ID: 1029871299

View in Genome Browser
Species Human (GRCh38)
Location 7:103695775-103695797
Sequence CTCTTTTAATCAAGTGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029871295_1029871299 28 Left 1029871295 7:103695724-103695746 CCTGGGTTTATGCATCTGCTTGC 0: 1
1: 3
2: 1
3: 11
4: 136
Right 1029871299 7:103695775-103695797 CTCTTTTAATCAAGTGGTAGTGG 0: 1
1: 0
2: 1
3: 9
4: 169
1029871296_1029871299 6 Left 1029871296 7:103695746-103695768 CCAGTGTTGAACAATGACAGCAG 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1029871299 7:103695775-103695797 CTCTTTTAATCAAGTGGTAGTGG 0: 1
1: 0
2: 1
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029871299 Original CRISPR CTCTTTTAATCAAGTGGTAG TGG Intronic
904287855 1:29463839-29463861 GTCTTTTTATCAAGTGGTGCTGG - Intergenic
908803867 1:67909456-67909478 TTTTTTTAATCCAGTGGTAGGGG - Intergenic
911447505 1:98016482-98016504 ATCTTTAAATCAAGAGGGAGCGG - Intergenic
917531092 1:175835718-175835740 CTCTTTCAACCAATTGGCAGTGG + Intergenic
919368776 1:196699722-196699744 GTCTTTTAAACAAGTGATACTGG - Intronic
921091749 1:211850106-211850128 GTCTTTTTAACAAGTGGTACTGG - Intergenic
921258721 1:213366250-213366272 CTCTTTGGAACAGGTGGTAGAGG - Intergenic
923263452 1:232289395-232289417 CTCTTTTAAATAAATGGTATTGG + Intergenic
1063685506 10:8233724-8233746 CTCTTGAAATCATCTGGTAGTGG + Intergenic
1064575436 10:16741191-16741213 CTCTTTTTATCAAATGGTCTTGG - Intronic
1068513716 10:57999372-57999394 ATCTTTCAAGGAAGTGGTAGAGG - Intergenic
1070681161 10:78450058-78450080 CTCATTTATTAAAGTGGAAGGGG + Intergenic
1071179996 10:82972576-82972598 CATTTCTAATCAATTGGTAGTGG - Intronic
1072197265 10:93126942-93126964 TTCTTTTCTTCAATTGGTAGTGG - Intergenic
1073352148 10:102827608-102827630 CTTTGTTAATCAGGTGGCAGTGG - Intergenic
1074805013 10:117040423-117040445 ATCTTTTCATCAAATGGTAATGG + Intronic
1075376329 10:121980618-121980640 GTCTTTTCAACAAATGGTAGTGG + Intergenic
1076195510 10:128514768-128514790 CTCTGTTAATCAACTGGCACTGG - Intergenic
1080489846 11:32750859-32750881 CTCCTTTTCTCAAGTGGAAGGGG + Intronic
1081390843 11:42526907-42526929 CCCTATTAAACAGGTGGTAGAGG + Intergenic
1082917089 11:58448835-58448857 CTCTTTTCAACAAGTGGTGTTGG + Intergenic
1086257678 11:84898412-84898434 CTCTTTCAAGAAAGTGGTAGAGG - Intronic
1088342381 11:108783345-108783367 AGGTTTTATTCAAGTGGTAGAGG + Intronic
1089806665 11:121096843-121096865 CTGTTTTAATAAACTGCTAGAGG - Intergenic
1090987365 11:131780672-131780694 TTCTTTTAATAAGGTGGAAGAGG - Intronic
1095804313 12:46301901-46301923 CTCTTTTCATCAAGTGGAAAAGG + Intergenic
1097780523 12:63698313-63698335 CACTTTTAAACAAGTGATAATGG - Intergenic
1098296226 12:69006700-69006722 CTCATTTAATGATGTGGTTGGGG + Intergenic
1099465581 12:82983022-82983044 CTACTTTGATCAATTGGTAGTGG + Intronic
1100821533 12:98436216-98436238 CACTATTCATCAAGTGGAAGTGG - Intergenic
1101866096 12:108520678-108520700 CTCTTTGAATCATATGGTACAGG + Exonic
1101896601 12:108761767-108761789 ATGTTTTAGTCATGTGGTAGTGG - Intergenic
1103187914 12:118977461-118977483 CTATTTTAATAAAGTGATGGAGG + Intergenic
1103423114 12:120806408-120806430 GTCTTTTCATCAAATGGTACTGG + Intronic
1104177009 12:126342734-126342756 CTCTTGAACTCAAGTGGCAGAGG + Intergenic
1104750249 12:131233801-131233823 GTCTTTTCATGAAGTGGGAGCGG - Intergenic
1105936997 13:25110490-25110512 GTCTTTTCAACAAATGGTAGTGG - Intergenic
1106964078 13:35038412-35038434 CTGTTTTTATCAAGCGGAAGGGG + Intronic
1109503027 13:63262981-63263003 GTCTTTCAAACAAATGGTAGTGG - Intergenic
1109808548 13:67476530-67476552 CTTTTTTAAAAAAGTGGTAATGG + Intergenic
1111625852 13:90785864-90785886 CACTTTTCATCAAGTGATAATGG - Intergenic
1111974155 13:94947958-94947980 CTCTTTTTATTAAGAGGTAGGGG - Intergenic
1112218112 13:97457034-97457056 ATCTTTTAATAAAGTGTTATGGG - Intronic
1113436484 13:110296010-110296032 GTCTCTTAATCAAGTGGGAGAGG - Intronic
1114159079 14:20142731-20142753 CTCTCATTATCAAGTGATAGAGG - Intergenic
1114175754 14:20318170-20318192 CTCTTTAAATTAAGCGATAGTGG + Intronic
1114282635 14:21207711-21207733 ATGTTTTATTCAAGTGTTAGGGG - Intergenic
1116262424 14:42647587-42647609 GTCTTTTCATCAAGTGGCACTGG - Intergenic
1120301047 14:82707305-82707327 GTCTTTTAAACAAATGGTACTGG + Intergenic
1121475559 14:94198756-94198778 ATCTTTTCAACAAGTGGTGGTGG - Intronic
1121478231 14:94234763-94234785 CTCTTTTAATCCAGACATAGAGG - Intronic
1122587926 14:102823399-102823421 CACTTTTAATCATGAGGGAGAGG - Intronic
1124444782 15:29721033-29721055 CCCTTTTAAGCAAGGGGAAGAGG + Intronic
1126480646 15:49115992-49116014 CTCTGTTAAACAAGTGGTGCTGG + Intronic
1128442439 15:67724630-67724652 CTCTTTTTATCAAGTTCTATTGG - Intronic
1128455748 15:67830385-67830407 GGCTTTTAATCAAGTGTAAGCGG + Intronic
1129627812 15:77222613-77222635 CTCTGTTAATCAACTGGTCTTGG + Intronic
1130252455 15:82308741-82308763 CACTGTTAATTAAGTGGAAGTGG + Intergenic
1137607735 16:49797725-49797747 CTCTTTTCAGCAAGTGGTCAGGG - Intronic
1140687654 16:77449048-77449070 CCTTTTTAAACAAATGGTAGAGG + Intergenic
1140703786 16:77606968-77606990 ATCTTTTAAGCAAGTGTTTGAGG - Intergenic
1146963337 17:37003775-37003797 CTCTTTTAGTAGAGTGGTGGAGG + Intronic
1148524107 17:48313277-48313299 ATCTTTAACTCAAGTGGAAGGGG - Intronic
1149130121 17:53289964-53289986 TTTTTTTAAACAAGTGGTATTGG - Intergenic
1153049413 18:887170-887192 CTCATTTAATCAGATGGCAGGGG + Intergenic
1156747521 18:40410472-40410494 CTCATTTAATCAGGTAGTAGGGG - Intergenic
1156897236 18:42259650-42259672 GTCTTTTTCTCAAGTTGTAGGGG + Intergenic
1156913854 18:42442415-42442437 CTCTTTTACTCCAGTGTCAGAGG + Intergenic
1158038512 18:53064792-53064814 CATTTTTAATTCAGTGGTAGTGG - Intronic
1164295927 19:23909997-23910019 CTCACTGAATCAAGTGGCAGGGG - Intergenic
926939164 2:18116922-18116944 CACATTCAATCATGTGGTAGGGG - Intronic
928318167 2:30262094-30262116 GTCTTTTCAACAAGTGGTACTGG + Intronic
930720943 2:54637160-54637182 CACTTTTAATCAATTGATAAGGG - Intronic
932402182 2:71488671-71488693 CTGCTTTAATCAAGTGTTATAGG + Intronic
935688771 2:105711722-105711744 CACCTTTAATCAAGTGCTACTGG + Intergenic
939032050 2:137088386-137088408 CCCTTTTAAACAAATGGTACTGG + Intronic
939088948 2:137756760-137756782 GTCTTTTAAACAAATGGTATAGG + Intergenic
941402907 2:165053534-165053556 GTCTTTTAAACAAATGGTACTGG + Intergenic
941792747 2:169570757-169570779 CTCTTGAATTCACGTGGTAGAGG - Intronic
943001976 2:182339202-182339224 ATCTATTAAACAAGTGGAAGTGG - Intronic
943373035 2:187040383-187040405 CTATTGTAATCCAGTGTTAGAGG + Intergenic
944434999 2:199679036-199679058 CTCATTCAAACAAGTGCTAGCGG - Intergenic
945962013 2:216145497-216145519 CTCTTTTAAGCAACTGTTACTGG - Intronic
1169669869 20:8085417-8085439 GTCTTTTAAACAAGTAGTACTGG - Intergenic
1169710966 20:8562984-8563006 CACTTTTATTCAAGTGGTAGAGG - Intronic
1170071957 20:12378932-12378954 CTTTTTTCAACAAATGGTAGAGG + Intergenic
1170114987 20:12847924-12847946 ATTTTTTAATGAAGTGGTAATGG - Intergenic
1170132503 20:13036421-13036443 TTCTTTTCATTAAGTGGAAGTGG - Intronic
1170955837 20:20978650-20978672 CTCTTATATTCCAGTGGTGGGGG - Intergenic
1170988830 20:21283659-21283681 CTCTTTGAAGCAATTGTTAGTGG + Intergenic
1171082229 20:22198505-22198527 CTCTTTGAAGCAATTGTTAGTGG - Intergenic
1172196347 20:33094294-33094316 CTCTTTGTGTCAAGTGGTACTGG + Intronic
1172928989 20:38568915-38568937 CTCTTTAAATCTAGGGCTAGAGG + Intronic
1177799438 21:25813330-25813352 GTCTTTTAAACAAATGGTACTGG + Intergenic
1178213322 21:30562859-30562881 CACTTTTAATAAACTGGTAAAGG - Intergenic
1183820069 22:40338977-40338999 CTCTTTTAGTGAAATGATAGGGG - Intergenic
1183877999 22:40800704-40800726 GTATTTTAATCATGAGGTAGAGG + Intronic
950856179 3:16107524-16107546 CACTTTTAGTTCAGTGGTAGGGG - Intergenic
951230623 3:20174407-20174429 CTCTGTGAATCAAGTGGTTCAGG - Exonic
951353143 3:21630870-21630892 CTCTTTTAAAGAAGAGGTAGGGG + Intronic
951610694 3:24489927-24489949 CTCTTGTATCCAAGTAGTAGGGG - Intronic
952015545 3:28952377-28952399 CTCTTTTTTTCTAGTGGTGGTGG + Intergenic
952244892 3:31576719-31576741 CTCTTTTTGACAAGTGGTGGAGG + Intronic
955112800 3:55965919-55965941 CTCATTTAATCAGGGGGAAGTGG - Intronic
956100276 3:65760918-65760940 TTCTTTGAAACAAGGGGTAGAGG + Intronic
958581807 3:96035560-96035582 GTCTTTTAAACAAATGGTACTGG - Intergenic
959499963 3:107095283-107095305 GTCTTTTCAACAAGTGGTACAGG + Intergenic
959619325 3:108383015-108383037 CTCTTCTAATCTAATGGTAGAGG - Intronic
960886047 3:122395952-122395974 GTCTTTTAAACAAGTGGTGCTGG + Intronic
963183608 3:142388248-142388270 TACTATTAATTAAGTGGTAGTGG - Intronic
963862899 3:150329202-150329224 CTCTTTAAAACAAGTGGGGGTGG + Intergenic
966471563 3:180294963-180294985 TTTTTTTAAGGAAGTGGTAGGGG - Intergenic
967339547 3:188381089-188381111 CTCCTTTAATAAATGGGTAGTGG + Intronic
968344963 3:197995146-197995168 CACTATTCATCAAGTGGAAGTGG - Intronic
968628840 4:1639914-1639936 CACTTTTAATAAAATCGTAGGGG - Exonic
969166584 4:5321433-5321455 CTTATTTAATCAAGTGGTGAGGG + Intronic
970279009 4:14433522-14433544 CTCTTTTATTCTAATGGAAGTGG - Intergenic
971817932 4:31513497-31513519 CTGTTTTACCCATGTGGTAGAGG + Intergenic
972656418 4:41067795-41067817 CTGTTTTAGTGAAGTGGTGGAGG + Intronic
972976459 4:44642304-44642326 CTTTCTTAAATAAGTGGTAGAGG - Intronic
975092009 4:70415036-70415058 CACTTTAAATCAAGAGCTAGAGG - Intergenic
976509102 4:85887250-85887272 ATCTTTTAATTAAATGTTAGAGG - Intronic
981505341 4:145493201-145493223 CTCTTTGAGCTAAGTGGTAGAGG + Intronic
984738172 4:183131131-183131153 CTCTTTTTAACAAATGGTATTGG + Intronic
984744843 4:183204485-183204507 CTCTTTTCAACAGCTGGTAGTGG + Intronic
988042340 5:25905581-25905603 CTGTTTTGATCAACGGGTAGAGG - Intergenic
990298750 5:54429667-54429689 CTCATTTAATCAAGTCGTCAAGG + Intergenic
992830077 5:80585355-80585377 CTCTTCAAATCAGGTGGGAGGGG - Intergenic
993478803 5:88397370-88397392 TTCTTTTATTCAAGTGTGAGAGG + Intergenic
994416453 5:99477712-99477734 CTCTTTTATTCTTCTGGTAGAGG + Intergenic
997019603 5:129983276-129983298 CTCTTTTAGTGATGTGGCAGTGG + Intronic
1001125971 5:169019633-169019655 TCATTTTAAGCAAGTGGTAGAGG - Intronic
1001407224 5:171484620-171484642 TTTTTTTAATCAAGTTGTGGGGG - Intergenic
1003844910 6:10163123-10163145 CTCTTTTCATTCAGTGGAAGTGG - Intronic
1006892420 6:37440483-37440505 TTCTTTTATTCACGTGGTATAGG - Intronic
1008173419 6:48236383-48236405 TTTTTTTAATTAACTGGTAGTGG - Intergenic
1008738199 6:54573160-54573182 CTCTTTTCAACAAATGGTACTGG - Intergenic
1011498051 6:87956226-87956248 GTCTTTTCAACAAGTGGTAATGG - Intergenic
1011951066 6:92965217-92965239 CTCTCCTAAACAAGTGGTTGTGG - Intergenic
1012702277 6:102474815-102474837 CTTTTTTATTCAGGTGGCAGTGG + Intergenic
1013984850 6:116178467-116178489 CTCTTTTAATAAACTGGTCCAGG - Intronic
1014059560 6:117054966-117054988 CTCTTTTAATCAATGGGTTCTGG + Intergenic
1016396803 6:143632361-143632383 CTATTTTAATAAATTGGTGGCGG - Intronic
1018292090 6:162302163-162302185 GGCCTTTACTCAAGTGGTAGAGG - Intronic
1022939101 7:35214364-35214386 CACTTTTAAACAAGTGATAATGG - Intronic
1028159938 7:87474799-87474821 CAGTTTTGTTCAAGTGGTAGGGG - Intronic
1029871299 7:103695775-103695797 CTCTTTTAATCAAGTGGTAGTGG + Intronic
1030009642 7:105153465-105153487 CTATTTCAATCAAGTTGTGGTGG - Intronic
1032558709 7:132865309-132865331 CTGTTTTAATCATGGGGAAGAGG + Intronic
1037034940 8:14154687-14154709 CTCCTTTTATAAAATGGTAGAGG + Intronic
1039502009 8:38025413-38025435 CTCTTGAACTCAAGAGGTAGAGG + Intergenic
1041363609 8:57077702-57077724 ATCTTATAATCAAGAGGTAAGGG - Intergenic
1041607991 8:59807538-59807560 AGCTTTTAAACAAGTGGTACTGG + Intergenic
1042711655 8:71724022-71724044 GTCTTTCAAGCAAGTGGTAATGG - Intergenic
1042910501 8:73821272-73821294 ATCTTTTAATGAAGTGGTTAGGG - Intronic
1043296433 8:78669001-78669023 GTCTTCTAATCAAGTTTTAGAGG - Intronic
1043652509 8:82614213-82614235 CTCTTCTAAACAAATGGTGGTGG - Intergenic
1046884413 8:119348155-119348177 CTCTTTTCAACAAATGGTACTGG - Intergenic
1046934663 8:119874380-119874402 CTCCTTTTATCAAGGAGTAGAGG - Intronic
1047123990 8:121939648-121939670 CTGTTTGAAAGAAGTGGTAGAGG + Intergenic
1047434102 8:124820716-124820738 CTCTTTTCAACAAGTGGTGTTGG - Intergenic
1050038986 9:1467933-1467955 ATATTTTAATCTGGTGGTAGTGG + Intergenic
1050310134 9:4344252-4344274 CTGTTTCAATGAAATGGTAGTGG - Intronic
1052058725 9:23933794-23933816 CCCTTTTATTGAAGGGGTAGAGG - Intergenic
1053816466 9:41917469-41917491 CACATTTAACCAAGAGGTAGAGG - Intronic
1054106726 9:61061151-61061173 CACATTTAACCAAGAGGTAGAGG - Intergenic
1054614131 9:67269974-67269996 CACATTTAACCAAGAGGTAGAGG + Intergenic
1055465522 9:76561650-76561672 CTCTTCTAATCAAGTGCTGGTGG + Intergenic
1056907230 9:90663983-90664005 CTCTTTTAATGAAGGTCTAGCGG + Intergenic
1186656459 X:11616802-11616824 CTCCTGGAATCTAGTGGTAGAGG + Intronic
1188012808 X:25075491-25075513 CTTTTTTAATAAAGTGAGAGGGG - Intergenic
1188386652 X:29568894-29568916 CTATTTTAATCAAGTGACACTGG - Intronic
1189463349 X:41259929-41259951 CTCTTTGAATCAAGAGGTGCAGG - Intergenic
1192539129 X:71953389-71953411 CTATTTAAGTCATGTGGTAGTGG + Intergenic
1193570987 X:83143039-83143061 TTCTTTTAATTGAATGGTAGTGG - Intergenic
1193876081 X:86864228-86864250 TCCTTATAATCAAGTGGCAGAGG + Intergenic
1194209198 X:91049673-91049695 CACATTTAAGAAAGTGGTAGTGG + Intergenic
1194280777 X:91951177-91951199 GGCTTTTACTCTAGTGGTAGAGG - Intronic
1197664213 X:129205941-129205963 CTCTTTTTAACAAGTGGTGCTGG - Intergenic
1198849699 X:140953254-140953276 CTCTGTTAATCATGTGGTCAGGG + Intergenic