158-128341180 AGTTATAAGTACAATGTGCAGGG - Intergenic
1048015972 8:130498336-130498358 ATAAATAAATAAAAGGAGGAGGG - Intergenic
1048755389 8:137732676-137732698 ATATATAAGCAAAGGGTTGAGGG + Intergenic
1048978812 8:139691929-139691951 AGATATAAGTAGAAGCTGTTGGG + Intronic
1050777263 9:9280826-9280848 ATATTGAAGGAAAAGGTGGAGGG + Intronic
1051097847 9:13487019-13487041 AAAAATAAGTAAAAGGAGGAAGG + Intergenic
1051180047 9:14401893-14401915 TCATATAAGCAAAAGGTGTAGGG - Intergenic
1051735354 9:20192408-20192430 AGAGCTGAGTTAAAGGTGGATGG + Intergenic
1051964907 9:22815979-22816001 ATATCTAAGCAAAATGTGGAAGG + Intergenic
1052321020 9:27167617-27167639 ATATATAATTAAAAGGTAGAAGG + Intronic
1052956554 9:34256927-34256949 AGATCTAACTAAAAGCTGGGTGG - Exonic
1053366821 9:37528686-37528708 TGATATAAGTGATAGGTGGGAGG - Intronic
1054969029 9:71062881-71062903 AGTTTTAAGTCAAAGGTGGAGGG - Intronic
1055501098 9:76902896-76902918 AGATTTAGGGAAAAGGAGGATGG + Intronic
1055884002 9:81037540-81037562 AGATTTAAGTAAAATGTAGTAGG - Intergenic
1055959497 9:81807137-81807159 ACATATAAGTAAATGGTGAAAGG + Intergenic
1056471379 9:86907311-86907333 TGATATAAGGAGGAGGTGGAGGG + Intergenic
1057176255 9:93002515-93002537 AGATTTCAGTAAAAGGTGTAGGG - Intronic
1057738046 9:97684915-97684937 ATAAAAAAGTAAAAGGTAGATGG - Exonic
1060021200 9:120132911-120132933 AGAAATGAGTAAAAGGAGTATGG + Intergenic
1060337462 9:122739205-122739227 AGATATAAGTAAGAGGGTGGGGG - Intergenic
1185808595 X:3083202-3083224 AGATACAAATAAATGATGGATGG - Intronic
1186720146 X:12295562-12295584 AGAAAAAACTAAAAGGAGGAAGG - Intronic
1187137786 X:16564988-16565010 ATACATAAGTAAAAGGTGATGGG + Intergenic
1188850810 X:35129494-35129516 AGATGTAAGGAAAAGGTGAATGG - Intergenic
1189654409 X:43226931-43226953 GAATATAACTCAAAGGTGGAAGG + Intergenic
1190386474 X:49886629-49886651 AGGTAAAAGAAAATGGTGGATGG + Intergenic
1190514048 X:51204782-51204804 ATATATAAATAAAAGGATGATGG + Intergenic
1192095669 X:68207975-68207997 AGAAAGAAGGAAAAGGAGGAAGG - Intronic
1192803739 X:74492397-74492419 TTATCTAAGTAAAAGGTAGAGGG + Intronic
1193530174 X:82646579-82646601 AGAAAAAAGTAAAAGATGCATGG - Intergenic
1193593329 X:83417515-83417537 AGATAGAATTCACAGGTGGAAGG - Intergenic
1193654371 X:84181875-84181897 AGATATATGAAAAGGGTGGAGGG - Intronic
1193661221 X:84260946-84260968 AGACCTAATGAAAAGGTGGAGGG + Intergenic
1193952118 X:87812505-87812527 AGATGTAAATAAAATGAGGAAGG + Intergenic
1194300017 X:92174712-92174734 AAATATAAGTAAAACATGGATGG - Intronic
1194511865 X:94806548-94806570 AGGAATATGAAAAAGGTGGATGG - Intergenic
1194514376 X:94832917-94832939 AGATAAAAGTAGAATTTGGATGG + Intergenic
1194585319 X:95726073-95726095 AGATATAAGTACAACGAGGTAGG - Intergenic
1195772528 X:108366731-108366753 AGATATAAATAAAAGGTGCATGG - Intronic
1196130413 X:112149447-112149469 AGATTTGAGTAAAAGGCTGAAGG + Intergenic
1196226406 X:113172567-113172589 AGATAAAACAAAAAGATGGAGGG + Intergenic
1196594394 X:117526730-117526752 TGATATCACTAAAAGGAGGAAGG - Intergenic
1197867233 X:131032273-131032295 AAATAAAAACAAAAGGTGGAGGG - Intergenic
1199303223 X:146237106-146237128 ATATACAAGTATAAGGTGGGAGG - Intergenic
1199405569 X:147454981-147455003 AGAGAAAAGTAAAACGGGGAGGG + Intergenic
1200131040 X:153846150-153846172 AGATAAAGGAAAAAGGTGCAGGG + Intergenic
1201553793 Y:15247322-15247344 AGAAACAAATGAAAGGTGGATGG + Intergenic
1201755237 Y:17480052-17480074 ATATATATATTAAAGGTGGATGG - Intergenic
1201846315 Y:18425933-18425955 ATATATATATTAAAGGTGGATGG + Intergenic