ID: 1029869962

View in Genome Browser
Species Human (GRCh38)
Location 7:103680333-103680355
Sequence TCTGAGTCCCCAGGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 337}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029869962 Original CRISPR TCTGAGTCCCCAGGGGCTCT GGG Intronic
900389109 1:2426465-2426487 CCTGAGTCCCCATGGGGTCCTGG + Intronic
900527559 1:3136545-3136567 CCTGGGTCCACAGGGGCTCTGGG + Intronic
900576619 1:3385749-3385771 TCAGAGGCCCCGGAGGCTCTAGG - Intronic
900868847 1:5287629-5287651 TCGCAGTCCCCAGATGCTCTAGG - Intergenic
900931374 1:5739932-5739954 TCCTAGTCCTCAGGGGCTCCTGG - Intergenic
900972509 1:5999339-5999361 TCTGAGTCACCAGGGACTGGTGG - Intronic
900987004 1:6078952-6078974 TCTGAGCCTCCAGCGGCTCTTGG - Intronic
901050870 1:6425309-6425331 CCAGAGTCCCCCGGGGCTCAAGG + Intronic
901736530 1:11316111-11316133 TCTTCTTCCCCAGGAGCTCTAGG - Intergenic
901931556 1:12599228-12599250 TCTGAATCCCCTGGCCCTCTGGG - Intronic
902229689 1:15020049-15020071 TGTGAGTCCCCAGGGCCCCTGGG - Intronic
902810053 1:18883030-18883052 GCTGAGACCCAAGGGGCTCAGGG + Intronic
902888841 1:19426663-19426685 ACTGAGCCCCCAGGTGCTCCAGG + Intronic
903096560 1:20981062-20981084 ACTGAGGCCCCTGGGGCACTGGG + Exonic
903322966 1:22553563-22553585 CCTGGGTCCCCAGCGGCCCTGGG + Intergenic
903753972 1:25647830-25647852 TGTGAGTCCCCAGGCTCTCTTGG + Intronic
904044164 1:27600293-27600315 TCTGGGTCCCCTGGGTCTCTTGG - Intronic
904366530 1:30014384-30014406 TCTGAGCCCTCAAGGGCTCCTGG - Intergenic
904875587 1:33652265-33652287 TCAGAGTGGCTAGGGGCTCTGGG - Intronic
904976668 1:34461873-34461895 CCTGAGTCCCCTCAGGCTCTGGG + Intergenic
906686787 1:47768008-47768030 CCTGACTCCACATGGGCTCTTGG + Intronic
907311871 1:53543435-53543457 TCTCACTCCTCAGGGGCCCTGGG - Intronic
907701502 1:56792520-56792542 TCTAACTCCCCAGGGCCTCTGGG - Exonic
908417577 1:63928354-63928376 TCTGAGTGCCAATGGCCTCTTGG - Intronic
909094879 1:71274283-71274305 TCTCAGTCCTCAGGGTTTCTTGG - Intergenic
910770076 1:90822310-90822332 TCTCCCTCCCCAGGGGCTTTGGG - Intergenic
911065014 1:93780179-93780201 TCTGAGTCCCCACAGGATGTGGG - Intronic
911069976 1:93824866-93824888 TCTGTGTGCCCAGGTGGTCTGGG + Intronic
912439425 1:109687432-109687454 GCCGAGTTCCCAAGGGCTCTGGG - Intronic
912442731 1:109711872-109711894 GCCGAGTTCCCAAGGGCTCTGGG - Intergenic
912744954 1:112238425-112238447 ACTGAGTCTCCTGGGTCTCTAGG + Intergenic
913348094 1:117828215-117828237 CCAGAGTCCCCAGGGGCTGGAGG - Intergenic
915662479 1:157415755-157415777 TCAGATCCCCCAGTGGCTCTTGG - Intergenic
915925948 1:160019833-160019855 TCTGACTCCCCATGGGGTCATGG + Intergenic
916007496 1:160675544-160675566 TCTTAGTCCACAGGAGCTCCTGG + Intergenic
916817897 1:168371326-168371348 TGTGAGTCCCCATGCCCTCTTGG + Intergenic
918534288 1:185557356-185557378 TCTGAGTCCCCTAAGGCTCATGG + Intergenic
919807812 1:201391107-201391129 TTTCACTTCCCAGGGGCTCTTGG + Intronic
919944655 1:202310357-202310379 TGTGAGTGACCAGGGGCCCTGGG + Exonic
919969537 1:202565305-202565327 TCTAAGTCCCCAGGCATTCTAGG - Intronic
920186220 1:204161064-204161086 TCTGGGTGCTCAGGGGTTCTTGG + Intronic
921776854 1:219111682-219111704 TCCCAGTCCCCAGTGGCTCCAGG + Intergenic
922336568 1:224623182-224623204 TCTGCTGCCCCAGGGGCTCTTGG + Intronic
922888126 1:229036252-229036274 TCTGATTCCCCTGGGGGACTGGG + Intergenic
923107834 1:230868247-230868269 TCCGAGTCCCCGGGGTCTCGGGG + Exonic
924707193 1:246510534-246510556 CCGGAGTCCTCAGGGTCTCTCGG + Intergenic
1064278994 10:13933765-13933787 TCTGTGTCCCAGGGGCCTCTAGG - Intronic
1065892127 10:30130421-30130443 TCTGAGTCCCCAGAGGACCTTGG + Intergenic
1067285259 10:44903187-44903209 ACTTAGTCCCCTGGGTCTCTGGG + Intergenic
1068752804 10:60614848-60614870 TATCAGTCTCCAGGGGGTCTTGG + Intronic
1069071880 10:63998042-63998064 TCCTAGCCCCCAAGGGCTCTGGG + Intergenic
1069633476 10:69911677-69911699 TCTGAGTCTCCAGGCTCCCTGGG + Intronic
1070836026 10:79447157-79447179 TCTGAGATCCAAGGGCCTCTTGG - Intergenic
1072438566 10:95435048-95435070 TCAGGGTCCACAGGGCCTCTTGG + Intronic
1073184507 10:101607612-101607634 TCTGAGTCCCCAGGGCATAGGGG + Intronic
1073488670 10:103838218-103838240 TGTCAGGCCCCAGGGGCTCTGGG + Intronic
1073592921 10:104773315-104773337 TCCGAGTTTCCAAGGGCTCTTGG - Intronic
1075731942 10:124641591-124641613 TCTGAGTTCCCCGTGACTCTCGG - Intronic
1075788428 10:125066153-125066175 TCTGAGTGACCAGTGGCTCTTGG + Intronic
1076132358 10:128022229-128022251 ACTGAGTCCCCAGGTGCACCTGG + Intronic
1076132550 10:128023621-128023643 TCTGTGGCTTCAGGGGCTCTTGG + Intronic
1076246339 10:128950256-128950278 CCTGGGCCCCCAGGGGCACTGGG + Intergenic
1076255193 10:129017649-129017671 CCTGAGTCCCCAGAGGCTACAGG - Intergenic
1077071698 11:676969-676991 TCTCTGTCCCCAGGTGCCCTTGG - Intronic
1077192478 11:1261196-1261218 TCTGGGCCCCCAGGGTCCCTTGG - Intronic
1077258959 11:1605176-1605198 TGGGGGTCCCCAGGGGCTCAGGG - Intergenic
1077496569 11:2889623-2889645 TTTGGGTTCCCTGGGGCTCTGGG - Intronic
1078598995 11:12714320-12714342 TCTTTGTCCCCAGCAGCTCTGGG + Intronic
1079911381 11:26314702-26314724 TTTGAGACCCCAGGGTCTCAGGG + Intronic
1080666321 11:34339374-34339396 TCTGAGGCCTGAGGGGCTGTGGG + Intronic
1081429936 11:42965832-42965854 TCTGGGTCCCCAGGGTCTCCTGG - Intergenic
1083331346 11:61899883-61899905 CCTGAGGCCCCAGGGGCCCCGGG - Intronic
1083586550 11:63863891-63863913 TATTAGTCCCCAGGTGCTCAGGG - Intronic
1083745762 11:64735710-64735732 TCTCTGTTCCCCGGGGCTCTGGG - Intronic
1083832576 11:65242156-65242178 CCAGTGTCCCCAGGGGCTCCTGG - Intergenic
1084387967 11:68855724-68855746 CCAGCGTCCCCAGGGGCTCCCGG + Intergenic
1084460713 11:69295117-69295139 CCTGGGTCCCCATGGCCTCTAGG - Intronic
1084971459 11:72774490-72774512 TTTGAGTCTCCAGGGGCCCCAGG + Intronic
1085039343 11:73317721-73317743 TCTCAGCTCCCAGGGTCTCTGGG + Intronic
1085343070 11:75746191-75746213 ACAGATTCCCCAGGGGCTCCGGG + Intergenic
1085637407 11:78169221-78169243 CCTGTGTCCCAGGGGGCTCTGGG - Intergenic
1088806653 11:113358847-113358869 TCTTGGTCCCCAAAGGCTCTTGG - Intronic
1089115790 11:116093924-116093946 TCAGAGTCCCCTGGACCTCTTGG - Intergenic
1089358327 11:117870240-117870262 TCTGGTTCCCCAGGAGATCTCGG + Intronic
1090436280 11:126689354-126689376 TCTGGGCTCCCAGGGGGTCTGGG - Intronic
1091201645 11:133785117-133785139 TCAGGGTCCCCAGTGGCTCTGGG + Intergenic
1091753797 12:3038899-3038921 TCAGAGTCCACAGGTGCTTTGGG - Intronic
1094252748 12:28384024-28384046 TCTTAATCCCCAATGGCTCTTGG - Intronic
1094840559 12:34341067-34341089 GCTGGGACCCCAGGGTCTCTGGG - Intergenic
1096189360 12:49605272-49605294 TCTGGGTCCTCAGAGGCCCTGGG - Intronic
1097001984 12:55884634-55884656 TCTCCCTCCCCAGGGGCTATAGG - Intergenic
1100423505 12:94460157-94460179 TTTCCGTCCCCTGGGGCTCTGGG - Intergenic
1101576917 12:106006369-106006391 TCTGAGGACACAGGGGCTCTGGG - Intergenic
1102080126 12:110091109-110091131 TCTGGGTTCCCAGGGGATCTGGG + Intergenic
1102599731 12:114020699-114020721 TCTCTGTTCCCAGAGGCTCTAGG - Intergenic
1103181939 12:118920442-118920464 TCTGATTTCCCAGGGGGTCTGGG - Intergenic
1103520240 12:121533129-121533151 CCTGCCTCCCCAGAGGCTCTAGG - Intronic
1105024884 12:132841354-132841376 GCTGCGGCCCCCGGGGCTCTGGG + Exonic
1105863631 13:24439802-24439824 TCTGACTGCACAGGGGCCCTTGG - Intronic
1105947734 13:25203687-25203709 TCTGAGTGCACAGCAGCTCTAGG - Intergenic
1106787201 13:33119298-33119320 TCTCATTCCCCAGTGGCTCATGG + Intronic
1106924569 13:34600578-34600600 TGCCAGTCCCCAGGGGGTCTAGG - Intergenic
1107000279 13:35536089-35536111 TGTGAATACCCAGGGGCACTTGG + Intronic
1107411318 13:40161193-40161215 GCTGAGTCCCCAGGGACCCCAGG - Intergenic
1109738381 13:66518214-66518236 TCTGAGTTCACATGGGATCTGGG - Intronic
1110307818 13:74010301-74010323 TCTGAGGCCCCTGGGACTTTTGG - Intronic
1110410215 13:75196584-75196606 GCTGAGTCCCCAGTGGATATGGG + Intergenic
1110707325 13:78609767-78609789 TCGGAGTCCCCAGAGGCTCTTGG - Intergenic
1114474194 14:22982353-22982375 TCTGGTTCCCCAGGGGCACAGGG + Exonic
1118694993 14:68375976-68375998 TCTGAGGCCCCTGGGTCCCTAGG - Intronic
1119325009 14:73754673-73754695 TCTGAGGCCCCAGCTGGTCTTGG - Intronic
1120746476 14:88156985-88157007 TATGAGTCACCTGGGGATCTTGG + Intergenic
1122125569 14:99576762-99576784 TCTGAATCCCCAGGGTGTCATGG - Intronic
1122172509 14:99888901-99888923 TCAGAGTCCTCAGGGGCTCTGGG + Intronic
1122378417 14:101284905-101284927 TTGGACTCACCAGGGGCTCTTGG + Intergenic
1122489231 14:102102346-102102368 TCTGGGTGGCCAGGTGCTCTTGG + Intronic
1125272403 15:37953343-37953365 TCTGAGTCACCTGGAGCTCTGGG - Intronic
1125424833 15:39538197-39538219 TCTGAATCCCCAAAGGCTTTGGG - Intergenic
1126776690 15:52106587-52106609 TCTGAGTCCCAAGTAGCTTTAGG + Intergenic
1128515833 15:68341394-68341416 TCTGATTTCACAGGGCCTCTGGG - Intronic
1128780830 15:70357583-70357605 TCTGCGTCCCCAGGGTCTGCAGG - Intergenic
1129755005 15:78092794-78092816 TCTCAGCCCCAAGGGGCTGTGGG - Intronic
1129876538 15:78979131-78979153 GCACAGTCCACAGGGGCTCTCGG + Intronic
1130255879 15:82325892-82325914 TCTGGGTCCCCAGAGGCCCCAGG + Intergenic
1130546110 15:84858342-84858364 CCTGGGTCCCCAGGGACTCCAGG + Exonic
1130578737 15:85116265-85116287 TCTGAGTCACCAGGGCCTGGGGG + Intronic
1130599080 15:85264094-85264116 TCTGGGTCCCCGGAGGCCCTGGG - Intergenic
1132299833 15:100768617-100768639 TCTGAGTCCTCAGGGCCACAGGG + Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132658189 16:1049941-1049963 TCTGAGCTCCCAGGGGCCCTCGG - Intergenic
1132733765 16:1375682-1375704 TCCTGGTCCCCAGGGGGTCTTGG - Intronic
1132826143 16:1906649-1906671 TTCGTGTCCTCAGGGGCTCTCGG - Intergenic
1133033630 16:3023065-3023087 TCCAGGTCCCCAGGGGCTCCTGG + Intronic
1133328196 16:4955119-4955141 GCTGATTCCCCAGGGGTGCTGGG - Intronic
1134632104 16:15763959-15763981 TCTGGGTCCCCAGTGGCTTTAGG - Intronic
1134733035 16:16477897-16477919 TCTGGGTCTCCTAGGGCTCTGGG - Intergenic
1136248360 16:28988181-28988203 TCTGACTGCCCTGGGGCTCCCGG + Intronic
1136990166 16:35147174-35147196 TCTGGGGCCCCAGGGGATCAGGG - Intergenic
1137564423 16:49524484-49524506 TCAGGGTGCTCAGGGGCTCTGGG + Intronic
1138348741 16:56335368-56335390 TCTGAGGCCCCAGAGCCCCTGGG - Intronic
1138511421 16:57510630-57510652 TCAGGGTCACCAGGAGCTCTGGG - Intergenic
1138529598 16:57627975-57627997 TCTGAGACCCCAGGGGCTTCTGG - Intronic
1138589175 16:57990329-57990351 TCTCAGTCTCCAGGGACTCTTGG + Intergenic
1139297000 16:65909844-65909866 TCTGAGTCCCCAGAGTATGTGGG + Intergenic
1139434063 16:66926131-66926153 TCAGGGCCCCCAGGGGCTCATGG - Intergenic
1139958264 16:70703606-70703628 GCTGCGTCCACAGGGCCTCTGGG - Intronic
1139967552 16:70754186-70754208 TCTGGGTCCCCCTGTGCTCTGGG + Intronic
1140689700 16:77469858-77469880 GCAGGGTCCCCAGGGGCTTTGGG - Intergenic
1140742334 16:77952575-77952597 TGTGAGTCACCAGGGGCTCATGG - Intronic
1141157817 16:81609530-81609552 TCTGTCTCCCCAGGGGCTGAGGG - Intronic
1141490338 16:84368397-84368419 CCTGGGACCCCAGGGGCTCTGGG - Intergenic
1142227120 16:88882935-88882957 ACTGAGCCGCCTGGGGCTCTGGG + Intronic
1142755482 17:2014128-2014150 GGTGAGTCCCCATGGGCACTGGG - Intronic
1143322196 17:6075553-6075575 TCTGAATATCCAGGTGCTCTGGG + Intronic
1144386183 17:14751194-14751216 TCTGCCTTCCCAGGTGCTCTGGG + Intergenic
1144625372 17:16841746-16841768 GCTGAGTCCCCAGGAGTTCTAGG - Intergenic
1144881055 17:18430975-18430997 GCTGGGTCCCCAGGAGTTCTAGG + Intergenic
1145151177 17:20513411-20513433 GCTGGGTCCCCAGGAGTTCTAGG - Intergenic
1145378793 17:22375837-22375859 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1145379269 17:22378207-22378229 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1145379747 17:22380577-22380599 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1145380227 17:22382952-22382974 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1145380706 17:22385299-22385321 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1145381184 17:22387674-22387696 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1145381786 17:22390720-22390742 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1145381920 17:22391449-22391471 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1145382394 17:22393813-22393835 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1145383615 17:22399734-22399756 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1145384198 17:22402669-22402691 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1145385122 17:22407130-22407152 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1145385303 17:22408202-22408224 TCTGATGACCCTGGGGCTCTTGG + Intergenic
1146054873 17:29576016-29576038 TCTGAGCCCCAGGGGGTTCTGGG - Intronic
1147892490 17:43727157-43727179 TCTGAGTCCCCAGGGGCCAGTGG + Intergenic
1148588854 17:48800562-48800584 TCTGAGAACCCTGGTGCTCTTGG + Intronic
1149160555 17:53687394-53687416 TCTGAGCCCCCCTGTGCTCTTGG - Intergenic
1150230156 17:63545351-63545373 TCTGGGGCCACAGAGGCTCTGGG - Intronic
1152092718 17:78256081-78256103 TCTGAGGGCCCGGGGGCTTTGGG + Intergenic
1152112859 17:78366638-78366660 CCTGACTCTCCTGGGGCTCTGGG + Intergenic
1153061449 18:999180-999202 TCTGAGGCCCCAAGGGCTGATGG + Intergenic
1153626384 18:7025455-7025477 ACTGAGTCCCCTGGGGCCCACGG + Intronic
1153685790 18:7543762-7543784 TCTGAGTTCCCAGGGACATTTGG - Intergenic
1154001172 18:10483613-10483635 TCTCAGTCACCAGGGTCTTTGGG - Intronic
1154493527 18:14939348-14939370 GCTGATTCCCCAGTGGCTCAGGG + Intergenic
1155799326 18:30081496-30081518 ACTGACTGCCCAGGGGCTCATGG - Intergenic
1157100629 18:44725729-44725751 CCTGACTTCCCAGCGGCTCTGGG + Intronic
1157804650 18:50649143-50649165 TCTGATCCCCTAGGGGCCCTTGG + Intronic
1157941019 18:51929342-51929364 TCTGAGTCCTCCGAGTCTCTAGG - Intergenic
1158412731 18:57222094-57222116 TCTGTGTCCCCAGGCCCCCTAGG + Intergenic
1160169169 18:76538638-76538660 GCTGAGTCCCCAGGGGCAGGAGG - Intergenic
1160342499 18:78101841-78101863 TCTGAATGGCAAGGGGCTCTGGG - Intergenic
1160537482 18:79602852-79602874 TATGAGACCCCAGGGACTTTAGG - Intergenic
1160767292 19:814192-814214 CATGGGTGCCCAGGGGCTCTAGG - Intronic
1160817289 19:1042051-1042073 TCTCTGTCCCCAGGGTCTCCCGG + Exonic
1161217402 19:3101304-3101326 TCTTAATCCCCAGGGACTGTGGG + Intronic
1162322287 19:9977409-9977431 CCAGAGGCCCCAGGGGCCCTGGG + Exonic
1162402343 19:10453863-10453885 TCTCTGTACCCAGGGTCTCTGGG + Intronic
1163348930 19:16763150-16763172 GCTGAGTCTGCAGGGACTCTGGG - Intronic
1163687814 19:18722052-18722074 CCTGAGTCACCAGAGGCTGTGGG + Intronic
1163763393 19:19149153-19149175 TCTCAGAGCCCAGGGACTCTTGG - Intronic
1164157279 19:22604326-22604348 TGAGAATCCCCAGGGGATCTCGG + Intergenic
1165160552 19:33813229-33813251 TCTGAGGCCCCGGGGCCTGTTGG + Exonic
1165950826 19:39473190-39473212 TCTGCGTCCCCAGGGGCTCACGG + Exonic
1167115500 19:47487144-47487166 TCTGAGGCCCGAGTGGGTCTGGG - Intergenic
1167787082 19:51645738-51645760 GCTGAGTCCCCAAGGGCAGTGGG - Intronic
925024989 2:600637-600659 TCTGACTCTCCAGGTGCTCCTGG + Intergenic
925360651 2:3278167-3278189 TCAGACTCCCCTGGGCCTCTGGG - Intronic
925644117 2:6018469-6018491 GCTGCTTCCCCAGGGGCTCTCGG + Intergenic
926841410 2:17084719-17084741 TCTTATTCCCCATGGGCTCATGG + Intergenic
928097672 2:28414426-28414448 CCCGATTTCCCAGGGGCTCTGGG + Exonic
928176298 2:29036500-29036522 CCTGGGTTCCCATGGGCTCTTGG + Intronic
928621438 2:33092239-33092261 TCTGAGTGAGCAGGGTCTCTGGG - Intronic
929589082 2:43133573-43133595 TCAGAGTCCCAAGCCGCTCTAGG - Intergenic
929823069 2:45289096-45289118 TCTGGATTCCCAGGGGCTATGGG + Intergenic
929929271 2:46239520-46239542 TCTGACTCCCCCAGGGCACTAGG + Intergenic
930032952 2:47069482-47069504 TTTGAGGCCCAGGGGGCTCTGGG + Intronic
933352513 2:81172841-81172863 TCTAAGTTCCCAGTGGCTTTAGG - Intergenic
933555362 2:83824092-83824114 TCCTAGTCCCCAGTGACTCTAGG - Intergenic
934544842 2:95206288-95206310 GCAGACTCCCCAGGAGCTCTAGG - Intergenic
934561830 2:95317505-95317527 TCTGGCTGCCCCGGGGCTCTGGG + Intronic
935216013 2:100975851-100975873 TGTGTAGCCCCAGGGGCTCTGGG - Intronic
935821246 2:106894954-106894976 TATGTGTGGCCAGGGGCTCTGGG + Intergenic
936062094 2:109301595-109301617 TCTGAGCCCACAGAGGCCCTGGG - Intronic
936860518 2:117012476-117012498 GGTGAGCCCCGAGGGGCTCTCGG + Intergenic
937244535 2:120484094-120484116 TCTCATTCCCCAGGGCCCCTGGG + Intergenic
937454316 2:122028055-122028077 TCAGAGTCCCCAGGTGGTCCCGG - Intergenic
937907811 2:127060913-127060935 TCCCAGTCCCCAGGAGCTCCAGG + Intronic
942227960 2:173832972-173832994 TCTGAATCTCATGGGGCTCTTGG + Intergenic
943470427 2:188288522-188288544 TATGAGTTCCTAGGGGCTCTGGG - Intergenic
944434146 2:199668830-199668852 GCTGAGTTCCCAGGGGAACTCGG + Intergenic
944586481 2:201178096-201178118 TCTGAGCCCCCCTGTGCTCTTGG + Intergenic
944885564 2:204059068-204059090 TCTGATCCCAGAGGGGCTCTGGG + Intergenic
948072413 2:235138485-235138507 TTGGTGTCACCAGGGGCTCTGGG + Intergenic
948492441 2:238321744-238321766 TCTGAGTTCCCACGTGCCCTTGG - Intronic
948813880 2:240499857-240499879 TCTGGACCCCCTGGGGCTCTTGG - Intronic
948987599 2:241534789-241534811 ACTGAGACCCCAGGGACGCTGGG + Intergenic
949014388 2:241701552-241701574 GCTGAGGCCCCGGGGGCTCGGGG + Intergenic
1169628418 20:7598206-7598228 TCTGAGCCACCTGGAGCTCTGGG - Intergenic
1170591257 20:17773545-17773567 TCTGGGTGCCCAGGAGCTCCTGG + Intergenic
1171236280 20:23527712-23527734 AGTGGGTCCCCAGGGCCTCTTGG + Intergenic
1172196680 20:33096716-33096738 ACTGAGTCCTCAGTGGCGCTGGG + Intronic
1172440099 20:34959376-34959398 TCTGAGACACCAGAGGCTCAGGG - Intergenic
1172770886 20:37381977-37381999 CCTGAGGCCCCAGGGGCACAGGG + Intronic
1172953926 20:38741932-38741954 CCTGATTCCCCAGCTGCTCTGGG - Intergenic
1172999582 20:39095989-39096011 TCTGCCTCCACAGGGGCCCTGGG - Intergenic
1174138085 20:48394209-48394231 TGTAAGTCACCAAGGGCTCTGGG - Intergenic
1175327209 20:58138025-58138047 CCTGAGACTCCAGGGGCTCCCGG - Intergenic
1175946677 20:62562207-62562229 TCTGAGGCCCCAGGAGCTAGGGG + Intronic
1176125588 20:63473173-63473195 TCTGGGACCCCAGGAGCGCTGGG - Intergenic
1176204818 20:63882540-63882562 TCTGGGGGCCGAGGGGCTCTGGG + Intronic
1178431686 21:32523302-32523324 TCTGAGCTCCCAGGGCCACTTGG - Intergenic
1179234648 21:39535003-39535025 GCTGAGCCCACAGAGGCTCTCGG - Intergenic
1179478872 21:41665409-41665431 TCTGAGCCTGCAGGGGCTCCTGG - Intergenic
1180864003 22:19105489-19105511 TCTGAGCCACCAGGGGCCATGGG + Intronic
1181423934 22:22820700-22820722 CCTGACTCGCCAGGTGCTCTGGG + Intronic
1183351541 22:37337381-37337403 TCTGAGTCCTCAGGGCCCCTTGG + Intergenic
1183960003 22:41405777-41405799 GCTGAGGCCCCAGGGGCCCCTGG - Intergenic
1184205240 22:42998217-42998239 GCTGGGTCCCCAGGTTCTCTGGG - Intronic
1184455932 22:44609429-44609451 TCTGTGTCCCCAGGGGCCCAAGG - Intergenic
1184748371 22:46469856-46469878 TCTGGGTCCTCAGGGACTCATGG - Intronic
1185129018 22:49027064-49027086 TCTGAGCCCCCAGGCTCTATGGG + Intergenic
1185334666 22:50266165-50266187 GCTGAGCCCCCAGGCTCTCTGGG - Intronic
949537830 3:5009639-5009661 TCAAACTCCCCAGGGACTCTGGG + Intergenic
954660863 3:52226175-52226197 GATGGGGCCCCAGGGGCTCTGGG - Intergenic
961664189 3:128486161-128486183 TCTGTGTACCCAGGGGCTGGGGG - Exonic
961806291 3:129491648-129491670 TCTGTGGTACCAGGGGCTCTGGG + Intronic
962059490 3:131910544-131910566 TCTGATTCCATGGGGGCTCTGGG + Intronic
962343376 3:134603072-134603094 TCCGAGCCCCCAGGGAATCTTGG - Intronic
962700790 3:137998440-137998462 TCTCAGTCCCCAGGGCCACATGG + Intergenic
962850668 3:139306354-139306376 TCTGACTCCCCTGGGGTACTGGG + Intronic
965483827 3:169254079-169254101 TCTGAGTTCCCATGGGCACCAGG + Intronic
966726964 3:183116727-183116749 TCTGAAATCCCAGAGGCTCTGGG + Intergenic
967725357 3:192857493-192857515 TTTGAGTCTCCAGCAGCTCTAGG - Intronic
967848163 3:194060707-194060729 TTTGAATCCCCAGTGGCTCTAGG + Intergenic
967938016 3:194744752-194744774 TCCCAGTCCCTAGGAGCTCTGGG - Intergenic
968271763 3:197408511-197408533 GCAGAGTTCCCAGGGGCTGTGGG - Intergenic
968511222 4:996791-996813 GCTGAGTGCCCAGGGGGTCCAGG + Intronic
968702211 4:2062489-2062511 TGGGAGACCCCAGGGGCTCCAGG + Intronic
968812019 4:2804448-2804470 CCAGCCTCCCCAGGGGCTCTTGG + Intronic
970789327 4:19838167-19838189 TCTGATTCCCAAGGTGCCCTGGG + Intergenic
971857334 4:32060172-32060194 ACTGATTTGCCAGGGGCTCTTGG - Intergenic
977230701 4:94449052-94449074 TCTGAGTCCAGAGGGGATCCAGG + Intergenic
979453727 4:120902986-120903008 AATGGCTCCCCAGGGGCTCTTGG + Intronic
980255941 4:130381406-130381428 TCTGAGCCCTCAGGGTCTCTAGG - Intergenic
983034696 4:162848949-162848971 ACTGAGTCCCTTGGGGCTCCTGG + Intergenic
985649946 5:1102765-1102787 TGTGAGTCCCCTGTGGCTCCAGG - Intronic
985719343 5:1481178-1481200 TCTGGGTCCTTAGAGGCTCTGGG - Intronic
985719361 5:1481241-1481263 TCTGAGTCCTCAGGGACTCTGGG - Intronic
986294976 5:6430622-6430644 TCTGTGTCCCCACTGGCCCTGGG - Intergenic
986519183 5:8595495-8595517 TCTCACTTCCCAGGGCCTCTAGG - Intergenic
988516751 5:31911771-31911793 GCTGAGTCCCCAGGAGCTGAGGG + Intronic
989771626 5:45152837-45152859 TCTCAGTGCTCATGGGCTCTGGG - Intergenic
992950529 5:81852892-81852914 TCAGAGTCCCCAGGCGCTGGTGG - Intergenic
993795863 5:92267589-92267611 TCTTGGTCCCCAGTGACTCTGGG + Intergenic
996934096 5:128928153-128928175 AAGGAGTCCCCAGGGGCTCTTGG + Intronic
997199378 5:132000458-132000480 ACTGAGGTCCCAGGGGCTCTCGG + Intronic
997879342 5:137575378-137575400 TCTGAGTCACCTGGAGCTTTAGG + Intronic
999090571 5:148932264-148932286 TCTCAGTCCTCAGGGACTTTGGG - Intronic
999528598 5:152436397-152436419 CCTGATTCTCCAGGGGCTCCTGG - Intergenic
1001426658 5:171627347-171627369 TCTGCATCCCCAGGAGCTCCAGG + Intergenic
1001541595 5:172543328-172543350 CCTGAGTTTGCAGGGGCTCTGGG - Intergenic
1002069436 5:176670612-176670634 GCTGAGGCCTCAGGGGCTCGAGG - Intergenic
1002078278 5:176722755-176722777 TCTGTGTCACCAAGGGCTGTCGG + Intergenic
1002457441 5:179353617-179353639 TCTGAGACCCCAGGCCTTCTGGG + Intergenic
1004295914 6:14410359-14410381 TCTGATGCACAAGGGGCTCTGGG - Intergenic
1004492577 6:16129824-16129846 TCTCGGGCCCCAGGGGTTCTTGG + Intronic
1004743900 6:18491156-18491178 ACTGAGTAGCCAGGGCCTCTGGG - Intergenic
1004987402 6:21098292-21098314 CCTAAGTCCCCAGGTGCTCAGGG + Intronic
1005258539 6:24031604-24031626 TTTGGGACCCCAGAGGCTCTAGG - Intergenic
1005864211 6:29926417-29926439 TCTGAGTCCCAATGGGTTCGCGG - Intergenic
1006125492 6:31835172-31835194 TTTGAGTCAGCAGGGGCTGTGGG - Exonic
1006513714 6:34534746-34534768 TCTCAGTCCCCAGGTCCTCAGGG + Exonic
1006838198 6:37011865-37011887 TCTGAGGCCTCAGGGGCTCCTGG - Intronic
1007663869 6:43503118-43503140 CCTGAGGTTCCAGGGGCTCTGGG - Intronic
1007723485 6:43900202-43900224 TCTCGGTCCCCAGGAGCACTTGG - Intergenic
1007848472 6:44780494-44780516 TCTGACCCACCAGGGGCTCCCGG + Intergenic
1007986114 6:46208572-46208594 TCTGAGTCCTCAGGCAGTCTAGG + Intergenic
1011248536 6:85345561-85345583 TATGAGTCCCCAGAACCTCTGGG + Intergenic
1015093233 6:129384624-129384646 TCTGGGTGCCTAGGGCCTCTAGG + Intronic
1015549057 6:134393275-134393297 TCTGGGTTCCCTGGGGCTCCTGG + Intergenic
1016979064 6:149837659-149837681 TCAGACTCCTCAGGGGCTCTTGG + Intronic
1017853018 6:158322001-158322023 TGCCAGTCCCCAGTGGCTCTGGG - Intronic
1018278257 6:162156463-162156485 TGTGATTTGCCAGGGGCTCTTGG - Intronic
1019155240 6:170034138-170034160 TCTGAGACCACAGGTGCACTAGG - Intergenic
1019326197 7:439489-439511 GCTGAGCCACCAGGGGCTCTCGG - Intergenic
1019530910 7:1502973-1502995 TCTGAGTGCCCTGGGGCGCCTGG - Exonic
1019781778 7:2944665-2944687 TCTGAATCCCCAGTGCCTCGTGG - Intronic
1019883654 7:3885053-3885075 CCATAGTCCCCAGGGGCTATTGG - Intronic
1022143073 7:27509948-27509970 CCTGAGGCCTCAGAGGCTCTTGG - Intergenic
1022671784 7:32462637-32462659 TCTGTGTCACCTGAGGCTCTGGG - Intergenic
1023028965 7:36076623-36076645 TTTGAGTCCCCAGGGGCCTCTGG - Intergenic
1024005844 7:45224525-45224547 TCTCAGGCCCCAAGGGCTTTGGG - Intergenic
1024858602 7:53811788-53811810 CCTGTGGCCCCTGGGGCTCTCGG - Intergenic
1028154498 7:87414305-87414327 TCTGAAGCCCCAGGGCCTCACGG - Intronic
1029869962 7:103680333-103680355 TCTGAGTCCCCAGGGGCTCTGGG + Intronic
1030105023 7:105979833-105979855 TCAATGTCCCCAGGGGCTCCGGG + Intronic
1030857966 7:114585333-114585355 TCAGAATCACCAGGAGCTCTTGG - Intronic
1031893751 7:127324384-127324406 TCTGAGTCCCTAGGGGTGGTGGG + Intergenic
1034203278 7:149295520-149295542 TCTGAGGGCCCAGGGGCAGTTGG + Intronic
1034391058 7:150788085-150788107 TCTGACTCCTCAGGGTCTCCAGG - Intergenic
1034980256 7:155471274-155471296 ACTGAGTTCCCAGGGGCAATGGG - Intergenic
1035309037 7:157953193-157953215 ACAGAGTCCCCAGCAGCTCTGGG + Intronic
1035726562 8:1828028-1828050 TGTGAGTCCCCAGGGACTGACGG - Intronic
1035933320 8:3809050-3809072 CGTGATTCCCCAGGGGCTGTTGG - Intronic
1035966080 8:4193540-4193562 TCTGAGTCACAAGAGGCTGTGGG + Intronic
1036608478 8:10329288-10329310 TCTGCTCCCCCAGGGGCTCCAGG + Intronic
1037985879 8:23290253-23290275 TCTCAGGCCCCAGAGGCTCAGGG - Exonic
1038537630 8:28365204-28365226 TCTGAGTCCCCAAAGACCCTTGG - Intronic
1041206648 8:55506204-55506226 TCTCAGTCCACAGGGCATCTGGG + Intronic
1043484477 8:80685587-80685609 TGTGGGTCCCCAGGGACACTGGG - Intronic
1046099769 8:109601136-109601158 TCTGAGTCCACAGTGGCTAGTGG - Intronic
1048335078 8:133496693-133496715 TCCGAGGCTCCAGGCGCTCTAGG - Intronic
1048335419 8:133498791-133498813 TCCGAGGCCTCAGGAGCTCTAGG - Intronic
1048931480 8:139318898-139318920 TCTGAGTCACCATGGGCTGAGGG + Intergenic
1049472702 8:142783451-142783473 TCTGAGGCCCCAGGAGCGCACGG + Intergenic
1049494083 8:142921606-142921628 TGTGAGTCCCCAGAGGCACAAGG + Intergenic
1053307055 9:36992180-36992202 TCTGATTCCACAGGGGCTTCTGG - Intronic
1053516453 9:38734576-38734598 TCTGTGTCCTCAGGAGCTGTGGG - Intergenic
1055502537 9:76916047-76916069 CCAGAGTTCCCAGGGTCTCTGGG - Intergenic
1056309356 9:85323332-85323354 TCTGAGCCCCTATGGGCTGTGGG - Intergenic
1056779032 9:89535687-89535709 TCTGAGCCCCCAGGGACCCCTGG + Intergenic
1057785012 9:98080882-98080904 TCTGTGGCCGCAGTGGCTCTGGG + Exonic
1059407226 9:114108692-114108714 TCTGAGTCCCCACAGTCTCCCGG + Intergenic
1059504659 9:114787448-114787470 TCTGTGTCCCCAGGGGCAGTAGG + Exonic
1061377809 9:130236420-130236442 TGTGAGTCCTCAGAGGCCCTGGG + Exonic
1061989208 9:134149125-134149147 TCTGACTCCCCAGTGACTGTTGG + Intronic
1185622858 X:1464234-1464256 TCTGACTCTCCAGGGGTGCTGGG - Exonic
1185699217 X:2217730-2217752 TCTTAGTTCCTAGGGGCTCCAGG - Intergenic
1187140442 X:16588106-16588128 CCTGACTGACCAGGGGCTCTTGG + Exonic
1188407005 X:29824089-29824111 TCTGAATCTCCAGGGACTGTAGG - Intronic
1189537547 X:41951715-41951737 TCTGAGTCCACAGGGTAACTTGG + Intergenic
1192152677 X:68721864-68721886 CCTGACTCCTCAGGGGCCCTGGG + Intronic
1193288244 X:79738864-79738886 TGTGATTTGCCAGGGGCTCTCGG + Intergenic
1196303625 X:114074188-114074210 TCTGTTTCCCGAGGGGCACTGGG - Intergenic
1197532642 X:127649130-127649152 TTTGACTCACCAGTGGCTCTAGG - Intergenic
1199523497 X:148765312-148765334 ACTAAATCTCCAGGGGCTCTTGG + Intronic
1199965270 X:152814752-152814774 TCTGAGTGCCTAGGGGCCCCTGG + Intergenic
1199976804 X:152899011-152899033 TCTGAGTCCCCAGCAGCCCTGGG - Intergenic
1200069409 X:153520298-153520320 TCAGAAGCCCCTGGGGCTCTGGG - Intronic
1200166496 X:154039213-154039235 CCTGTGTCACCAGAGGCTCTGGG + Intronic