ID: 1029871300

View in Genome Browser
Species Human (GRCh38)
Location 7:103695776-103695798
Sequence TCTTTTAATCAAGTGGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029871295_1029871300 29 Left 1029871295 7:103695724-103695746 CCTGGGTTTATGCATCTGCTTGC 0: 1
1: 3
2: 1
3: 11
4: 136
Right 1029871300 7:103695776-103695798 TCTTTTAATCAAGTGGTAGTGGG No data
1029871296_1029871300 7 Left 1029871296 7:103695746-103695768 CCAGTGTTGAACAATGACAGCAG 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1029871300 7:103695776-103695798 TCTTTTAATCAAGTGGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029871300 Original CRISPR TCTTTTAATCAAGTGGTAGT GGG Intronic
No off target data available for this crispr