ID: 1029866702

View in Genome Browser
Species Human (GRCh38)
Location 7:103639181-103639203
Sequence GTAGTTTTACTAGAAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029866700_1029866702 0 Left 1029866700 7:103639158-103639180 CCAGTGTTTTGGAATGGGAGTTG 0: 1
1: 0
2: 2
3: 9
4: 171
Right 1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG 0: 1
1: 0
2: 3
3: 18
4: 219
1029866696_1029866702 23 Left 1029866696 7:103639135-103639157 CCAATGTTTCATAGATCTACTGA 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG 0: 1
1: 0
2: 3
3: 18
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029866702 Original CRISPR GTAGTTTTACTAGAAAACAC AGG Intronic
900229621 1:1550001-1550023 GTATTTTTAGTAGAGAAGACGGG - Intronic
900279880 1:1859837-1859859 GTATTTTTAGTAGAGAACAGGGG - Intronic
904358567 1:29957615-29957637 GTAGTTTTACGAGAAAAAACAGG - Intergenic
904980269 1:34494980-34495002 GAAGTTTAACAAGAAAACACAGG - Intergenic
905463850 1:38138370-38138392 GTAGTTTTAAAAGAACACAGTGG - Intergenic
908615558 1:65917857-65917879 ATATTTTTACTTTAAAACACTGG + Intronic
908866866 1:68557725-68557747 GTAGATGTACTAGAAAAAAAAGG - Intergenic
909237322 1:73170134-73170156 ATAGTTTTGTTAGGAAACACTGG - Intergenic
910022726 1:82611802-82611824 GAAGTTTTATAAGAAAACCCAGG - Intergenic
910310818 1:85822614-85822636 GTAGTTTGACTATGTAACACAGG - Intronic
910510258 1:87995721-87995743 GTACTTTTACTTGAAAATAAAGG + Intergenic
911112115 1:94200027-94200049 GAAATTTTAGTAGAAATCACAGG + Intronic
911658341 1:100470786-100470808 GAAGTTTTACTACAAAATGCTGG + Intronic
913965365 1:143372704-143372726 ATACTTTTACTAGAAAGAACTGG - Intergenic
914059741 1:144198306-144198328 ATACTTTTACTAGAAAGAACTGG - Intergenic
914119409 1:144768065-144768087 ATACTTTTACTAGAAAGAACTGG + Intergenic
915582032 1:156819176-156819198 GTATTTTTAGTAGAAAATAATGG + Intronic
916209128 1:162344534-162344556 GTATTTTTAGTAGAAAATACAGG - Intronic
919556434 1:199060419-199060441 GTAGTTTTAAAATAAAACATTGG + Intergenic
921239770 1:213166879-213166901 GTAGGTTCACCTGAAAACACTGG + Intronic
921295155 1:213694436-213694458 GTAGTTTTAGGAGAAAAGGCTGG - Intergenic
921856225 1:219987947-219987969 AAAGTTCTACTAGAAAGCACTGG + Intronic
924242272 1:242052823-242052845 AAAGTTTTACAAGAAAACATTGG + Intergenic
1062765060 10:55586-55608 AAAATTTTACAAGAAAACACTGG - Intergenic
1064180838 10:13113195-13113217 GTATTTTTAATAAAAAAGACAGG + Intronic
1065057933 10:21866222-21866244 GTAGTTTTATTACATAACAATGG + Intronic
1065410257 10:25418506-25418528 GTTGTTTTAGAAGAACACACTGG - Intronic
1065568813 10:27046632-27046654 TTAGAATTACTAGAAAACATTGG - Intronic
1070225652 10:74502188-74502210 GTAGTTTAAAAAGAAATCACTGG - Intronic
1072773215 10:98161584-98161606 GAAGTATTAGAAGAAAACACAGG - Intronic
1073071291 10:100795001-100795023 GTTATTTTCCTTGAAAACACAGG + Intronic
1074615919 10:115068002-115068024 GGGGCTTGACTAGAAAACACTGG + Intergenic
1074964328 10:118475513-118475535 GTAATTTTACTAAAAAAAAACGG - Intergenic
1078072397 11:8124896-8124918 GTAGAATTTCTAGAAAACATGGG + Intronic
1078925988 11:15875501-15875523 GTAGCTTTGCTAGAGCACACAGG + Intergenic
1079280768 11:19085093-19085115 GCAGTTTTCCTTGGAAACACAGG - Intergenic
1079386754 11:19987169-19987191 GTAGTTATATCAGAAAACAAAGG + Intronic
1079878140 11:25887097-25887119 GTAGTTATTATAGAAATCACAGG - Intergenic
1080754871 11:35187503-35187525 GTATTTTAATTAGAAAACAGTGG - Intronic
1084071228 11:66736737-66736759 TGAGTTGTACTAGAAAACCCAGG + Intergenic
1085959127 11:81438749-81438771 TTATTATTACAAGAAAACACGGG - Intergenic
1086517832 11:87634211-87634233 GTATTTTAAATAGAGAACACAGG - Intergenic
1086612941 11:88778668-88778690 ATAGTTTTATTAGACAACATTGG + Intronic
1090581126 11:128160092-128160114 GAAGTTGTACTGGAAAACAAAGG + Intergenic
1092208114 12:6628940-6628962 GTATTTTTAGTAGAGAAGACTGG + Intronic
1092934541 12:13348372-13348394 TAAGTTTTAGTAGAAAACAGGGG + Intergenic
1092935017 12:13353062-13353084 GTAGTTCTACTAGCAAGGACCGG - Intergenic
1094291909 12:28860521-28860543 TTATTTTTAGTTGAAAACACTGG - Intergenic
1097515232 12:60596274-60596296 GTAGTTTTATGTAAAAACACTGG - Intergenic
1097541325 12:60947355-60947377 GTGGTTTTATTAGAAAAAAGCGG + Intergenic
1099263361 12:80412443-80412465 CTAGTGTTACTAAAAAAAACTGG - Intronic
1099454765 12:82850336-82850358 GTAGTGTTAATAGAAGACCCTGG + Intronic
1099560152 12:84163233-84163255 GTAGTTTAAAAAGCAAACACCGG - Intergenic
1106685111 13:32050319-32050341 GTAATTTTCATAGAAAACAAAGG + Intronic
1107160325 13:37218266-37218288 TTAGTTTTATAAGAAAACACTGG + Intergenic
1107191943 13:37599174-37599196 TTATTTTTACCAGAAAACAAAGG + Intergenic
1107455897 13:40554201-40554223 TTAGTTTAACTAGAAAAAAATGG - Intergenic
1108066236 13:46580460-46580482 GTAGCATTACAAGAAAACATGGG - Intronic
1108104410 13:46993136-46993158 GTAATTATAATAGAAGACACAGG + Intergenic
1108808840 13:54194997-54195019 GTAGATTTTCCAGAAATCACAGG - Intergenic
1111482688 13:88852113-88852135 TTAATTTTAGTAGAAAACAAAGG + Intergenic
1113290155 13:108896795-108896817 GTAGTTTTAGTAGTAGAGACAGG - Intronic
1115489776 14:33948064-33948086 TTAGTTTTTCTTGAAAACACGGG + Intronic
1115619166 14:35123630-35123652 GAAGATTTAAAAGAAAACACCGG + Exonic
1115959519 14:38819784-38819806 GTTGTTTTGTTAGGAAACACAGG + Intergenic
1116532838 14:45994143-45994165 TTAGTTTTTATAGGAAACACAGG - Intergenic
1117423150 14:55568088-55568110 ATAGTTTTAGAAGAAAACATAGG - Intronic
1117581880 14:57159372-57159394 GCAGTATTATTAGATAACACAGG + Intergenic
1118079576 14:62342852-62342874 GTAGTCTTACTATAAAAAGCTGG + Intergenic
1121168446 14:91832684-91832706 TCAGTTTTGCTGGAAAACACCGG - Intronic
1121420942 14:93813586-93813608 GGAATTAAACTAGAAAACACTGG + Intergenic
1121885781 14:97541527-97541549 GTAGTTTGACAAGAAAAAAGAGG + Intergenic
1121903954 14:97722733-97722755 ACAGTGTTACTAGAAAACATCGG + Intergenic
1124804163 15:32864283-32864305 GTGGTATTACTGGAAATCACAGG + Intronic
1127018628 15:54718882-54718904 GTAGTTGAATTAGAAAACAAAGG - Intergenic
1127065645 15:55235168-55235190 GTAGTTTTAATTTAACACACAGG + Intronic
1127083255 15:55401059-55401081 GAAGTATTAGTAGAAAATACAGG - Intronic
1127201005 15:56650784-56650806 GTAGATATACAAGAAAACAGAGG + Intronic
1128932179 15:71715239-71715261 GTAGTTAACCTAAAAAACACAGG - Intronic
1131432913 15:92400982-92401004 GTGTTTTTATTTGAAAACACTGG + Intronic
1131876123 15:96807985-96808007 GTAGTTGTACAAGAATATACTGG + Intergenic
1132487570 16:202974-202996 GTATTTTTAGTAGAGAAGACGGG - Intronic
1135205207 16:20477899-20477921 GTATTTTTACTAGTGAAAACTGG - Intronic
1135213696 16:20545915-20545937 GTATTTTTACTAGTGAAAACTGG + Intronic
1135891904 16:26365106-26365128 GTAGTTTAAAAAGAAAACAGTGG - Intergenic
1138667382 16:58583274-58583296 TTAGTTTTACTAAATAAAACAGG + Intronic
1140652503 16:77104091-77104113 GTAATTATAATAGAAAACATTGG + Intergenic
1141021876 16:80504900-80504922 GCAGTTTACTTAGAAAACACTGG - Intergenic
1142316671 16:89351517-89351539 GAACTTTTTCAAGAAAACACTGG + Intronic
1142335655 16:89488448-89488470 GTAGTTAAACTAGAAAAAAAGGG - Intronic
1142439587 16:90087729-90087751 AAAATTTTACAAGAAAACACTGG + Intronic
1144608487 17:16688661-16688683 GTATTTTTAGTAGAGAACAAGGG + Intergenic
1145128254 17:20319583-20319605 GTATTTTTAGTAGAGAACAAGGG + Intergenic
1145196353 17:20897626-20897648 GTATTTTTAGTAGAGAACAAGGG - Intergenic
1145229802 17:21165313-21165335 ATAGTGTTACCAGAAGACACTGG - Intronic
1145873618 17:28298152-28298174 GTAATGTTACCAGAAAACAAAGG + Intergenic
1148730792 17:49835086-49835108 GGAGTTTTCCAAGAAGACACAGG + Intergenic
1151635821 17:75347154-75347176 GAAGTTTCTCTAGAAACCACAGG - Intronic
1151643642 17:75414718-75414740 GGAGTGTTACCAGAATACACTGG - Intergenic
1152957983 18:55932-55954 AAAATTTTACAAGAAAACACTGG - Intronic
1158257362 18:55566974-55566996 GTAGATCTACTAGAAAAGAATGG + Intronic
1158542659 18:58370770-58370792 GCAGTTTTTATAGAAAACACAGG - Intronic
1159573992 18:70153669-70153691 GGAGATTTACCAGAAGACACTGG + Intronic
1160345469 18:78128553-78128575 ATAATTTTACTTGACAACACTGG + Intergenic
1160853242 19:1204905-1204927 GTATTTTTAGTAGAAATTACAGG - Intronic
1162197071 19:8993149-8993171 GTATTTTTAGTAGAGAACATGGG + Intergenic
1164998613 19:32742330-32742352 GTAGTTTTAGTATAAGAGACAGG + Intronic
1165271666 19:34712911-34712933 GCAGTATTACTGTAAAACACCGG - Intergenic
1202699144 1_KI270712v1_random:150192-150214 ATACTTTTACTAGAAAGAACTGG - Intergenic
926904338 2:17792059-17792081 ATAGTTTTATGAGAAAACGCGGG + Intronic
926922077 2:17948985-17949007 GAAGATTTAGTAGAAAACACAGG + Intronic
928601694 2:32909770-32909792 GTAGTTTTAATACAAAAGAGAGG - Intergenic
929172437 2:38945378-38945400 GTTATTTTACTACAAAACAGAGG + Intronic
930419883 2:51137102-51137124 GTAGTTTCTCTACTAAACACTGG + Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
934170094 2:89533677-89533699 ATACTTTTACTAGAAAGAACTGG - Intergenic
934280395 2:91607985-91608007 ATACTTTTACTAGAAAGAACTGG - Intergenic
935699160 2:105795874-105795896 CTAGTTTTACTGAAAAAGACTGG - Intronic
936433947 2:112487022-112487044 GTTGTTTCAGTAGGAAACACTGG + Intronic
937763813 2:125635870-125635892 GTATATATACTAGCAAACACTGG - Intergenic
938853137 2:135282746-135282768 ATAGTTTTACAAAAAAACCCTGG + Intronic
941256122 2:163233223-163233245 GAATTTTTAGAAGAAAACACAGG - Intergenic
942260118 2:174151760-174151782 ATAGTTTTATTAATAAACACTGG + Intronic
943760151 2:191599242-191599264 GTAGTTGTACCAGAAAATTCTGG - Intergenic
944552815 2:200861274-200861296 GTAGTTATAAAAGCAAACACAGG - Exonic
945004185 2:205385983-205386005 ATATTTTTAATAGAAATCACTGG + Intronic
946985902 2:225272636-225272658 GTAGATTTTCTTAAAAACACTGG + Intergenic
1169750879 20:8992785-8992807 ATACTATTACAAGAAAACACTGG + Intergenic
1173381540 20:42548753-42548775 GAAAATTTAATAGAAAACACAGG + Intronic
1174534984 20:51244486-51244508 ATAGTTTTAACAGAAAACCCGGG + Intergenic
1174799523 20:53551552-53551574 GTATTTTTAGTAGAAACCTCAGG + Intergenic
1174838655 20:53881078-53881100 GTATTTTTTTTAGTAAACACGGG - Intergenic
1175717206 20:61263128-61263150 GAGGTTTTACAAGAACACACCGG - Intronic
1178451461 21:32705175-32705197 TTAGTCTATCTAGAAAACACTGG - Intronic
1179450616 21:41466096-41466118 GTCGTTTTACAAGAAAACAATGG - Exonic
1183722981 22:39573061-39573083 CTAGTTTTAATACAAAGCACTGG + Intronic
1183819296 22:40332042-40332064 GTACTTTTTCCAGAGAACACTGG - Exonic
949156386 3:831601-831623 AAACTATTACTAGAAAACACTGG + Intergenic
949707766 3:6838609-6838631 GCAGATTTATTAGAAAAGACAGG - Intronic
950759919 3:15213220-15213242 ATAATTTTATTTGAAAACACTGG - Intronic
951027841 3:17848299-17848321 GGTGTTTAACTAGAAAGCACAGG + Intronic
951100389 3:18681529-18681551 TTGGTTTTACTAAGAAACACAGG - Intergenic
952121562 3:30250623-30250645 GTAGTTGTAACAGAAACCACAGG - Intergenic
953732724 3:45464144-45464166 GTACCTTTACCAGAACACACTGG + Intronic
954281372 3:49581154-49581176 GTATTTTTAGTAGTAAAGACTGG + Intronic
955536014 3:59924379-59924401 GAAGTTTGACTGGAAGACACTGG - Intronic
955727777 3:61951257-61951279 ATAGTTTCAGCAGAAAACACTGG - Intronic
956714849 3:72070017-72070039 GTATTTTTACTAGCTAACTCAGG - Intergenic
956884974 3:73550075-73550097 GTTGTTTTACTTAAAAGCACAGG + Intronic
957558298 3:81788078-81788100 GGAATTTTACTGGAAAACTCTGG + Intergenic
958053380 3:88378427-88378449 AGAGTTTTACTGGAAAGCACTGG - Intergenic
960552308 3:118989525-118989547 GTATTTTTAGTAGAAGACACGGG + Intronic
963394026 3:144708720-144708742 GGAGACTTACTAGAAAACACAGG - Intergenic
963556222 3:146792248-146792270 GTATTTTTAGTAGAAGAGACGGG + Intergenic
964095680 3:152928589-152928611 GTAGTTTTACTATATAAAACGGG + Intergenic
964830257 3:160876634-160876656 ATTGATTTACTAGAAAACAATGG + Intronic
966010164 3:175065280-175065302 GAAGTCTTACTATAAATCACTGG + Intronic
969029699 4:4202065-4202087 ATACTTTTACTAGAAAGAACTGG + Intronic
970100837 4:12520127-12520149 TTTGTTCAACTAGAAAACACAGG + Intergenic
970506600 4:16736523-16736545 ATGGCTTTACTAGAAAACAATGG + Intronic
971322840 4:25619254-25619276 GTATTTATACTAAAAATCACTGG - Intergenic
974217696 4:58873451-58873473 GTAGTTTTAATAGTGAACATAGG - Intergenic
974393364 4:61303188-61303210 GTAGTTTTACTTTCAAAGACTGG + Intronic
976568371 4:86578942-86578964 GAAGTTGTTCAAGAAAACACTGG + Intronic
977982539 4:103341765-103341787 GTACTATTAGAAGAAAACACAGG + Intergenic
978226415 4:106339923-106339945 GTATTTTTATTAGAGAAAACAGG - Intronic
978622799 4:110650936-110650958 GTAGTTAAAGTAGACAACACTGG - Intergenic
980764589 4:137284899-137284921 GAAATTTTACTAAAAAACACAGG - Intergenic
981803293 4:148682838-148682860 TCAGTTTTAAAAGAAAACACTGG - Intergenic
983197069 4:164818527-164818549 TTAGCTCTACTAGAACACACTGG - Intergenic
983610905 4:169643902-169643924 GTTGTTTTACTTGAAAAGACAGG + Intronic
983992044 4:174131252-174131274 GTAGTTTAACAAGAAAAGACTGG + Intergenic
984788882 4:183595357-183595379 GTATTTTTAGTAGAAGAGACAGG - Intergenic
987174986 5:15298311-15298333 ATAGTTTTATGAGAAAAAACAGG - Intergenic
988432972 5:31141380-31141402 GTATTTTTTTTAGAAAAGACAGG + Intergenic
990773570 5:59279013-59279035 GTAATTTTACTATACAACTCAGG + Intronic
990831464 5:59963478-59963500 GAATTTTTACTAGAACACAGTGG + Intronic
990933780 5:61124554-61124576 GATATTTTACTGGAAAACACAGG - Intronic
991221157 5:64219846-64219868 GTAGTTTCACTATGAAACACTGG - Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993736503 5:91482939-91482961 GCAGTTCTACTAGAAAGGACAGG - Intergenic
995067844 5:107882456-107882478 GTATTTTCACTGGAAAACACTGG - Intronic
995264535 5:110142229-110142251 GAAGTTTTAGAAGAAAACATAGG - Intergenic
996128883 5:119757106-119757128 TTGCTTTTACTAGAAGACACAGG - Intergenic
996607051 5:125335466-125335488 GAATTTTTACAAGAACACACAGG + Intergenic
996766898 5:127043620-127043642 ATATCTTTACAAGAAAACACAGG + Exonic
998315187 5:141176488-141176510 GTAGTATTACTATATATCACTGG + Intergenic
998434230 5:142093803-142093825 ATATTTTCAGTAGAAAACACGGG + Intergenic
1004094671 6:12540766-12540788 GAAATTTTATTTGAAAACACAGG - Intergenic
1004597918 6:17118194-17118216 GAAATTATACAAGAAAACACGGG - Intronic
1006006134 6:31003279-31003301 GTAAATATACTAAAAAACACTGG + Intergenic
1008630083 6:53356246-53356268 GTATTTTTAGTAGAAAACGTTGG + Intergenic
1011272180 6:85591175-85591197 GTTGTTATACAAGAAAACATGGG - Intronic
1013884155 6:114941526-114941548 GTAGTTATACAAGAAATTACAGG + Intergenic
1014080206 6:117277654-117277676 TTAGTTTCACAAGAATACACCGG - Intergenic
1014578997 6:123111061-123111083 GTAGAATTACTAGAAAAGAAGGG + Intergenic
1015694622 6:135966370-135966392 CTAGTTTTACTAAAAAACAAAGG + Intronic
1016435582 6:144034143-144034165 GTGGTTTTACATGTAAACACAGG - Intronic
1016960815 6:149671012-149671034 GTACTTTTAGAAGAAAACATAGG - Intronic
1017365264 6:153628818-153628840 GTACTTTTATTGGAAAACAGAGG - Intergenic
1017622401 6:156312828-156312850 GTTGTTTTACTAGAAGTGACAGG + Intergenic
1017714524 6:157199836-157199858 GTATTTTTACTATAAGAGACGGG + Intronic
1018128774 6:160707785-160707807 GTAGTTTTATTTGAAAAGAAAGG + Exonic
1021209565 7:17830534-17830556 GTAGATTATCTTGAAAACACTGG + Intronic
1021615827 7:22501581-22501603 CTAGTTTCACTAGAAACAACAGG - Intronic
1022164172 7:27741052-27741074 AAAGTTTTGTTAGAAAACACTGG + Intronic
1022574115 7:31481285-31481307 GAAGTTTTACTACATCACACAGG - Intergenic
1027535990 7:79402591-79402613 CTAGGTTTATTAAAAAACACCGG - Intronic
1028376642 7:90152767-90152789 CTAGTTTCACTAGAAACAACAGG + Intergenic
1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG + Intronic
1030568379 7:111189201-111189223 GTTATTTTAATTGAAAACACTGG - Intronic
1030894981 7:115048016-115048038 CTAGTCTTACTAGAAAATATGGG - Intergenic
1031047818 7:116913355-116913377 ATACTTTTAGAAGAAAACACTGG - Intronic
1031632000 7:124054523-124054545 GTAGTTTTACTATAATACTGTGG - Intergenic
1033503322 7:141975993-141976015 GTAGTGTCAATAGGAAACACTGG + Intronic
1034096582 7:148414249-148414271 GTACTTTTAGTATAAAAGACCGG + Intronic
1037015868 8:13905365-13905387 GTACTTTTACTGGAAAAAATAGG - Intergenic
1038869262 8:31476314-31476336 TTATTTTTACTAGAAAACACTGG - Intergenic
1039132814 8:34286767-34286789 GTAGTTTCAGTAGAACACATGGG - Intergenic
1040424071 8:47266789-47266811 GTAAATATACTAGAAACCACTGG - Intronic
1041243879 8:55872775-55872797 GTAGTTTTTCCAGTAATCACAGG + Intergenic
1049287570 8:141784290-141784312 TTATTTGTAATAGAAAACACTGG - Intergenic
1051725547 9:20084951-20084973 GTAGTTTTTCTGCAAAAGACAGG + Intergenic
1052358670 9:27530154-27530176 GTGGATTTACTAGAACACACTGG + Intergenic
1052952816 9:34227519-34227541 GTACTTTTTTTAGAAAAAACGGG + Intronic
1053302706 9:36963163-36963185 GCAGATTAACCAGAAAACACTGG + Intronic
1055492892 9:76824391-76824413 GAAATTATACTAGAAAACATGGG - Intronic
1055529002 9:77164628-77164650 GTATTTTTAGTAGTAAAGACAGG + Intergenic
1055609028 9:78002436-78002458 CTAGTTTTACTAGCAGACAGTGG + Intronic
1057668460 9:97066197-97066219 GTAGTTATACTAGACAAAATAGG + Intergenic
1062740186 9:138168670-138168692 AAAATTTTACAAGAAAACACTGG + Intergenic
1186314942 X:8359078-8359100 GTAGTTCTATTAGAAAACACTGG - Intergenic
1187466831 X:19534984-19535006 GTAGTTTCACTATTAAACTCAGG + Exonic
1188077080 X:25791235-25791257 GTAGTTTTAGGAGAAAACATAGG + Intergenic
1192857355 X:75026103-75026125 AAACTTTTACAAGAAAACACAGG - Intergenic
1193378998 X:80796493-80796515 TTTGTTTTCCTAGGAAACACAGG + Intronic
1194012487 X:88579984-88580006 GTAGTTTAATTAGATCACACTGG - Intergenic
1194034801 X:88856794-88856816 GTAATGTTACTAGAAAAGAGAGG - Intergenic
1195884903 X:109627457-109627479 GTAGTTTTGGCAGAAAGCACTGG - Intronic
1199536545 X:148908644-148908666 ACAGTTTTACTGGAAAACAGAGG + Intronic
1199568070 X:149237850-149237872 AAAGATTTACAAGAAAACACAGG + Intergenic