ID: 1029864771

View in Genome Browser
Species Human (GRCh38)
Location 7:103615578-103615600
Sequence GATCCCTGATGGTCTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029864771_1029864775 1 Left 1029864771 7:103615578-103615600 CCTCTGGGAGACCATCAGGGATC 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1029864775 7:103615602-103615624 TTAACATTGTGTTATGGAGAAGG 0: 1
1: 0
2: 1
3: 22
4: 370
1029864771_1029864773 -5 Left 1029864771 7:103615578-103615600 CCTCTGGGAGACCATCAGGGATC 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1029864773 7:103615596-103615618 GGATCCTTAACATTGTGTTATGG 0: 1
1: 0
2: 1
3: 16
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029864771 Original CRISPR GATCCCTGATGGTCTCCCAG AGG (reversed) Intronic
900179331 1:1304411-1304433 TGTCCCTGAGGGACTCCCAGCGG - Intronic
901773049 1:11540500-11540522 GATACCTCTTGGTCTCCAAGAGG - Intergenic
902209675 1:14895502-14895524 GACCCCTGATGTGATCCCAGGGG - Intronic
903740493 1:25555953-25555975 AATCCCGGAAGGCCTCCCAGGGG + Intronic
905262399 1:36729097-36729119 GATCCCTGAAGGACCCCCCGAGG - Intergenic
911815578 1:102345233-102345255 CTTCCCTGATGGGCTTCCAGGGG - Intergenic
916371946 1:164108183-164108205 TCTGCCTGGTGGTCTCCCAGAGG + Intergenic
916470845 1:165120682-165120704 GATCCCTCAAGGTCATCCAGTGG + Intergenic
918215906 1:182391844-182391866 GTGCCCTGATTGGCTCCCAGCGG + Exonic
918676203 1:187289139-187289161 GATCCTTGGTGTTCTCCCATAGG + Intergenic
919983259 1:202655817-202655839 GATCTCTGATGTCCTCCCACTGG + Intronic
924299867 1:242626437-242626459 GATCACTGAAGGGCTCCAAGGGG - Intergenic
1068414927 10:56708247-56708269 GATGCCTGATGGACTCTGAGAGG - Intergenic
1068746337 10:60534953-60534975 GATCCCTGAAGGTTTAACAGTGG - Intronic
1072371757 10:94771640-94771662 GATGCCTGATTGTCTCTCATCGG + Intronic
1073284697 10:102380604-102380626 GTTCCCAGGTGATCTCCCAGAGG - Exonic
1074058523 10:109943698-109943720 GGTCCCTGGTGGTCTCTCTGTGG - Intronic
1076547775 10:131257295-131257317 GGTCCCTGCTGCCCTCCCAGGGG - Intronic
1078339285 11:10487449-10487471 GAGCCCTGAAGTTCTCACAGGGG - Intronic
1079826202 11:25198029-25198051 GATCCTTGATGATCTACTAGTGG - Intergenic
1083623921 11:64062310-64062332 GAGCCCTGGGTGTCTCCCAGAGG + Intronic
1086879487 11:92136974-92136996 CATCCCTGATAGCCTCCTAGTGG - Intergenic
1088291319 11:108241165-108241187 TGTCCCTGAAGATCTCCCAGGGG - Intronic
1090183054 11:124717884-124717906 CCTTCCTGATGGTCTCACAGAGG - Intergenic
1090199743 11:124845696-124845718 CATCTCTGATGCTCTCCCAGTGG - Intergenic
1091441871 12:517324-517346 AATCCCTGATCTTCTCCCATGGG - Intronic
1092744117 12:11657629-11657651 GAGGCCTGATGGCCTCCCTGGGG + Intronic
1094271436 12:28621413-28621435 AATCACTGGTGGTCTCACAGGGG - Intergenic
1096080805 12:48831078-48831100 GATTCCTTATGGTGTCCCACTGG - Intronic
1096969529 12:55654695-55654717 GATCCATGTTGCACTCCCAGAGG + Intergenic
1101826865 12:108227188-108227210 GACCCCAGATGCACTCCCAGTGG + Intronic
1103043210 12:117712707-117712729 AAGCCCTGGTGGTCTGCCAGTGG - Intronic
1103956041 12:124577411-124577433 GATCCTGGAGGGTCTCCCTGAGG + Intergenic
1104637117 12:130444797-130444819 GCACCCTCAGGGTCTCCCAGAGG - Intronic
1104916598 12:132268785-132268807 GCTCCCTGATGGCCGCCGAGGGG - Intronic
1104959199 12:132480151-132480173 CATCCCTGTGGCTCTCCCAGAGG - Intergenic
1118891215 14:69910833-69910855 TATCCTTGATGGCCTCCCAGAGG - Intronic
1119394986 14:74319635-74319657 GATGCCTGTTGGACACCCAGTGG + Intronic
1119429865 14:74559571-74559593 GATCCCTGGTGGTCTCCAATTGG + Intronic
1124378871 15:29147679-29147701 GAACCCTCATGGTCTCACGGTGG + Intronic
1127490640 15:59459414-59459436 AATCCCTGATGGTCACTCATGGG + Intronic
1130731996 15:86505413-86505435 TATGCTTGATGGTGTCCCAGTGG + Intronic
1132385186 15:101395335-101395357 CATCCCTAATGAGCTCCCAGGGG + Intronic
1132629983 16:912625-912647 GACGCCTGCTGGTCTCTCAGCGG + Intronic
1135047000 16:19164269-19164291 GATCACAGAAGGTTTCCCAGAGG - Intronic
1138221717 16:55257151-55257173 AATCCCTCTTGGTTTCCCAGAGG - Intergenic
1139681727 16:68570225-68570247 GATCCCTGATGGATTCCATGTGG + Intronic
1140507880 16:75485815-75485837 GGGACCTGATGGTGTCCCAGTGG + Intronic
1140692919 16:77501520-77501542 GTCCACGGATGGTCTCCCAGGGG - Intergenic
1147882463 17:43662907-43662929 GCGCCCTGCTGGTCTCTCAGAGG + Intergenic
1153598418 18:6753715-6753737 GAGTTCTGATGGTCTTCCAGAGG + Intronic
1156300515 18:35832428-35832450 GGTCTCTGATCATCTCCCAGGGG + Intergenic
1158480312 18:57816243-57816265 GATTCCTGTTGGTCCCCCACAGG + Intergenic
1160214567 18:76916950-76916972 GACCCCAGATGGTCTCACTGTGG - Intronic
1163021372 19:14482640-14482662 GGTCCCTGATGGTGGACCAGAGG - Intronic
1167954948 19:53057141-53057163 GATGCCTGCTGGACTCCCAGAGG + Intergenic
925259500 2:2517492-2517514 GACCCCTCCTGGTCACCCAGAGG + Intergenic
926756434 2:16240111-16240133 AATCCGTGAGGGTCTCCCTGGGG - Intergenic
926796800 2:16626196-16626218 GACCCCTGATGGGCACCAAGGGG + Intronic
927155477 2:20218981-20219003 GACCCTTGAGGGGCTCCCAGTGG + Intronic
927505387 2:23610033-23610055 GATCCCTGAGGGACTGTCAGGGG - Intronic
928789352 2:34932479-34932501 GATGCCTGATGATCTTGCAGTGG + Intergenic
928898382 2:36291753-36291775 GATCCCAGAGGGTGTCTCAGTGG + Intergenic
932378207 2:71257012-71257034 GGTCCCTGAAGCTCTCTCAGGGG + Intergenic
937990482 2:127659417-127659439 GCTCCCTGCTGGTCTCCACGGGG + Intronic
938383050 2:130847358-130847380 GAGCCCTCATGGGCACCCAGAGG + Intronic
939338804 2:140867057-140867079 GATACCTCATGGTATCCCAGTGG + Intronic
946016793 2:216610482-216610504 GATCCATGTTGGGTTCCCAGAGG + Intergenic
946432087 2:219631403-219631425 GGCCCCTGATGGACTCCCACAGG - Intronic
948259854 2:236595611-236595633 GATCCCTCAGGGTCTACCCGTGG + Intergenic
948363957 2:237442633-237442655 GCTCCCTGATGGGCTGGCAGAGG - Intergenic
948775816 2:240288283-240288305 GACACCAGCTGGTCTCCCAGTGG - Intergenic
948775872 2:240288483-240288505 GATACCAGCCGGTCTCCCAGTGG - Intergenic
1173595860 20:44258049-44258071 GGGCCCTGATGCCCTCCCAGTGG - Intronic
1175996151 20:62813156-62813178 GGTCTCCGATGGGCTCCCAGGGG - Exonic
1176005486 20:62860626-62860648 CATCCCTGAGGGTCGCCAAGGGG + Intronic
1178147738 21:29759051-29759073 GATTTCTGAAGGTCTCACAGAGG - Intronic
1178254832 21:31043024-31043046 GAGCCCTGATGTTCTACCAAGGG + Intergenic
1179270676 21:39848165-39848187 GATTCCTCCTGGTTTCCCAGGGG + Intergenic
1180877783 22:19183017-19183039 GCTCCCTGAGGAGCTCCCAGTGG - Intronic
1182713990 22:32340654-32340676 GAGCCCTGCTGGTATCCCGGAGG + Intergenic
1184369924 22:44075827-44075849 GTTCCCTGTTTGCCTCCCAGAGG + Intronic
1184417238 22:44359435-44359457 TGTCCCTGATGGACACCCAGAGG - Intergenic
952510379 3:34047677-34047699 GAGCCCTGATGGCCTCCCAAAGG - Intergenic
952781660 3:37106144-37106166 GACCCCTGATGGGATCCCAAAGG - Intronic
953902108 3:46849276-46849298 GAGCCCTGCAGGTCTCCCTGGGG - Intergenic
961662692 3:128478150-128478172 GATCCCTGATGGTCTGCATTTGG - Intergenic
968914596 4:3491937-3491959 GATCACTGCTTGTCCCCCAGAGG + Intronic
968958094 4:3729111-3729133 AATCCCCGATGGTGACCCAGAGG + Intergenic
969577299 4:8043872-8043894 GATTACTGAGGGGCTCCCAGAGG + Intronic
974626190 4:64431226-64431248 GCTCCCTGCAGGTCTGCCAGAGG - Intergenic
977319704 4:95497566-95497588 AATCACTAATGGTCTCTCAGTGG + Intronic
977577335 4:98689465-98689487 GATTCATAATGGTCTCCCATGGG + Intergenic
981508219 4:145526641-145526663 GATTCCTGTTTTTCTCCCAGTGG - Intronic
981843213 4:149136230-149136252 GATCCCTGTTACTCTCCCACTGG - Intergenic
983477014 4:168225652-168225674 GTTCCTTGATGATCTCCCTGAGG - Exonic
984654651 4:182304827-182304849 GATCCCTTATTGTCCTCCAGTGG + Intronic
986268452 5:6210838-6210860 CAGCCCTGATGATCTCCAAGTGG - Intergenic
996029641 5:118690742-118690764 GACCCCTTATGGTCCCTCAGTGG + Intergenic
996619157 5:125479055-125479077 GATCCCTCTTGGGATCCCAGGGG - Intergenic
997233955 5:132261941-132261963 GATCCCAGAGAGGCTCCCAGAGG + Intronic
997261584 5:132469485-132469507 TATCCCAGATGGTTTCCCAGTGG - Intronic
997736345 5:136215372-136215394 GATCCCTGATGTTCTGCCTGTGG + Intronic
1001883024 5:175261425-175261447 GATCCCTGACAGTGTCACAGTGG + Intergenic
1003184046 6:3815192-3815214 AGTCACTGATGGACTCCCAGAGG - Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1006093543 6:31642206-31642228 GCTCCCTGCTGGGCTCCCTGGGG - Exonic
1006812630 6:36829880-36829902 GAATCCTGATGGTCCCACAGAGG + Intronic
1007254001 6:40515989-40516011 GAGGCTTGATGGTTTCCCAGGGG + Intronic
1011674606 6:89720254-89720276 AACCCCTGATGTTCTACCAGAGG + Intronic
1015862583 6:137696335-137696357 GAATCCAGAGGGTCTCCCAGTGG - Intergenic
1019143036 6:169960211-169960233 GAGCCCTCAGGGCCTCCCAGGGG + Intergenic
1019560564 7:1654478-1654500 GATCCCCGAGGGGCTCACAGAGG + Intergenic
1026482459 7:70790414-70790436 GGTCCCGGATGGGGTCCCAGTGG - Exonic
1029499741 7:100921362-100921384 CAAGCCTGATGGTCTCCCATTGG + Intergenic
1029864771 7:103615578-103615600 GATCCCTGATGGTCTCCCAGAGG - Intronic
1030276892 7:107731047-107731069 TATCCCTGATGACCTTCCAGTGG - Intergenic
1032491942 7:132330310-132330332 GGTCACTGCTGGTGTCCCAGAGG - Intronic
1033420291 7:141199486-141199508 GGTGCCTGGTGGTCCCCCAGTGG + Intronic
1035114383 7:156510615-156510637 GCTCCCCAGTGGTCTCCCAGTGG - Intergenic
1035176440 7:157055370-157055392 GTTACCTGATGGTCTCACTGGGG + Intergenic
1035437100 7:158867462-158867484 GATCCGCGCTGGTCTCCCCGAGG - Intronic
1047541610 8:125772225-125772247 TATACTTGATGGTGTCCCAGAGG + Intergenic
1049457781 8:142702494-142702516 GAGCCCTGAAGATCTCCCTGTGG - Intronic
1049704156 8:144032105-144032127 TATGCTTGATGGTGTCCCAGAGG + Intronic
1051418711 9:16870451-16870473 GATCCCCGCTGCGCTCCCAGTGG - Intronic
1052381282 9:27773640-27773662 TAGGTCTGATGGTCTCCCAGGGG - Intergenic
1054714159 9:68540743-68540765 GTTTCCTGATGGTCTGCCTGGGG - Exonic
1056295305 9:85187203-85187225 GTTCCCTGAGGGGCTCCAAGTGG - Intergenic
1057142913 9:92738349-92738371 GGTCCCTGATGGTCCCCCCAAGG + Intronic
1060884762 9:127143269-127143291 AATCCCTGATGCTTTCCCAAAGG + Intronic
1185488822 X:503801-503823 GAACCCTGATGTTATCCTAGGGG - Intergenic