ID: 1029878024

View in Genome Browser
Species Human (GRCh38)
Location 7:103773942-103773964
Sequence CTTATTTAGCACTGTGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029878022_1029878024 -5 Left 1029878022 7:103773924-103773946 CCTTTTCACTTTCATATCCTTAT 0: 1
1: 0
2: 2
3: 102
4: 579
Right 1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG 0: 1
1: 0
2: 0
3: 21
4: 206
1029878021_1029878024 16 Left 1029878021 7:103773903-103773925 CCTCAAGAACAGGAAATGGGTCC 0: 1
1: 0
2: 1
3: 21
4: 168
Right 1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG 0: 1
1: 0
2: 0
3: 21
4: 206
1029878017_1029878024 26 Left 1029878017 7:103773893-103773915 CCTGTGAGTTCCTCAAGAACAGG 0: 1
1: 0
2: 3
3: 28
4: 216
Right 1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG 0: 1
1: 0
2: 0
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029878024 Original CRISPR CTTATTTAGCACTGTGAGCT AGG Intronic
901112745 1:6811385-6811407 TTTATTTAACACTGTGATTTGGG + Intronic
902982665 1:20137213-20137235 ATTATTGAGCACCCTGAGCTTGG + Intergenic
903467768 1:23564199-23564221 CTTATCTAGCTATGTGACCTTGG - Intergenic
905223845 1:36466765-36466787 CTCCTCCAGCACTGTGAGCTTGG + Exonic
905528109 1:38654857-38654879 CTCATTTTGCCCTGTGAGGTAGG + Intergenic
906793681 1:48679893-48679915 GTTACTAAGCACCGTGAGCTGGG - Intronic
909547523 1:76864230-76864252 ATTTTTCAGCACTGTGACCTAGG - Intergenic
909844256 1:80371189-80371211 CTTATTTAGAACTTAGAGATGGG + Intergenic
910185995 1:84540808-84540830 CTTAGTAAGGCCTGTGAGCTAGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912566290 1:110589860-110589882 GTTATTTAGCTGTGTGACCTTGG + Intergenic
912768627 1:112440739-112440761 CTTAATTAGCTTTGTGACCTTGG + Intronic
915734826 1:158078123-158078145 CTTACTGAGCACGGTGAGTTTGG - Exonic
916229032 1:162520749-162520771 CTTATTAAGTAGAGTGAGCTGGG + Intronic
916527632 1:165626606-165626628 CTTATTTAGCTGTGTGACTTTGG - Intergenic
916811772 1:168312252-168312274 CTTAATTAGCTCTGTGGCCTTGG - Intronic
917529810 1:175824562-175824584 CTTATTTATCACTGTCAGTATGG + Intergenic
917545583 1:175963491-175963513 CTTATTTAGCTGTGTAATCTTGG + Intronic
917672749 1:177288584-177288606 CTTATTAAGCATTTTCAGCTAGG + Intergenic
921604709 1:217139389-217139411 CTTATTTAGCCCTTTGCCCTAGG - Intergenic
921742785 1:218705726-218705748 ATTCATTAGCACTGGGAGCTTGG + Intergenic
922478390 1:225922399-225922421 CTGCTCCAGCACTGTGAGCTGGG - Intronic
923585457 1:235265880-235265902 TTTATTTGGCAATGTGTGCTGGG - Intronic
1064068463 10:12204146-12204168 TTAATTAATCACTGTGAGCTGGG + Intronic
1066479168 10:35778881-35778903 CTTATTTAGCTGTGTGAGGTTGG + Intergenic
1067216328 10:44307308-44307330 TTTATTTAGAACTGTGGGATAGG + Intergenic
1069315744 10:67098885-67098907 TTTATTTAGAACTGTGAGACCGG + Exonic
1069324986 10:67222353-67222375 TGTCATTAGCACTGTGAGCTAGG + Intronic
1069664204 10:70144203-70144225 CTTAGTGAGCACTGTGGGCCAGG + Intronic
1069846019 10:71372220-71372242 CTTATTGAGCACTATGAACCGGG + Intergenic
1070399208 10:76038173-76038195 CATATTTAGCGGTGTGACCTTGG + Intronic
1073068445 10:100778424-100778446 CATATCCAGCACTGTGAGCTAGG + Intronic
1073431631 10:103491104-103491126 CTTCTTTAACCCTCTGAGCTGGG + Intergenic
1074293011 10:112155142-112155164 ATTAATTAGCAGTGTGACCTGGG + Intronic
1074483147 10:113846254-113846276 CATTTTTAGCTCTGTGACCTGGG + Intronic
1075687461 10:124374447-124374469 CTCATTTAGTGCTGTGGGCTAGG + Intergenic
1077605479 11:3608008-3608030 CTTATTTGGCAGTGTGACCTGGG - Intergenic
1078618654 11:12888091-12888113 TTTATTGAGCTCTGTGAGGTAGG + Intronic
1079170319 11:18087949-18087971 CTAATGTAGCACTATGGGCTAGG + Intronic
1079788542 11:24706929-24706951 TTTCTATAGCACTGTGATCTGGG + Intronic
1080447074 11:32347074-32347096 ATTATCCAGCTCTGTGAGCTGGG + Intergenic
1080667088 11:34345436-34345458 TTTATTGAGGACTGTGTGCTGGG - Intronic
1081946590 11:47000812-47000834 GTTAATAAGCACTGTGTGCTAGG + Intronic
1082079674 11:48002509-48002531 CTTATTGAGCACTTTGTGCTAGG + Intronic
1082856570 11:57812996-57813018 TTTATTTGCCACTGTGAGCCTGG + Intronic
1083186969 11:61023255-61023277 ATTATTTAGCTGTGTGACCTTGG - Intergenic
1083204082 11:61137532-61137554 CATATTAAGCACTGTGAGCATGG - Intronic
1084417212 11:69039822-69039844 CTTTATTAGCAATGTGAGCATGG - Intergenic
1085396125 11:76208039-76208061 CTTATCTGGCTCTGTGAGCTTGG + Intronic
1085405245 11:76257644-76257666 CTTATTTAGCACTGAGGGAGAGG - Intergenic
1086239469 11:84671973-84671995 AGTATCTAGCTCTGTGAGCTTGG + Intronic
1088338471 11:108735771-108735793 TTTATTGAACACTGAGAGCTAGG + Intronic
1088500653 11:110479157-110479179 CTTACATAGCAAAGTGAGCTCGG - Intergenic
1089339214 11:117746249-117746271 CTTATATAGCACTATGTGCCAGG - Intronic
1091196282 11:133733367-133733389 CTTCTGTAGAACAGTGAGCTAGG - Intergenic
1093698357 12:22189075-22189097 ATTATTTAGCACTGTCCCCTTGG + Intronic
1094768023 12:33619817-33619839 CTTTTTTAGCAGTGTGAGAATGG + Intergenic
1096459278 12:51813423-51813445 CTTATTGCGCACTGTGTGCCAGG - Intergenic
1096769368 12:53924600-53924622 CCTACTTACCACTGTGAGCCAGG - Intergenic
1097463722 12:59896262-59896284 GTTTTCTAGCTCTGTGAGCTTGG + Intergenic
1097888300 12:64752115-64752137 CTTTTCTAGCAGTGTGACCTTGG - Intronic
1098572443 12:72003852-72003874 GTTATTTAGAACTGTATGCTAGG + Intronic
1099155136 12:79165661-79165683 CTTATTTAGCAATGGGAGTCAGG - Intronic
1099612995 12:84898914-84898936 CTGAATTAGCAGTGTGAACTAGG + Intronic
1099624484 12:85051484-85051506 CTTATTAAGCATTTTGAGCTAGG - Intronic
1101225572 12:102684875-102684897 TTTATTCAGCACTGGGTGCTAGG - Intergenic
1101547337 12:105728197-105728219 CTTATTAAGCAGTGTGAAGTGGG - Intergenic
1101831597 12:108262139-108262161 TTTATTTATCACAGTGAGATTGG + Intergenic
1106605547 13:31225293-31225315 CTTATTTAGCTCTGTGGACTGGG + Intronic
1107804146 13:44138572-44138594 ATTGTTTAGGTCTGTGAGCTGGG - Intergenic
1110849738 13:80231664-80231686 TTTATTGAGCACTATGTGCTAGG + Intergenic
1110957525 13:81574240-81574262 AGTATTTAGTACTGTGTGCTAGG - Intergenic
1114680314 14:24478872-24478894 CTTTATTAGCAGTGTGAGATTGG - Intergenic
1116382372 14:44286397-44286419 CTTAATTAACACTGTGCCCTTGG - Intergenic
1118858904 14:69646467-69646489 CCTATAGAGCACTCTGAGCTTGG - Intronic
1122861176 14:104582985-104583007 CTTCTTTGGCTCTGTGACCTCGG - Intronic
1125806954 15:42501759-42501781 TTTATTGAGCACTGTGTGCCAGG + Intronic
1127451017 15:59116505-59116527 GTAATTGAGCACTGTGTGCTAGG - Intronic
1127470836 15:59288533-59288555 CTCATCTGGTACTGTGAGCTTGG - Intronic
1130559353 15:84946371-84946393 CTTATGTGGCACTGTGTGCCAGG + Intergenic
1133648838 16:7790294-7790316 ATTTATTAGCAGTGTGAGCTTGG + Intergenic
1133773546 16:8881606-8881628 CTTATTCAGCTTTATGAGCTTGG - Intergenic
1133846725 16:9461284-9461306 CTTAGTTAGCTATGTGATCTGGG - Intergenic
1134037375 16:11041274-11041296 CTTACTTACCACTGTGAACGAGG - Intronic
1138962825 16:62047707-62047729 ATTATTAAGCAATGTGACCTTGG - Intergenic
1139058399 16:63217363-63217385 CTGAGTTAGCACTGGCAGCTTGG - Intergenic
1139693933 16:68659169-68659191 CTTACTTAGCTGTGTGATCTTGG - Intronic
1140422849 16:74834989-74835011 CTTAATTATCAGTGTCAGCTGGG - Intergenic
1150251682 17:63708558-63708580 CTTATTTAGCTCTGTCATCCAGG + Intronic
1153842503 18:9019642-9019664 CTTATTTAGTCTTGTGAACTTGG - Intergenic
1153852443 18:9108420-9108442 TTTATTTAGCTGTGTGAGCTAGG + Intronic
1155834545 18:30563639-30563661 CTAATTTATCTGTGTGAGCTTGG + Intergenic
1156840661 18:41606456-41606478 CTTTATTAGCACTATGAGATCGG - Intergenic
1158014142 18:52764475-52764497 CTCATTTATCACTGTGAGGATGG - Intronic
1158331981 18:56372751-56372773 CTTACTGAGCACTATGAGCCAGG + Intergenic
1159229989 18:65593964-65593986 CTTATTTATCACTTTTAGTTTGG + Intergenic
1159870645 18:73756880-73756902 CTTACCTTGCACTGGGAGCTCGG - Intergenic
1161075795 19:2285060-2285082 CTTATTGAGCCATGGGAGCTGGG + Intronic
1164430864 19:28187654-28187676 ATTAATAAGCACTGTGACCTGGG + Intergenic
926189197 2:10715051-10715073 TCTATTCAGCACTGTGAACTTGG + Intergenic
927291990 2:21413555-21413577 CTTGTTTTACACTGTGTGCTAGG - Intergenic
930767610 2:55100247-55100269 CTTACTTTGCACTGGGGGCTTGG + Intronic
933187453 2:79293860-79293882 CTTTATTAGCAATGTGACCTCGG + Intronic
935925202 2:108060722-108060744 CTTAATTTGCAGTGTGACCTTGG + Intergenic
938251121 2:129816633-129816655 CTTATTTAACCATGTGAGTTAGG + Intergenic
939142324 2:138369737-138369759 CTTATCTAGCATTGTGACCTAGG - Intergenic
940546248 2:155090244-155090266 CTAATTTAGACATGTGAGCTTGG + Intergenic
942386412 2:175447969-175447991 CTTAATTAGCTCTGAGATCTTGG + Intergenic
945680467 2:212907431-212907453 ATTTTTTAGCTCTATGAGCTTGG - Intergenic
946596424 2:221310514-221310536 CTTTATTAGCACTGTGAGAACGG - Intergenic
947452069 2:230217718-230217740 CATAGTTAGCACTGTAAGCCTGG - Intronic
948303341 2:236926169-236926191 CTTTTTTAGCAATGTAACCTGGG - Intergenic
1169006426 20:2210885-2210907 CTTTTTTAGCACTGTCATCATGG + Intergenic
1175743586 20:61437482-61437504 CTTATTTAGCAATCAGTGCTCGG - Intronic
1179580088 21:42338073-42338095 CTTAATGAGCCCTGTGCGCTCGG + Intergenic
1181541411 22:23574962-23574984 CTTACTTAAAACGGTGAGCTGGG + Exonic
1181863031 22:25834067-25834089 CTGATTTAGCAGTGTTGGCTGGG + Intronic
1183384376 22:37506489-37506511 CTTACTGAGCACTGTGTGCCGGG + Intronic
1185039289 22:48496216-48496238 CTTGTTTTGGGCTGTGAGCTTGG + Intronic
950287418 3:11755701-11755723 CCTTTGTGGCACTGTGAGCTTGG - Intergenic
951000375 3:17552560-17552582 CTTATTTAGTACTATGTCCTAGG - Intronic
955106897 3:55907072-55907094 CTGATTCACCACTGTGTGCTAGG - Intronic
955347230 3:58170103-58170125 CTTATTTAGCCATGTGACCTTGG + Intronic
956904146 3:73748395-73748417 TTTATTGAGTACTGTGAGATAGG + Intergenic
957894506 3:86403851-86403873 CTTATTGAGCACTATGTACTAGG + Intergenic
958169213 3:89917348-89917370 CTTGTTGAGCACTGTAACCTGGG + Intergenic
958616308 3:96497159-96497181 TTTAATTAGAACTATGAGCTCGG - Intergenic
960360995 3:116710951-116710973 CTTATCTAGCCATGTGACCTTGG - Intronic
962728752 3:138260021-138260043 CTTATTCAATACTGTGAGTTTGG + Intronic
965608770 3:170523085-170523107 CTTATTTAGTGCTATGTGCTCGG + Intronic
966236490 3:177707073-177707095 CTTATTTAGGATTTTGTGCTTGG + Intergenic
966320483 3:178695961-178695983 CTTTGTTAGCAGTGTGAGCATGG - Intronic
968162808 3:196440728-196440750 CTTAAATAGCAAGGTGAGCTAGG + Intergenic
968458882 4:713800-713822 CTTATTTCGCAGTGTGAGCCTGG + Intronic
970492441 4:16588229-16588251 CAGATTTAGCACTGTGATCAGGG + Intronic
970601040 4:17641295-17641317 CTTAATTAGCTGTGTGAGGTTGG - Intronic
971546183 4:27890320-27890342 CTTAATTAGCAGTGTGAGAATGG + Intergenic
972359256 4:38312161-38312183 CTTTATTAGCTTTGTGAGCTTGG + Intergenic
974932073 4:68371100-68371122 GTTATTTACCTCTCTGAGCTGGG - Intergenic
975640697 4:76497103-76497125 CCTATTTAGCTGTGTGATCTTGG + Intronic
976413812 4:84747968-84747990 CTTTATTAGTAGTGTGAGCTTGG + Intronic
976590164 4:86841962-86841984 TTTATTGAGCACTATGTGCTAGG + Intronic
977857673 4:101913584-101913606 CTTATCTAGGGCTGTGGGCTAGG - Intronic
978165433 4:105601544-105601566 CTCATTTCCCACTGGGAGCTTGG + Intronic
978308982 4:107364611-107364633 CTTTTTTAGCAGTGTGAGAATGG + Intergenic
978389651 4:108212058-108212080 TTTATTGAGCACTGTCAGCAAGG + Intergenic
978403560 4:108356189-108356211 CCCATCTGGCACTGTGAGCTGGG + Intergenic
981242279 4:142492265-142492287 CTTAATGAGCAGTGTGAGATTGG + Intronic
981366283 4:143907411-143907433 CTTATTTACCAATGAGTGCTTGG + Intergenic
984356985 4:178673741-178673763 CTTATTGAGCACATTGAGCCTGG + Intergenic
985588088 5:751232-751254 CTTCTTCAGCACTGTGGCCTCGG - Exonic
985602758 5:843699-843721 CTTCTTCAGCACTGTGGCCTCGG - Exonic
986289617 5:6389199-6389221 GTTATTTTTCAGTGTGAGCTAGG - Intergenic
988541180 5:32111571-32111593 TTTATTGAGCTCTGTGAGGTAGG - Intergenic
989782875 5:45290279-45290301 CTTAATTAGCAATGTGAGAATGG + Intronic
990025047 5:51177773-51177795 CCTTGTTAGCAATGTGAGCTTGG - Intergenic
990650934 5:57898648-57898670 CTTATTTAGGCCTGTGAGTAAGG - Intergenic
992007752 5:72495155-72495177 ATTCTTTACCACTGTGAACTGGG - Intronic
992400857 5:76410002-76410024 CTTGTTTAGCACTATGTGCCAGG - Intronic
992576067 5:78114093-78114115 TTCCTTTAGCACTGTGAGCTTGG + Intronic
992610002 5:78499309-78499331 CTTGTTGAGCACTCTGTGCTAGG + Intronic
992672822 5:79076613-79076635 CTTACTTAGCTCTGTGATCTTGG + Intronic
992885061 5:81150261-81150283 TTTATTTAGCTGTGTGACCTGGG + Intronic
995223445 5:109677103-109677125 CTTGTTTAGCTCTGGCAGCTTGG - Intergenic
997236987 5:132278355-132278377 CTCATGTGGCCCTGTGAGCTGGG - Intronic
998798967 5:145848824-145848846 CTTCTTCAGCTCTGTGAGCAAGG + Intergenic
999451464 5:151681375-151681397 CTGAATTCGCACAGTGAGCTGGG - Intronic
999600460 5:153257352-153257374 CTAATTTAGTACTGTGGGGTGGG - Intergenic
1000199657 5:158995622-158995644 TTTGTTAAGCTCTGTGAGCTTGG + Intronic
1000350819 5:160351043-160351065 AATATTTAGCACTGTGGGCCAGG - Intronic
1006673726 6:35746964-35746986 CGTATTTAACACTGTGAGTCTGG + Intronic
1007725251 6:43912132-43912154 TTCATTTAGTCCTGTGAGCTGGG + Intergenic
1008743539 6:54640536-54640558 CTTAATTAGCAATGTGAGTGTGG - Intergenic
1009508606 6:64518952-64518974 CTTTTTTAGCAGTGTGAGAACGG + Intronic
1009991905 6:70853930-70853952 CTTATTTAGCACTGTCACTGGGG + Intronic
1012569767 6:100709451-100709473 CTTAACTAGCTCTGTGACCTTGG + Intronic
1012846652 6:104397733-104397755 TGCAATTAGCACTGTGAGCTTGG - Intergenic
1013330548 6:109095572-109095594 CTTGGTAAGCACTGTAAGCTGGG + Exonic
1013449576 6:110266442-110266464 CTTATTTAGCACTGCCAAATTGG + Intronic
1013506533 6:110806042-110806064 GTTAATTATCACTGTCAGCTGGG + Intronic
1018593042 6:165448617-165448639 GGTATTTGGCACTGTGAGCTGGG - Intronic
1022817684 7:33929112-33929134 CAGAGTTTGCACTGTGAGCTGGG + Intronic
1023111505 7:36817007-36817029 CTTTTTTAGTACTGTAAGGTTGG - Intergenic
1023326714 7:39068920-39068942 CTTATTTAGCAGTTTGAGGAAGG + Intronic
1025156985 7:56615871-56615893 CATTTTTATCCCTGTGAGCTGGG + Intergenic
1025620651 7:63167111-63167133 CTTATTTAGAAATATGGGCTGGG - Intergenic
1025639108 7:63350600-63350622 CAGACTTAGCACTGTGAACTGGG + Intergenic
1025643591 7:63397492-63397514 CAGACTTAGCACTGTGAACTGGG - Intergenic
1025713178 7:63930524-63930546 CAGACTTAGCACTGTGAACTGGG - Intergenic
1026443198 7:70461400-70461422 ATTATGTACCACTGTGAGCTTGG + Intronic
1026502614 7:70955922-70955944 TCTCTTTAGCACAGTGAGCTTGG - Intergenic
1028639313 7:93025522-93025544 CTTATGTGGCACTGTGTGATAGG + Intergenic
1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG + Intronic
1029931863 7:104380239-104380261 TTTATTAAGTACTGTGTGCTGGG - Intronic
1030834130 7:114262396-114262418 TTTATTTAGTACTGTCACCTAGG - Intronic
1031175315 7:118341301-118341323 CTTTATTAGCAGTGTGAGCATGG + Intergenic
1032008616 7:128325675-128325697 CTTATTTAGCACTTTGTGTTAGG - Intronic
1034314285 7:150115720-150115742 CTCAGTCAGCACTGTGAGCAGGG + Intergenic
1034522345 7:151630567-151630589 CTTATTTAGCTGTGTGACCTTGG - Intronic
1036719819 8:11163825-11163847 TTCATTTAGCCCTGTGACCTAGG - Intronic
1038239671 8:25797070-25797092 CTTACTTGACACTATGAGCTTGG - Intergenic
1038479771 8:27893763-27893785 CTTATTTTACACTGTGTGCTTGG + Intronic
1038569316 8:28646730-28646752 GCTATTTAACTCTGTGAGCTTGG + Intronic
1038820066 8:30943965-30943987 CTTTTTTAGCAATGTGAGAATGG - Intergenic
1039089103 8:33809579-33809601 TTTAACTAGCACTGTGACCTTGG - Intergenic
1042070918 8:64932256-64932278 CTGATTTTGAACAGTGAGCTTGG + Intergenic
1045822162 8:106351933-106351955 CTTATTGGTAACTGTGAGCTTGG - Intronic
1046670838 8:117054422-117054444 CTGATTTAACCCTGTGAGGTTGG + Intronic
1048158563 8:131989390-131989412 TTTATTATGCACTGTGTGCTAGG + Intronic
1053103636 9:35392045-35392067 CCTATGTAGCACTGTGAATTTGG + Intronic
1059005818 9:110400867-110400889 ATTATTTATCAGTGTGAGCCTGG - Exonic
1059101102 9:111472370-111472392 GTTATTTAGCACTGTGCACAAGG - Intronic
1059541831 9:115137907-115137929 CTTAATTAGCTATGTGAGCTTGG + Intergenic
1059910142 9:119034299-119034321 CTATTCTAGCACTGTGATCTGGG - Intergenic
1185512323 X:672926-672948 ATTATTTAGGACTATGAGATGGG + Intergenic
1187606698 X:20892385-20892407 CTTTTCTAACACTGTGTGCTAGG + Intergenic
1188297475 X:28467413-28467435 ATTATCTAGCTCTGTGACCTTGG - Intergenic
1188870315 X:35364115-35364137 CTTGTTCTGCACTGTGATCTGGG - Intergenic
1191679892 X:63830254-63830276 CTTCGTTAGCACTGTGAGAAAGG + Intergenic
1192549221 X:72040675-72040697 CTCATTTGGCACTGAGTGCTTGG - Intergenic
1196912617 X:120499469-120499491 TTCACTTAGCACTGTGAACTTGG - Intergenic
1196931117 X:120683051-120683073 CTTATTGAACACTTTGTGCTAGG + Intergenic
1197558039 X:127981366-127981388 AGTATTTAGTACTGTGTGCTAGG - Intergenic
1198178459 X:134180396-134180418 ATTATTTGGTACTGTGATCTGGG - Intergenic
1198671392 X:139084507-139084529 CCTGTTTAGCTCTGTGATCTGGG + Intronic
1199135988 X:144253609-144253631 CTTTTTTTGGACTGTGAGCCTGG - Intergenic
1199463787 X:148113316-148113338 CTTATATAGCACTATGTGCCAGG + Intergenic
1200902396 Y:8445950-8445972 CATTATTAGCCCTGTGAGCTGGG + Intergenic