ID: 1029870036

View in Genome Browser
Species Human (GRCh38)
Location 7:103680868-103680890
Sequence CAGGGCCTATTGACCTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029870036_1029870044 17 Left 1029870036 7:103680868-103680890 CCTGCAGAGGTCAATAGGCCCTG 0: 1
1: 0
2: 1
3: 44
4: 143
Right 1029870044 7:103680908-103680930 AGAGTCTCAGCCTTCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029870036 Original CRISPR CAGGGCCTATTGACCTCTGC AGG (reversed) Intronic
900544666 1:3222036-3222058 CGGGGCCTGCAGACCTCTGCTGG - Intronic
902727451 1:18346702-18346724 CAGGGCCTATGGACCTCTACAGG + Intronic
904326210 1:29728275-29728297 CAGGGCCTTCTGTCCTCTGGGGG + Intergenic
904330256 1:29754000-29754022 CAGGGGCTCCTGACCTCTCCTGG + Intergenic
904433297 1:30478983-30479005 CAGGGCCTTCTGTCCTCTGGAGG - Intergenic
905869184 1:41393437-41393459 CAGGACCCCTTGCCCTCTGCCGG + Intergenic
907386038 1:54125849-54125871 CAGGGCTCACTGCCCTCTGCTGG - Intergenic
913550256 1:119910462-119910484 CAGGTCCTAGTGACTTCTCCTGG + Intergenic
915140930 1:153768149-153768171 CAGGCCCTCTTGTCCTCTGATGG + Intronic
915823523 1:159051264-159051286 CAGGTCATATTGAGCACTGCTGG - Intronic
916470389 1:165117669-165117691 CACCGCATATTGACCCCTGCTGG - Intergenic
916743841 1:167669343-167669365 CAAGGCCTATTGGCCTCCACAGG + Intronic
917536379 1:175877382-175877404 CAGGGCCTGGTGGGCTCTGCAGG + Intergenic
919599075 1:199600183-199600205 AAGTGCCTGTTGACCCCTGCTGG - Intergenic
919923002 1:202177418-202177440 CAGGGCCTGCTGACCCCTGCAGG - Intergenic
920305473 1:205015576-205015598 CAGGGCCTATGGGCCTCAGAAGG + Intronic
922460679 1:225812458-225812480 AAGGGCATCTTGACCACTGCAGG + Intronic
922882084 1:228988791-228988813 GAGGGCCTGGTGACCTCGGCTGG + Intergenic
923216275 1:231851032-231851054 CAGGGCATACCGACCTCTCCAGG - Intronic
924351849 1:243122187-243122209 AAGGGCCTGGTGACCTCTTCGGG + Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1074612908 10:115038699-115038721 CAGGGTCCAGTGACCTTTGCGGG + Intergenic
1075274038 10:121077545-121077567 CAGGGCCTAGACACCCCTGCTGG + Intergenic
1076048263 10:127312412-127312434 CAGGCCCTATGCACTTCTGCAGG + Intronic
1076502374 10:130947419-130947441 CAGGGCTAATTGACCAATGCAGG + Intergenic
1077144849 11:1040254-1040276 CTGGCCATATTGAGCTCTGCCGG - Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1080062221 11:27969210-27969232 CAGGGCCATATGACCTCTTCTGG + Intergenic
1081592996 11:44438035-44438057 AGGTGCCTGTTGACCTCTGCTGG - Intergenic
1084227710 11:67727647-67727669 AAGGGCCTATTGAACTCCGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084704123 11:70806123-70806145 CCGGGCCTACTGACCTCTAAGGG + Intronic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1088108384 11:106230581-106230603 CAGGGCCTCTTTGCCTCTGTTGG - Intergenic
1089538613 11:119175650-119175672 CAGAGCCTAATCACCTCTGGAGG - Intronic
1091186052 11:133649073-133649095 CGCAGCCTATTGATCTCTGCTGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1096803779 12:54127908-54127930 CAGGGCCAAGTGGCCTCTGCAGG - Intergenic
1098143779 12:67477622-67477644 GAAGGCCTATTGACATCTGTGGG + Intergenic
1098250152 12:68560785-68560807 CAGGCCTAGTTGACCTCTGCTGG - Intergenic
1104725678 12:131074351-131074373 CAGGGGCTGCTGAGCTCTGCTGG - Intronic
1104749874 12:131231659-131231681 CGGGGCCCATTCACCTCTGCTGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1113282092 13:108799680-108799702 CTGGGCCCACTGACCTCTGCAGG - Intronic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1120989944 14:90366441-90366463 CATAGGCTATAGACCTCTGCAGG - Intergenic
1121065398 14:90959169-90959191 CAGGGCTTATGGACCTTTACTGG + Intronic
1121167831 14:91824344-91824366 AAGGGCTTATTTGCCTCTGCTGG + Intronic
1121919848 14:97870461-97870483 CAGGGCCTTTTGCAGTCTGCAGG + Intergenic
1125358836 15:38844887-38844909 CATAGGCTATAGACCTCTGCAGG - Intergenic
1128246136 15:66134116-66134138 CAGGGCCACTTGCTCTCTGCTGG - Intronic
1132387406 15:101410230-101410252 CAGGGCCTTTAGAATTCTGCAGG + Intronic
1133474826 16:6110744-6110766 CATGGCCTAGTGTCCTCTGGCGG - Intronic
1135647887 16:24179239-24179261 CAGGCCCACTTGACCACTGCTGG + Intronic
1136448111 16:30336197-30336219 CAGGGACTAGTGGCCTCTGCTGG - Intergenic
1136744013 16:32567226-32567248 CAGAGCCTATTGATGTCTACAGG + Intergenic
1138598018 16:58039813-58039835 AAGGGCCTACTATCCTCTGCTGG - Intronic
1139663048 16:68435263-68435285 CAGGGCCTATTGGTCTCAGCTGG + Intronic
1142047761 16:87936631-87936653 CAGGGATTAGTGGCCTCTGCTGG + Intergenic
1203025586 16_KI270728v1_random:508007-508029 CAGAGCCTATTGATGTCTACAGG - Intergenic
1203046135 16_KI270728v1_random:826424-826446 CAGAGCCTATTGATGTCTACAGG + Intergenic
1145037713 17:19552874-19552896 CAGGGCCTTGTGTTCTCTGCTGG + Intronic
1145188213 17:20814645-20814667 CAGGGCCTCTTCAGATCTGCTGG - Intergenic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1150078700 17:62217019-62217041 CAGGGCCTCTTCAGATCTGCTGG + Intergenic
1153439439 18:5100578-5100600 CAGGGCCTGTTGATCTCTAAGGG + Intergenic
1161372018 19:3917871-3917893 CAGGGACCATTGTCCTGTGCAGG + Intronic
1162382442 19:10339560-10339582 CAGGGCCTGCTGGACTCTGCTGG - Exonic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164447613 19:28331350-28331372 CAGGGTCTAGGGACCTCTGCTGG + Intergenic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1165391081 19:35539281-35539303 CAGCTCCCATTGACCACTGCTGG + Intronic
925139420 2:1539742-1539764 CAGGGCCTGTGGTCCTCTTCAGG + Intronic
925709738 2:6727081-6727103 CAGAGCATATTAACCACTGCAGG - Intergenic
927056429 2:19369702-19369724 CTGGGCCAAGTGACCTCTGCTGG - Intergenic
927150597 2:20193175-20193197 CTGGGCCTGTTCACCTCTGCAGG + Intergenic
928935968 2:36678271-36678293 GAGGGCATGGTGACCTCTGCAGG + Intergenic
931423681 2:62151431-62151453 CTGGGCCAAATGACCTCCGCTGG + Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
933947547 2:87299850-87299872 CAGGGCCTATTGGCCTTGGCCGG - Intergenic
935376857 2:102408824-102408846 CAAGTCCTAGTGACCTCAGCAGG - Intergenic
935619554 2:105116938-105116960 CAGTGCCCACTGACTTCTGCAGG - Intergenic
937493852 2:122397821-122397843 CAGGGCTTACTGTCCTCTCCTGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
942603974 2:177671176-177671198 CAGGGGCTACAGACCTATGCAGG - Intronic
944904020 2:204244642-204244664 CAGGGCCTCATTACCTCTGAAGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
948492451 2:238321811-238321833 CAGGGCCTCATGACCTCACCTGG + Intronic
948760814 2:240189958-240189980 CAGGCCCTGGTGGCCTCTGCAGG - Intergenic
1168910083 20:1440538-1440560 CAGGGCCTATGGGGCTCTGCAGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1173075135 20:39811140-39811162 CCTGCCCTGTTGACCTCTGCTGG + Intergenic
1175814856 20:61878043-61878065 CAGGGCCTGTTGTCCTCTCTGGG - Intronic
1175985634 20:62762987-62763009 CAGGGCCTAGTGACCACCGAGGG + Intergenic
1176287091 21:5023928-5023950 CAGGGGCTCTTGAAGTCTGCAGG - Intronic
1179285466 21:39974280-39974302 CAGGGCCTCATGCCCTCTGAAGG + Intergenic
1179862447 21:44197390-44197412 CAGGGCCGATTGTCCACTTCTGG + Intergenic
1179870090 21:44239547-44239569 CAGGGGCTCTTGAAGTCTGCAGG + Intronic
1181180820 22:21067124-21067146 CAAGGCCTATTCTCCTGTGCAGG - Intergenic
1181405260 22:22679902-22679924 CAGGGTCTTTTGAGCTCTGGAGG + Intergenic
1183101010 22:35584063-35584085 CAGAGCCTATGGCCCTCTGGGGG - Intergenic
1183443008 22:37833964-37833986 GAGGGCCTCTTGGCCTATGCAGG + Intronic
1184716156 22:46282903-46282925 CTGGGCCTGTTGATCTCTGCAGG + Intronic
1185083856 22:48725268-48725290 CAGGATTGATTGACCTCTGCCGG + Intronic
949221030 3:1633992-1634014 CAGGTCCTAATTACCTCTCCTGG + Intergenic
949328883 3:2899164-2899186 AAGGGCCTAGAGACCTCTGCTGG + Intronic
950624686 3:14236214-14236236 CAGCGCCTCTTGCCGTCTGCTGG - Intergenic
953196276 3:40737370-40737392 CAGGCTCTGTTGACCTCTGGTGG + Intergenic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
958021354 3:88000966-88000988 AATGGACTATTTACCTCTGCAGG + Intergenic
958645442 3:96865801-96865823 CATGGCCTACTGACATCTGGAGG + Intronic
959587747 3:108040865-108040887 CAGGTCCTGTGGACCTGTGCAGG + Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961784819 3:129341428-129341450 CAGGGACAGGTGACCTCTGCGGG - Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
964814283 3:160700545-160700567 AAGGGCGTATTGACCTCTAAGGG - Intergenic
967729000 3:192889576-192889598 CAGGTCCTACCTACCTCTGCTGG + Intronic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
971996513 4:33972460-33972482 CATGGCCTAATCACCTCTGAAGG - Intergenic
972863041 4:43195311-43195333 CAGGGACTACTTACCTCTACAGG - Intergenic
973134476 4:46689390-46689412 GATGGCCTACTGACATCTGCTGG - Intergenic
985851326 5:2390955-2390977 CAGGGCCTCCTGAACTCTACTGG - Intergenic
997586502 5:135046887-135046909 CAGGGCACATTGACCTCAACTGG + Intronic
1001586806 5:172838370-172838392 CAGGGCCGCATGACCTGTGCAGG - Intronic
1002439703 5:179257977-179257999 CTGGGCCCAGTGATCTCTGCTGG + Intronic
1003164337 6:3663242-3663264 CAAGGCCGCTTAACCTCTGCCGG - Intergenic
1009715664 6:67391558-67391580 AAGGGCCTTCTGTCCTCTGCAGG + Intergenic
1012873747 6:104700959-104700981 CAGGGCCTAATGTTCCCTGCAGG + Intergenic
1015183828 6:130391009-130391031 CATTGCCTAGTGTCCTCTGCGGG + Intronic
1016786762 6:148019315-148019337 CAGGGCCTGTTGACCACTAGAGG + Intergenic
1018471615 6:164102087-164102109 CAGGAGCCATTGTCCTCTGCAGG - Intergenic
1019305887 7:335592-335614 CAGGGCCTGGGGACCTCTGGAGG - Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1024249779 7:47497354-47497376 CAGGGCCTGGTGGCTTCTGCAGG - Intronic
1026841535 7:73671934-73671956 CAGGGGCTTCTGACCTGTGCAGG + Exonic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1029623735 7:101706818-101706840 CAGGGCCAATGGACAGCTGCAGG + Intergenic
1029870036 7:103680868-103680890 CAGGGCCTATTGACCTCTGCAGG - Intronic
1033289775 7:140073617-140073639 CAGAGGCAATTGACCTCTGTTGG - Intergenic
1034203007 7:149294211-149294233 CAGCTCCCATTGTCCTCTGCCGG - Intronic
1035707732 8:1689921-1689943 CTGGGCCCACTGATCTCTGCTGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036877906 8:12489063-12489085 AAGGGCTTATTGAACTCTGGGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037825598 8:22158804-22158826 CATGGACTATTGACCGCTGTTGG + Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039680494 8:39730298-39730320 CTGGGCCGGTTGACCTCCGCGGG + Intergenic
1040131865 8:43806414-43806436 CAGGGCCCATTGACGTCTATGGG + Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1045036304 8:98178928-98178950 CAGGCCCTCTTCTCCTCTGCAGG + Intergenic
1046713393 8:117539665-117539687 CTGGGGCCATAGACCTCTGCAGG + Intronic
1048436499 8:134423385-134423407 CAGAGCATAGTGACCTCTTCAGG + Intergenic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1052866332 9:33466683-33466705 CAGGGCCTCCTCACCTGTGCTGG + Exonic
1055834227 9:80419634-80419656 CAGGGCCTGTAGACCATTGCTGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1060594796 9:124841469-124841491 CTGGGCCCCCTGACCTCTGCAGG - Intergenic
1060796521 9:126515823-126515845 CAGGGCCAACTGTCCTCTGCTGG + Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1191115471 X:56847462-56847484 AAGCGTCTATTGACCCCTGCTGG - Intergenic
1192127075 X:68511454-68511476 CAGGCTCTAGTGGCCTCTGCTGG - Intronic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1197884467 X:131204089-131204111 CAGGAACTATTGACTTCTGTGGG + Intergenic
1199968952 X:152844493-152844515 AAGGCCTTATTGACCTCTGCTGG - Intronic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic