ID: 1029873921

View in Genome Browser
Species Human (GRCh38)
Location 7:103727458-103727480
Sequence GTGGCTAATGAGCCTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029873921 Original CRISPR GTGGCTAATGAGCCTTTTTT TGG (reversed) Intronic
901719912 1:11188723-11188745 GTGGCTACAAAGTCTTTTTTTGG + Intronic
903633701 1:24798032-24798054 GTGGCTACTCAGTCTTTTTTAGG + Intronic
908706013 1:66955511-66955533 GTTGCTAATACACCTTTTTTTGG + Intronic
909795796 1:79734400-79734422 GTGGTTAATAAGCCATTCTTTGG + Intergenic
910290398 1:85595083-85595105 GTGGCCCAGGAGCCTTTTTGAGG - Intergenic
918536369 1:185579292-185579314 TTGGCTATTCAGGCTTTTTTTGG + Intergenic
918600373 1:186351420-186351442 CTGGCTACTAAGCCTTTGTTTGG + Exonic
923318661 1:232806127-232806149 GCGGCTTATCAGCCTCTTTTGGG - Exonic
924345330 1:243068301-243068323 CTGGCTAATGTTTCTTTTTTTGG - Intergenic
1066731004 10:38436508-38436530 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
1067424318 10:46193027-46193049 TTGGCCAGTCAGCCTTTTTTTGG + Intergenic
1069562617 10:69441478-69441500 GTGTCCAGTGAGCCTTTTTGAGG - Intergenic
1070375092 10:75822481-75822503 TTGGCTATTCAGGCTTTTTTTGG - Intronic
1070860735 10:79658437-79658459 TTGGCCATTCAGCCTTTTTTTGG + Intergenic
1071643457 10:87339318-87339340 TTGGCCATTCAGCCTTTTTTTGG - Intergenic
1072203896 10:93185421-93185443 TTGGCTATTCAGGCTTTTTTTGG + Intergenic
1073518435 10:104101173-104101195 TTGGCTTATGAGGATTTTTTAGG + Intergenic
1074671207 10:115794318-115794340 GTGGAAAATGTTCCTTTTTTAGG - Intronic
1079986874 11:27208962-27208984 GTGGCAAAAGATCCTTTTCTTGG - Intergenic
1081473661 11:43402342-43402364 GTTGATAATGAGCATTTTGTTGG - Intronic
1083380893 11:62267721-62267743 CTTGCAAATGAGCCTTTCTTGGG + Intergenic
1083480817 11:62945269-62945291 GTGGCTAATCAGCTTTCTTCTGG + Intronic
1087257656 11:95974582-95974604 GATGCTAATGAGTCTTTTTTTGG + Intergenic
1088000172 11:104869702-104869724 GTGTCAAAAGTGCCTTTTTTTGG + Intergenic
1088112164 11:106274799-106274821 GTGGCTATTGGGCTGTTTTTTGG + Intergenic
1093311668 12:17595392-17595414 GTTACTAATGAGCCTTTAATCGG - Intergenic
1099494842 12:83334500-83334522 TTTGGAAATGAGCCTTTTTTAGG + Intergenic
1100316239 12:93447291-93447313 TTAGCTAATTAGTCTTTTTTTGG + Intergenic
1104061898 12:125275710-125275732 TTGGCTAATGTGTTTTTTTTGGG + Intronic
1108760001 13:53551672-53551694 GTGGCTTATGATCCTTTTACAGG - Intergenic
1109308713 13:60667190-60667212 TTGGCTATTTAGGCTTTTTTTGG + Intergenic
1110788860 13:79565164-79565186 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
1111331690 13:86766187-86766209 GTGGGTGATGAGGCTTGTTTTGG - Intergenic
1111491961 13:88990646-88990668 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
1112101655 13:96196484-96196506 GTGGGTATTGAGTCTTCTTTTGG + Intronic
1112782843 13:102920534-102920556 TTGGCTGATGAGGCTTCTTTTGG - Intergenic
1113629632 13:111873469-111873491 GTGGCTGATGAGGCATTTTGGGG - Intergenic
1116923085 14:50602211-50602233 GTGGAAAATGAGCCTTTCCTGGG - Intronic
1117792579 14:59356666-59356688 GTGTCTAAAGAGCCTTTTTAAGG + Intronic
1118256661 14:64211310-64211332 GTGGCTAATCTGCCTTCGTTTGG + Intronic
1120208387 14:81610565-81610587 GTGGATAATGTGCAATTTTTAGG - Intergenic
1126598489 15:50405241-50405263 GTGGCTAATGGGACTTAATTAGG - Intergenic
1135167959 16:20157098-20157120 GTGGCAAATGAGGCATTTGTTGG - Intergenic
1138253960 16:55535798-55535820 GTGGCCAATAGGACTTTTTTTGG + Intronic
1140561971 16:75994094-75994116 GTGGAAAATGAGACTATTTTTGG + Intergenic
1156032196 18:32725524-32725546 GTGGCTAATGAGCCAATGTCTGG + Intronic
1162697147 19:12485092-12485114 GTGGACAAAGAGCCTTTTTCTGG - Intronic
1166814406 19:45533840-45533862 GTGGCTATGGTGCCTTCTTTCGG - Intronic
927127887 2:20029855-20029877 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
927346400 2:22048211-22048233 GTTGCTAATGATTCTTTATTAGG - Intergenic
929913873 2:46117345-46117367 GTGGCTAATAATCCTGCTTTGGG + Intronic
930269134 2:49235484-49235506 GTGGCTTATTAGACATTTTTTGG + Intergenic
930282749 2:49390455-49390477 GTGGCTATTTAGGCTCTTTTTGG - Intergenic
935338652 2:102040000-102040022 TTGGCTATTCAGGCTTTTTTTGG + Intergenic
940186126 2:150986290-150986312 GTGGCCAAAGAACCTTTTTCTGG - Intergenic
942154626 2:173115450-173115472 GTGGCTAGTGTGATTTTTTTGGG + Intronic
944166391 2:196726488-196726510 GTGCCAAATGACCCTTGTTTGGG + Intronic
944774439 2:202948324-202948346 TTGGCTATTTGGCCTTTTTTTGG + Intronic
945214749 2:207421534-207421556 GGGACTAATAAGCCCTTTTTGGG - Intergenic
945521106 2:210828480-210828502 TTGGCTAATCAGGCTCTTTTTGG + Intergenic
948074786 2:235157527-235157549 GGAGCTAATGTGACTTTTTTGGG - Intergenic
1170413746 20:16118323-16118345 TTGGCTATTTAGGCTTTTTTTGG - Intergenic
1177938727 21:27382478-27382500 GTGGCTAATGTTCCTTCTGTAGG + Intergenic
1183208041 22:36432905-36432927 GTGGCTAATTTTCCTTTTTAGGG - Intergenic
955921607 3:63962768-63962790 GTGGCTAATAGGCCTTTTTCTGG + Intronic
956387684 3:68738144-68738166 CTGGCTAATCATCATTTTTTCGG - Intronic
957166544 3:76681508-76681530 CTGGCTTATAAGCCTATTTTGGG + Intronic
957668398 3:83267723-83267745 GTGGGATTTGAGCCTTTTTTTGG - Intergenic
958623320 3:96591812-96591834 GTGGGTTATGAGGCTTTGTTTGG - Intergenic
966519855 3:180861100-180861122 TTGGCTACTCAGGCTTTTTTTGG - Intronic
967326149 3:188242031-188242053 GTGGATGATGTGCTTTTTTTGGG + Intronic
968431835 4:563614-563636 GTTGCTATGGAGCCTTTATTTGG + Intergenic
968431977 4:564376-564398 GTTGCTATGGAGCCTTTATTTGG + Intergenic
968866330 4:3214588-3214610 GTGGCTAATGACCCTTGTTGAGG - Intronic
970227741 4:13877449-13877471 GTGGCTAATGAGCATTTGAAGGG + Intergenic
977313832 4:95419842-95419864 GAGGCCAATGATCCTTTGTTTGG - Intronic
979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
979330966 4:119421171-119421193 CTGGCTAATGTTTCTTTTTTTGG - Intergenic
981869123 4:149465432-149465454 GCAGTTAATCAGCCTTTTTTCGG - Intergenic
985119195 4:186622868-186622890 GTGGCAAGTGAGCTTTGTTTTGG - Intronic
987772064 5:22318289-22318311 CTGGCCAATTTGCCTTTTTTGGG + Intronic
988363684 5:30268436-30268458 GTGGCTAATGATACTTTCTGTGG + Intergenic
988494219 5:31731130-31731152 GAGGCTAAAGAGCCTTTTCAGGG + Intronic
990857861 5:60290911-60290933 TTGGCTTGTGACCCTTTTTTGGG - Intronic
995653515 5:114398520-114398542 TTGGCTATTCAGGCTTTTTTTGG + Intronic
996116669 5:119628012-119628034 GGGGCCAAAGAGCATTTTTTTGG - Intronic
1007420345 6:41715371-41715393 CCGGCTCATGAGACTTTTTTGGG - Intronic
1008709498 6:54207612-54207634 GTGGCAAATAAGTCTTCTTTGGG - Intronic
1010549149 6:77200219-77200241 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
1010556049 6:77281129-77281151 TTGGCTATTTAGTCTTTTTTTGG - Intergenic
1010823910 6:80449945-80449967 GTGACTAATGAGTTTATTTTTGG + Intergenic
1012034036 6:94108788-94108810 GTGACTAATCAGCCACTTTTTGG - Intergenic
1015079837 6:129210312-129210334 GTGGCTAACGAGGTTATTTTAGG - Intronic
1021396337 7:20153127-20153149 CTGGCTAAAGAGTCTTATTTTGG + Intronic
1022319862 7:29278475-29278497 GTGGCTCATGGGCCAATTTTGGG - Intronic
1023059490 7:36314449-36314471 TTGGCTACAGAGCCTTCTTTGGG - Intergenic
1024072306 7:45796458-45796480 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
1029873921 7:103727458-103727480 GTGGCTAATGAGCCTTTTTTTGG - Intronic
1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
1041231283 8:55755403-55755425 GTGGCTAATAGGCCTTCTGTAGG - Intronic
1041531415 8:58872170-58872192 TTGGCCAATGAGGCTATTTTAGG - Intronic
1042319993 8:67464980-67465002 GTGGCTAATCAGGCTCCTTTTGG + Intronic
1042964474 8:74335934-74335956 GGGTCTAATGATCCCTTTTTAGG - Intronic
1043280073 8:78452988-78453010 GTAGCTAATGAGCTTTGATTTGG + Intergenic
1043441871 8:80283403-80283425 GTAGCTAGTGAGCATGTTTTGGG - Intergenic
1044416083 8:91942080-91942102 GTGGCTAATGAACCTGGCTTTGG - Intergenic
1044617617 8:94158392-94158414 GTGGTTAATGGGCCCTTTTAGGG - Intronic
1045290644 8:100829877-100829899 GTGACTAATGGGCTTTCTTTTGG + Intergenic
1048056966 8:130876432-130876454 CAAGCTAATCAGCCTTTTTTGGG + Intronic
1048549047 8:135416618-135416640 GTGGCTAAGGAGCCTCTTTAAGG + Intergenic
1052862739 9:33447011-33447033 GAGGCAAATGAGCCATTATTAGG - Intronic
1055321201 9:75085000-75085022 GCTGCCAATTAGCCTTTTTTTGG + Intronic
1056493481 9:87131945-87131967 TTGGCTATTCAGGCTTTTTTTGG - Intergenic
1059180158 9:112204423-112204445 CTGGCTATTCAGGCTTTTTTAGG + Intergenic
1185882052 X:3750199-3750221 GTGGATAATATACCTTTTTTGGG - Intergenic
1188687794 X:33090240-33090262 GTGGCTTATGAGGGTTTTTATGG - Intronic
1188982739 X:36741930-36741952 TTGGCTAATCAGGCTATTTTTGG + Intergenic
1191822000 X:65320568-65320590 TTGGCTATTCAGACTTTTTTTGG - Intergenic
1192968080 X:76201741-76201763 GGTGATAAAGAGCCTTTTTTTGG + Intergenic
1193499366 X:82255427-82255449 TTGGCTATTTAGGCTTTTTTTGG + Intergenic
1194909813 X:99628245-99628267 TTGGCTATTCAGCCTTTCTTTGG - Intergenic
1194914261 X:99685539-99685561 TTGGCTATTTAGGCTTTTTTTGG - Intergenic
1197279232 X:124515869-124515891 TTGGCTATTTAGGCTTTTTTGGG - Intronic
1197308931 X:124880019-124880041 TTGGCTACTCAGGCTTTTTTTGG + Intronic
1197352498 X:125395302-125395324 GTGGATACTGATCCTGTTTTGGG + Intergenic
1197733071 X:129828261-129828283 GTGGCTCAAGAGCCACTTTTTGG - Intronic
1198392365 X:136189134-136189156 GTGGCTAATTAGACCTTTTCTGG - Intronic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic