ID: 1029866626

View in Genome Browser
Species Human (GRCh38)
Location 7:103638308-103638330
Sequence CCTCATTAGCATCTCTAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029866626 Original CRISPR CCTCATTAGCATCTCTAACA GGG Intronic
901390229 1:8940854-8940876 CACTATTAGCATTTCTAACATGG - Intergenic
902892418 1:19453905-19453927 CCTCATTTTCATCTGTAAAATGG - Intronic
905763848 1:40583755-40583777 CCACTTTAGCATCTTTTACAAGG + Intergenic
906015992 1:42580126-42580148 CCTCATTGGCTTCTCTGTCAAGG - Intronic
908652940 1:66355964-66355986 CTCCATTAGCTTCTCTGACATGG + Intronic
912220999 1:107675359-107675381 CCTGCTTATCATCTCTAAAATGG - Intronic
913281834 1:117192375-117192397 CTTCTTTAGCATCTCTCATAAGG - Intronic
916190023 1:162169386-162169408 CCTCATTAGCACCCCCAGCAGGG - Intronic
916200851 1:162270317-162270339 CCTCTTTAGCATCTATTACGGGG - Intronic
916320034 1:163493840-163493862 TCTCATTAGCATTTCTTATAAGG - Intergenic
917460585 1:175225755-175225777 CCTCATTAGCATCCCCAGAATGG + Intergenic
918173733 1:182024534-182024556 CCTCATTACCATCTCTCACTTGG + Intergenic
919021173 1:192107969-192107991 CCTCTTTACCTTTTCTAACAAGG - Intergenic
921310758 1:213840863-213840885 CCTCTCTAGCATCCCTAACGTGG - Intergenic
1065636435 10:27740977-27740999 CATCATTTGCATCTCTTACAAGG - Intronic
1071597011 10:86935624-86935646 TCTTGTTAGCATCTCTAACCAGG - Exonic
1074660638 10:115653325-115653347 ACTCATTAGCATCTAGTACAAGG + Intronic
1075530340 10:123223693-123223715 CCTTATTAGCCCCTCTCACAAGG + Intergenic
1075649740 10:124119627-124119649 CCTCATCATCATCTCTAAAGTGG + Intergenic
1075966030 10:126612470-126612492 TCTGATTAGCGTCTCTCACAGGG - Intronic
1077799795 11:5526262-5526284 CTTCATTAGCTTCTCTAGCCTGG + Intronic
1078294979 11:10058621-10058643 ACTGATTGGCCTCTCTAACAAGG - Intronic
1083403649 11:62441891-62441913 CCATATTAGCATCTCTAACAGGG - Intronic
1087919666 11:103852052-103852074 CCTCATTAGAATCAAGAACATGG - Intergenic
1089277089 11:117344612-117344634 CCTCCTTAGCATGTCTAAGTTGG + Intronic
1093078093 12:14777683-14777705 CCTCAGTTTCATCTCTAAAATGG + Intronic
1093508148 12:19893551-19893573 CTTCCTTGGCATCTCTAAAATGG - Intergenic
1093600831 12:21020208-21020230 AGTAATTGGCATCTCTAACAGGG - Intronic
1093914297 12:24783698-24783720 CCCCATGATCATCTCTAACAGGG - Intergenic
1095811255 12:46374546-46374568 CCTCCTTAGCACCTCTAACTGGG - Intergenic
1096323579 12:50637582-50637604 CCTCCTTAGCATGTATCACAAGG + Intronic
1097995592 12:65884304-65884326 CCTCTTCAGCATCTCTAATCTGG - Intronic
1102381184 12:112468172-112468194 CCTCATTAGCATCCCTGCCAAGG + Intronic
1103141253 12:118550353-118550375 TCTCATTACAAACTCTAACACGG + Intergenic
1109091294 13:58049613-58049635 CCTCATCACCACCTCTACCAGGG - Intergenic
1109661798 13:65469341-65469363 CATCATTTGCATCTCTAAGTGGG + Intergenic
1109979972 13:69894873-69894895 CCTAACTAGCACCTCTATCATGG + Intronic
1110020823 13:70469244-70469266 CCTCATTAGTTTCTGTATCAAGG - Intergenic
1111576683 13:90163390-90163412 CCTCCTTAGCTGTTCTAACAAGG - Intergenic
1113189075 13:107722723-107722745 CCTCATTTCCATCTGTAAAATGG + Intronic
1113437257 13:110302904-110302926 CCTCATTAAAATGTCTCACAAGG - Intronic
1114924535 14:27378327-27378349 TCTCTTTAGCATTTCTCACAGGG - Intergenic
1121715332 14:96069931-96069953 GCTCATTAGCATTTCTTCCAGGG + Intronic
1122801299 14:104230957-104230979 GCTCATTATCATTTCTAATATGG - Intergenic
1124292117 15:28462646-28462668 TCTCATAAACCTCTCTAACATGG + Intergenic
1126097423 15:45099497-45099519 CCTGGTTGGCATCTCTAACAGGG - Intronic
1128091999 15:64925589-64925611 CTTCATTAGCAGCTGTATCAAGG + Intronic
1136092598 16:27931206-27931228 CTTCATTAGCAGCTCTGAGATGG - Intronic
1136706668 16:32195030-32195052 TCTCATAAACCTCTCTAACATGG - Intergenic
1136761243 16:32734387-32734409 TCTCATAAACCTCTCTAACATGG + Intergenic
1136806860 16:33135999-33136021 TCTCATAAACCTCTCTAACATGG - Intergenic
1139451465 16:67030543-67030565 CCTCATCAGCACCTCCAACAAGG - Intronic
1203063396 16_KI270728v1_random:994704-994726 TCTCATAAACCTCTCTAACATGG + Intergenic
1142562213 17:816961-816983 CCTCCTTGGCATCTCCAACTTGG + Intronic
1149223863 17:54445427-54445449 CCTAATTAGGACATCTAACAGGG + Intergenic
1151374910 17:73681528-73681550 CCTCATGAGCATCCCAAACATGG - Intergenic
1152247558 17:79193057-79193079 CCTCATTAGCATCTCCTGAAAGG + Intronic
1154173125 18:12064768-12064790 CCCCAGGAGCCTCTCTAACATGG + Intergenic
1157433980 18:47653209-47653231 CCTCATTAGAATCCCGAACTTGG - Intergenic
1158387012 18:57006140-57006162 CCTTAATAGCATCTGTAATAAGG + Intronic
1162450710 19:10752701-10752723 CCTCATTTGCATCTGTAAAATGG + Intronic
925705851 2:6684216-6684238 CCTTCTTAGCATCTCCAATAAGG + Intergenic
928395804 2:30942564-30942586 ACTCATTAGCATATCTCCCATGG + Intronic
930294515 2:49537801-49537823 TCTCTTTAGCATTTCTTACAGGG - Intergenic
932640491 2:73440987-73441009 CCACATAAGCATCACCAACAGGG - Intronic
937220997 2:120343399-120343421 CCTCCTTAGAATCTCCACCAGGG - Intergenic
937983099 2:127626405-127626427 CCTCATTAGCATCTGTAGGGCGG - Intronic
940685041 2:156838195-156838217 TCTCATTTGCTTCTCTAGCAGGG + Intergenic
941055076 2:160778001-160778023 ACTCATTAGCATCCCTAAAAGGG + Intergenic
941629586 2:167869285-167869307 CCTCATCAGCACCACTCACAAGG + Exonic
942836527 2:180305472-180305494 CCTCATTATCATCTTTAAAAAGG - Intergenic
945115707 2:206406180-206406202 CTTCAGTATCATCCCTAACATGG + Intergenic
946331570 2:219012269-219012291 TCTCATTAGCATCTCAAACTTGG + Intronic
947134727 2:226965772-226965794 CCTCTGTAGCCTCTCAAACATGG - Intronic
1172571989 20:35977713-35977735 ACTCATTAGCATCACTCAGAGGG - Intronic
1174739877 20:53002188-53002210 CCTCTTTGTCATTTCTAACATGG - Intronic
1175631968 20:60548578-60548600 TCTCTTTAGCATTTCTTACAGGG + Intergenic
1177930373 21:27274843-27274865 TTTCATTAGCATCTTTAATAGGG + Intergenic
1178025907 21:28466514-28466536 CCCCATTAGCTTCTCTGATATGG - Intergenic
1178267383 21:31156101-31156123 CCTCATTAGCATATCCAAAAGGG + Intronic
1182219805 22:28749187-28749209 ACTCTTTAGCATCCCTTACAGGG + Intronic
1182652857 22:31866136-31866158 TCTCAGAGGCATCTCTAACAGGG + Intronic
949317406 3:2772088-2772110 GCTCATTACCATGTCAAACAAGG - Intronic
956208390 3:66777576-66777598 CCTCGTGAGGATCTCTAAAAAGG - Intergenic
958507679 3:95001660-95001682 ACTAATTTGCATCTCTAACTAGG + Intergenic
959361419 3:105398128-105398150 CCAAATTTGCATTTCTAACAAGG + Intronic
960348287 3:116561972-116561994 CCTTTTCAGCATCTCTAAAATGG + Intronic
960517191 3:118615428-118615450 CCTAATTTACATCTCTAACAAGG + Intergenic
961808765 3:129508467-129508489 CTTCATTCTCATCTGTAACATGG - Intronic
962775480 3:138655290-138655312 CCTTTATAACATCTCTAACAGGG + Exonic
963916300 3:150861742-150861764 ACCCATTAACATCTCTCACATGG - Intergenic
965986040 3:174754180-174754202 TCTCATTAGAATCCCTACCAAGG - Intronic
966507689 3:180725331-180725353 CATCACTAGCACATCTAACATGG + Intronic
967378558 3:188832261-188832283 CCTCATGAGCTTCTCTCATATGG - Intronic
967781249 3:193442435-193442457 CCTCATCAGCATCTATATCTTGG - Exonic
970596122 4:17601982-17602004 GCTCATTAGCATCTCTCCCAAGG - Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
974334999 4:60531182-60531204 GCTCTTTAGCATCTCTTTCAAGG + Intergenic
976330826 4:83829343-83829365 TATCATTACCATCTGTAACAGGG - Intergenic
976494937 4:85717170-85717192 CCTAATTCCCATTTCTAACAGGG + Intronic
982759004 4:159258212-159258234 TCTCTTTAGCAGCTCTAAAAAGG - Intronic
985941771 5:3142077-3142099 CCACAGTAGCATCTCTAACATGG - Intergenic
986229576 5:5850609-5850631 ACTCATTGGCATCTCTGAAAGGG + Intergenic
990451178 5:55933011-55933033 CCTCCTTCGCATCTCAAACCTGG - Intergenic
991179406 5:63732252-63732274 CATCATTGGCATCTACAACATGG + Intergenic
999017751 5:148127028-148127050 CCTCTTGAGAAGCTCTAACATGG - Exonic
999506049 5:152197479-152197501 TCCCATTAGCATCTGTAACTAGG - Intergenic
1000267172 5:159648537-159648559 CCTCATCAACATCTAGAACAGGG + Intergenic
1002772609 6:302548-302570 CCTCATGAGCAGCTCACACAGGG - Intronic
1002931664 6:1639198-1639220 CCTCAGTGGCATCCTTAACATGG - Intronic
1003769725 6:9286006-9286028 CCTCAGTTGCATCTATAAAATGG + Intergenic
1007022187 6:38532024-38532046 CCTCTTTAGCACCTCTTTCAGGG - Intronic
1007314704 6:40977853-40977875 ACTCATTAGCATCCCTGAAAAGG - Intergenic
1007330585 6:41104200-41104222 TCACATTTTCATCTCTAACAGGG - Intergenic
1007661064 6:43486676-43486698 CCTAATTAGCATCCCTAGAAAGG + Intronic
1009041867 6:58189848-58189870 CCTCAAAAGCATCTGAAACAGGG + Intergenic
1011392498 6:86869097-86869119 GATCATTAGCTTCTCTAGCAAGG - Intergenic
1015699935 6:136024651-136024673 CATGACAAGCATCTCTAACAAGG - Intronic
1015884227 6:137899852-137899874 CCTGCTTAGAATTTCTAACATGG - Intergenic
1016504133 6:144758918-144758940 CCTTTTTATCATTTCTAACATGG + Intronic
1017281198 6:152628010-152628032 CTGCATTAGCATGTCTTACATGG - Intronic
1022245010 7:28550699-28550721 CCTCATTGGCTTCACTAGCATGG - Intronic
1022829082 7:34046613-34046635 CCTCACTTGCATCTGTAACTGGG + Intronic
1024298486 7:47865215-47865237 CCTCGTGAGCTTCTCTAATAAGG - Exonic
1025636314 7:63322728-63322750 CCTCATTTACCTCTCTAAGAAGG - Intergenic
1025646382 7:63425448-63425470 CCTCATTTACCTCTCTAAGAAGG + Intergenic
1025839179 7:65128010-65128032 GCTCAGTAGTATCTTTAACATGG + Intergenic
1025883889 7:65567955-65567977 GCTCAGTAGTATCTTTAACATGG - Intergenic
1025889556 7:65634651-65634673 GCTCAGTAGTATCTTTAACATGG + Intergenic
1027897213 7:84061136-84061158 CCTCATTCACTTCTCTAAGAGGG + Intronic
1027904207 7:84158506-84158528 CCTCATAAGAAAATCTAACAGGG - Intronic
1028597652 7:92563646-92563668 CCTCATTAACAGCTCTACCTGGG + Intronic
1029866626 7:103638308-103638330 CCTCATTAGCATCTCTAACAGGG + Intronic
1029996994 7:105015479-105015501 CCTTATTCACATCTCTAAAAAGG - Intronic
1031094913 7:117405739-117405761 CCTCTTCAGCCTCTCAAACATGG - Intronic
1031177430 7:118370885-118370907 CATCATTAGCATCACTAAAATGG - Intergenic
1031390381 7:121206184-121206206 CTTCATTAGCATCTCAAGGAAGG - Intronic
1031852900 7:126887327-126887349 GCTCAGTAGTATCTTTAACATGG - Intronic
1035391888 7:158509632-158509654 CCTCATTTCCATCTCTGTCATGG + Intronic
1035551352 8:529524-529546 TCTCTTTAGCATTTCTTACAAGG + Intronic
1040320069 8:46288279-46288301 CTTCATTATCATTTTTAACATGG + Intergenic
1041257719 8:55993597-55993619 CCTCATTTGCATCTGTACAATGG + Intronic
1041435383 8:57833910-57833932 CCCAATTAGCATCTATAAAATGG - Intergenic
1042977839 8:74490427-74490449 TCTCATCAGCTCCTCTAACAGGG + Intergenic
1045039752 8:98211887-98211909 ACTCATTTTCAACTCTAACAAGG + Intronic
1046691144 8:117285975-117285997 CCTACTGCGCATCTCTAACATGG - Intergenic
1055690053 9:78820357-78820379 CCTCATTAGAACCTCTAAGGAGG + Intergenic
1056582270 9:87898530-87898552 TCTCATTAGCATTTCTTGCAGGG - Intergenic
1056807435 9:89739975-89739997 CATCATTAATATCTCCAACAAGG + Intergenic
1056876773 9:90340819-90340841 TTTCATTAGGATCTCTAACAGGG + Intergenic
1058675021 9:107392922-107392944 CTTCCTTAGCATCTCTCACCTGG + Intergenic
1059778949 9:117506734-117506756 ACTCATTGGCATCTCTGAAAGGG - Intergenic
1187263582 X:17709905-17709927 TCTGACTAGCATCTCTGACAGGG + Intronic
1188555235 X:31404323-31404345 CTTCATTTGCAACTCTGACATGG + Intronic
1191116996 X:56863055-56863077 GCTCCTTAGTAACTCTAACAGGG - Intergenic
1193482799 X:82047926-82047948 AATCATTAGCATCCCTAAAAGGG + Intergenic
1194803201 X:98296571-98296593 CCTCATTATCATATCTAGAATGG - Intergenic
1200024891 X:153249631-153249653 CCTCCTTAGCAGTTTTAACACGG + Intergenic
1200744021 Y:6887191-6887213 TCTCATTAGCATTTCTAATATGG - Intergenic