ID: 1029871296

View in Genome Browser
Species Human (GRCh38)
Location 7:103695746-103695768
Sequence CTGCTGTCATTGTTCAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029871296_1029871297 0 Left 1029871296 7:103695746-103695768 CCAGTGTTGAACAATGACAGCAG 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1029871297 7:103695769-103695791 AAATTCCTCTTTTAATCAAGTGG No data
1029871296_1029871300 7 Left 1029871296 7:103695746-103695768 CCAGTGTTGAACAATGACAGCAG 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1029871300 7:103695776-103695798 TCTTTTAATCAAGTGGTAGTGGG No data
1029871296_1029871299 6 Left 1029871296 7:103695746-103695768 CCAGTGTTGAACAATGACAGCAG 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1029871299 7:103695775-103695797 CTCTTTTAATCAAGTGGTAGTGG 0: 1
1: 0
2: 1
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029871296 Original CRISPR CTGCTGTCATTGTTCAACAC TGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
902281893 1:15380845-15380867 CTGCAGTCAGTGTTGAACGCAGG + Intronic
902281909 1:15381007-15381029 CTGTTGTCATTTTTCACCCCCGG + Intronic
903545322 1:24120358-24120380 CTTCTGTCATTGTTCAAAGGTGG - Exonic
905409205 1:37756653-37756675 CTGCCAGCATTGTTCAACAAAGG - Intronic
907632665 1:56098833-56098855 CTGTTATCATTTTTCACCACAGG - Intergenic
908216356 1:61957717-61957739 CTGCTGCAATTATTCAACTCTGG - Intronic
909992681 1:82242049-82242071 ATGCTGTCCTTGTTCAATCCTGG + Intergenic
912049705 1:105511401-105511423 TTGCTGTCATTCTTTAAAACTGG - Intergenic
913968241 1:143394383-143394405 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
914062620 1:144219975-144219997 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
914116530 1:144746379-144746401 ATGTTGTCATTGTTCAAGCCAGG - Intergenic
917035883 1:170746412-170746434 CTGCTGTCCTTGCTCCCCACGGG - Intergenic
922450845 1:225736020-225736042 CTACTGTCAGTTTTCAAGACAGG - Intergenic
1068746554 10:60538223-60538245 CTGTTATCCTTGTTCACCACTGG - Intronic
1069813611 10:71179854-71179876 CGGCTGTCTTTGTTCAATCCTGG - Intergenic
1074347190 10:112698762-112698784 GTGCACTCATTGTTGAACACAGG + Intronic
1078926922 11:15883677-15883699 CTCCTGTCATTGTTCTTCATTGG + Intergenic
1081383728 11:42446503-42446525 CTGCTGTCACTGTGCATCTCAGG - Intergenic
1082963645 11:58943247-58943269 CTGCTGGGATTGGCCAACACTGG - Exonic
1083392155 11:62360547-62360569 CTGCTTGCATTTTCCAACACTGG + Intronic
1083551228 11:63591551-63591573 CGGATGTCATTGTTGAAGACTGG - Intronic
1085333197 11:75669448-75669470 CTGCTGGAATTGGTCAAAACCGG + Intergenic
1087117413 11:94540618-94540640 CTGCTGTCATTGGCCAAACCTGG - Intergenic
1089803745 11:121063659-121063681 ATGCTCTCATTTTTCTACACTGG + Intronic
1095792098 12:46178597-46178619 ATGATGTCCTTGTTGAACACCGG - Intergenic
1100460180 12:94791683-94791705 GTGTTCTCATTGTTCAACAAGGG - Intergenic
1106578999 13:31001533-31001555 CTGCTTTCAGTGTTGAACAGAGG + Intergenic
1112452720 13:99526618-99526640 CTGCTGTCATTGATAAAGGCAGG + Intronic
1112525965 13:100147382-100147404 CAGCTATCACTGCTCAACACAGG - Intronic
1120399816 14:84016472-84016494 CTGCTTTCATTGAACAACACCGG - Intergenic
1121650844 14:95556749-95556771 CTGCTACCATTAGTCAACACTGG - Intergenic
1126048051 15:44663068-44663090 ATTCTTTCATTATTCAACACAGG - Intronic
1131265973 15:90915652-90915674 CTCCTGCCCTTGTTCTACACTGG - Intronic
1133792803 16:9022243-9022265 CCTCTGTCATTTATCAACACAGG - Intergenic
1134394258 16:13848562-13848584 ATGCTGTCACTGTGGAACACTGG - Intergenic
1134810036 16:17159509-17159531 CAGCTGGATTTGTTCAACACTGG + Intronic
1135267528 16:21040279-21040301 CTGATGTCCATGTTGAACACTGG - Intronic
1138746506 16:59368775-59368797 CTCCTGTCATTGCACAACCCTGG + Intergenic
1144708759 17:17386814-17386836 CTGATTTCATGGTGCAACACAGG - Intergenic
1145085410 17:19934351-19934373 CTTCTTTAATTGTTCAAGACAGG + Intronic
1145248249 17:21283857-21283879 CTGCTGCCCCTGTTCTACACAGG - Intergenic
1147462078 17:40579478-40579500 CTGCAGTCAGTGTCCAACAAAGG - Intergenic
1153490070 18:5638121-5638143 CTTCTGTCATTGCTCACCATAGG - Intergenic
1158124997 18:54091428-54091450 CTGCTGTCACTGTTTAATAAAGG - Intergenic
1160412190 18:78682799-78682821 CCACTGTCATTGTGCAACATCGG + Intergenic
1162685409 19:12379041-12379063 TTGTTGTTGTTGTTCAACACTGG - Intergenic
1165555729 19:36630240-36630262 GTGCTGTCATTTCTCAACAAAGG + Intergenic
1166143607 19:40819490-40819512 CTGCTGTGAATGGTAAACACAGG + Intronic
1166183944 19:41127289-41127311 CTGCTGTGAATGGTAAACACAGG - Intronic
1167264513 19:48477115-48477137 TTACTGTCATTGTTTAACCCTGG + Intronic
1202702028 1_KI270712v1_random:171847-171869 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
925788087 2:7452603-7452625 CTGCTGTTATTGTAGACCACAGG - Intergenic
926081599 2:9991022-9991044 GTGTTGTCATTTTTCAAGACTGG - Intronic
928317736 2:30258891-30258913 CTGCTGTCCTTACTCAACAGTGG + Exonic
928912056 2:36431885-36431907 TTGCTGTCATTGTTGCACAAAGG + Intronic
929556258 2:42927405-42927427 CTGGGCTCATTGTTGAACACTGG - Intergenic
932057947 2:68466444-68466466 CTGCAGTCTGTGTTCAACAGAGG + Exonic
932840238 2:75074994-75075016 CTGCTGTCATTTTCCCTCACTGG + Intronic
934172940 2:89555297-89555319 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
934283254 2:91629654-91629676 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
938367676 2:130747686-130747708 CTCCAGCCACTGTTCAACACAGG - Intergenic
939114160 2:138041353-138041375 CTGCTGTCAGTGTTCAGGATAGG - Intergenic
941274310 2:163471439-163471461 CTGCTCTCTTTCTTCAGCACTGG + Intergenic
943966958 2:194348485-194348507 CTGCTGGCATTATTTAACATTGG - Intergenic
944893252 2:204139091-204139113 AGGCTGTAATTGTTCAACAAAGG + Intergenic
947163450 2:227237560-227237582 CTGCTGTCATAGTTAAAAAGTGG - Intronic
948510944 2:238464829-238464851 GTGATGTCATTTATCAACACTGG - Intergenic
1172887803 20:38243035-38243057 ATGGTGTCACTGTTGAACACTGG - Intronic
1172957603 20:38772037-38772059 CTGATGTCTTTGTTCAACTGTGG + Exonic
1175598688 20:60255571-60255593 CTGCTGCCACTGTGCACCACGGG - Intergenic
1178872321 21:36386680-36386702 TTGCTTTCATTGTTCACCGCAGG - Intronic
1178963303 21:37089069-37089091 CTGATGTCATGGTTCTACGCTGG + Intronic
1179078533 21:38147704-38147726 CTGCTGTCATAGAACAAAACTGG - Intronic
1179121245 21:38548145-38548167 TTGCTGTCATTGAACAGCACAGG - Intronic
1182878629 22:33714050-33714072 CTGCTTTCATTATTGACCACTGG - Intronic
1184274235 22:43401094-43401116 CTGCTGTGATTGTTTATCAAGGG + Intergenic
949420043 3:3856059-3856081 CTGCTGACTTTATTCACCACCGG + Intronic
952407220 3:33015421-33015443 CTGCTCTATTTGTTCCACACAGG + Intronic
953479456 3:43237836-43237858 ATGATGTCAATGTTGAACACTGG + Intergenic
955749152 3:62169749-62169771 CTTGTGTCATTTATCAACACTGG + Intronic
959009153 3:101054455-101054477 CTGCTGTTATTTTCCAACATAGG + Intergenic
961726811 3:128936157-128936179 CTGCTGTCATTGCCCTGCACTGG + Intronic
963587714 3:147214220-147214242 CTGGTGTCATTTTTCAAGATAGG - Intergenic
964329795 3:155589775-155589797 CTGCTGTCATTGCTAAAAAGAGG - Intronic
964623091 3:158734490-158734512 CTGATGGCATTGTTGAACACAGG + Intronic
965680691 3:171248222-171248244 CTGCCTTCATTGTTCTCCACAGG - Intronic
965686060 3:171304023-171304045 CTCCTCTCATGGTTCAACTCAGG - Intronic
969177512 4:5410103-5410125 TGGCTGCCACTGTTCAACACAGG - Intronic
969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
970567470 4:17346827-17346849 CTCCAGTTATTGTTCTACACTGG + Intergenic
973336288 4:48959740-48959762 CTGCATTCATTGTACAAGACTGG - Intergenic
973724723 4:53763913-53763935 CTGCTGTCACTGTGCACCACAGG + Intronic
973795997 4:54427392-54427414 CTGCTGTCATATTTCAGTACAGG - Intergenic
977821581 4:101478160-101478182 CTGCTGTGAATGTCCAATACTGG + Intronic
978771384 4:112459570-112459592 CTTCTGTCATTCTTCCACAAAGG + Intergenic
981268074 4:142811012-142811034 CTGCTGACATTTTTCTGCACTGG + Intronic
983490802 4:168386773-168386795 CTGCTGTCATTGTTTCGCATGGG - Intronic
984887521 4:184463856-184463878 CTACTGTCATTCTCCAACAGGGG + Intronic
985178095 4:187224778-187224800 CTAATGTCATTGGTCAACAAGGG - Intergenic
987578637 5:19760520-19760542 CTGCTTTTAATGTTCAACTCTGG - Intronic
990455781 5:55986185-55986207 CTTCTATCATTGTTCAAAAAGGG + Intronic
991096604 5:62746411-62746433 CTGCTATCAGTGCTCAACAATGG + Intergenic
993567981 5:89498977-89498999 CTGCTGTCGTTATTAAACACAGG + Intergenic
994740763 5:103615634-103615656 CTGCTGCAATAGTTCACCACAGG + Intergenic
1006119334 6:31794921-31794943 CGGCTGTCCTTGTCCAACAGTGG - Exonic
1008120097 6:47604362-47604384 TTGGTGTCATAGTTCAAAACTGG + Intronic
1008724149 6:54395496-54395518 TTTCAGTCTTTGTTCAACACAGG + Intergenic
1018919567 6:168161737-168161759 CGGTTGTCAGTGTTCAACATGGG - Intergenic
1019281077 7:200524-200546 CTGCTGTCTCTGCTCAGCACGGG - Intronic
1019800840 7:3087270-3087292 ATGCTGTCATTGTCCTACCCTGG + Intergenic
1023862114 7:44222951-44222973 CTGCTGTCACTGTGCAGCAGGGG - Intronic
1024677336 7:51648509-51648531 CTGCTGTCCCTCTTCAATACAGG + Intergenic
1027759553 7:82260755-82260777 TTGATGTCATTGTTAAAAACAGG - Intronic
1028359602 7:89952045-89952067 CAGCTGTGATGGTTCAAAACAGG - Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030060594 7:105618011-105618033 CTGCTGTCACTGAGCAACATTGG - Intronic
1031450908 7:121916765-121916787 GTGCTGTCATTGGTCAAGATAGG + Intronic
1033911616 7:146269951-146269973 CTGCTGTCTTTGTTAAACATGGG + Intronic
1035849225 8:2897662-2897684 CTACTGTCATTATTCATCAGGGG + Intergenic
1042041388 8:64594245-64594267 CTGCTGACAGTGTCCATCACTGG + Intronic
1042947716 8:74171566-74171588 ATGGTGTCACTGTTGAACACTGG - Intergenic
1043045613 8:75319928-75319950 CTGCAGTCATTGAGCAACACAGG + Intergenic
1043549467 8:81353650-81353672 TTGCTGGCATTGATCAACACAGG + Intergenic
1043864230 8:85357520-85357542 CTGCTATCATTGTTCATGAGAGG + Intronic
1048480705 8:134789794-134789816 CTGATGTCTTTGGTCAACTCTGG + Intergenic
1050686913 9:8181741-8181763 CTGCTGTCATGGTGCATCAATGG + Intergenic
1055171248 9:73260768-73260790 CTGTTGTCTTTGTTCATCTCTGG + Intergenic
1056222794 9:84466784-84466806 AGGCTGTCATTCATCAACACAGG + Intergenic
1056520007 9:87392235-87392257 CTGCTTTCATCATTCCACACAGG - Intergenic
1058093403 9:100830825-100830847 TTGCTGACATTGTTGAAAACTGG + Intergenic
1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG + Intronic
1060611995 9:124975307-124975329 CTGCTGACATAGTTTGACACAGG - Intronic
1061639554 9:131941546-131941568 CTGTTGTCGTTGTTTACCACTGG - Intronic
1062293686 9:135811742-135811764 CTGCTGTAATTGTTTACAACAGG - Intronic
1187790723 X:22947189-22947211 CTGCTTTCCTTGGTCAAGACTGG + Intergenic
1188176334 X:26995344-26995366 CTGCTGTGCTTGTTCCACAGTGG - Intergenic
1190457114 X:50637250-50637272 CTGCTGCCACAGTTCAACTCTGG - Intronic
1200159625 X:153999578-153999600 CTCCCGGCATTGTTGAACACAGG - Intergenic