ID: 1029879567

View in Genome Browser
Species Human (GRCh38)
Location 7:103793475-103793497
Sequence GAGAAGAGTCAGTCTAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029879567_1029879569 24 Left 1029879567 7:103793475-103793497 CCATAATTAGACTGACTCTTCTC 0: 1
1: 0
2: 0
3: 10
4: 195
Right 1029879569 7:103793522-103793544 TGCCATGTTGCTAAGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029879567 Original CRISPR GAGAAGAGTCAGTCTAATTA TGG (reversed) Intronic
900849321 1:5130103-5130125 CATAAGAGTTAGGCTAATTAGGG + Intergenic
903108982 1:21112059-21112081 GAGAAGAGTCTTGCTAATAAAGG - Intronic
906368733 1:45234223-45234245 CAGAAGACTCAGTCTTGTTAAGG + Intronic
907978279 1:59455119-59455141 GAGAAGAGTAAGGCTGATTCTGG + Intronic
909913833 1:81293416-81293438 GAGAAGTGCCAGTCCAAGTAGGG + Intergenic
910409620 1:86926417-86926439 GAGAGAACTCAGTCTAATTCAGG - Intronic
910514911 1:88049489-88049511 TAGTAGAGTCAGATTAATTAGGG - Intergenic
918092823 1:181312085-181312107 GAAAAGTCTCAGGCTAATTAAGG - Intergenic
919790316 1:201286277-201286299 GAGCAGAGTCAGTTTACCTAGGG + Intronic
920847703 1:209607557-209607579 GAGAATACTCAGTGTAATCAGGG + Intronic
921797485 1:219363652-219363674 GACAAGGATCAGTCTATTTAGGG - Intergenic
923420996 1:233814858-233814880 GATAATAGTCATTCTAATTGGGG - Intergenic
1063876753 10:10486858-10486880 GAGAAGACTCAGTCCACTAAAGG + Intergenic
1065007661 10:21394511-21394533 GAAAAGTGTCAGCCTCATTAAGG + Intergenic
1066654833 10:37687690-37687712 CAGAAGAGTCAGTCTGAGAAGGG + Intergenic
1067206565 10:44220827-44220849 GATAATAGCCATTCTAATTAGGG - Intergenic
1071432666 10:85618596-85618618 GAAAAGAGTAGGGCTAATTAAGG - Intronic
1072780485 10:98247882-98247904 GGGAACAGTCAGTTTAGTTAAGG - Exonic
1077908486 11:6553879-6553901 CAGAAGAGTCAGTATCATTAAGG + Intronic
1078288040 11:9977887-9977909 GAGAAGAGACAGGAAAATTAAGG + Intronic
1078404869 11:11061725-11061747 GAAAAAATTCATTCTAATTATGG + Intergenic
1078460661 11:11512861-11512883 GAGAGGAGTTAGTGTCATTATGG - Intronic
1078740519 11:14062141-14062163 AATAAGTGTCAGTCAAATTAAGG - Intronic
1082674004 11:56072876-56072898 CAGAAGAGTCATTCTAGGTAGGG + Intergenic
1082727846 11:56758420-56758442 GAAAATATTCAGTCTAATAAAGG - Intergenic
1085499657 11:77008133-77008155 GAGAAGAAGCAGACTAACTAGGG - Intronic
1085992096 11:81861354-81861376 GAAAATAGCCATTCTAATTAGGG - Intergenic
1086507000 11:87515597-87515619 GAGAAGAGTGAGGCTAAGAAGGG + Intergenic
1088835664 11:113576279-113576301 GAGAAGAGTCAGGCTTATGCTGG - Intergenic
1091228686 11:133973833-133973855 GAGAAGAGACAGTGGAATTCAGG - Intergenic
1096036133 12:48472737-48472759 GACAACAGTCAGTCAAATGAAGG + Exonic
1098781782 12:74696255-74696277 GAGAAGAGTAAAACTTATTAAGG - Intergenic
1103569128 12:121832629-121832651 AAGAAAAGTCAGTATATTTATGG - Intergenic
1105523197 13:21150441-21150463 GGGAGGAGTCAGTGAAATTAGGG + Intergenic
1106806583 13:33314178-33314200 GATAAGAGCAAATCTAATTATGG + Intronic
1107064987 13:36203665-36203687 AAGAATAATCAGTCTTATTAAGG - Intronic
1107172533 13:37359533-37359555 GGGAAGGGTCAGTTTAATTGTGG - Intergenic
1108182934 13:47858984-47859006 GAGAAGTGGCAGTTTAACTAGGG - Intergenic
1109892229 13:68630436-68630458 GAGAAGAGTCAAATTTATTAGGG - Intergenic
1111163515 13:84426562-84426584 TAGAACAGTCATTCTAATTAGGG - Intergenic
1111967854 13:94879133-94879155 GAGAAGCGTTAGTCTGCTTACGG + Intergenic
1115910035 14:38245648-38245670 GATAACAGCCAGTCTAACTAGGG - Intergenic
1116185535 14:41596332-41596354 AAGAAGAGTCATTCTGATGAAGG + Intergenic
1116507378 14:45700999-45701021 GGGAAGAGTAAGTTTAATTTAGG - Intergenic
1116910617 14:50459669-50459691 AAGAAAAGTCAGTCTGACTAGGG - Intronic
1117069842 14:52046518-52046540 GAGGAGAGACAGTCTAGATATGG + Intronic
1128125482 15:65189274-65189296 AACAAGAGGCAGTCTAATTGAGG - Intergenic
1131978083 15:97965779-97965801 AAAAAGAGTAAGTCTATTTAGGG - Intronic
1132996316 16:2825357-2825379 GAAACGAGTCCGTCTTATTAAGG - Intronic
1135786176 16:25351258-25351280 GGGAAGAGTTAGCCTAATTTGGG - Intergenic
1140548989 16:75843210-75843232 GAGAAGACTGACTCTAATTTTGG - Intergenic
1140679601 16:77372084-77372106 GATAATAGTCATTCTAATTGGGG - Intronic
1146551446 17:33783622-33783644 CAGGAGAGCCAGTCTGATTAAGG - Intronic
1150600593 17:66647377-66647399 GTGAATATTCAGTTTAATTATGG + Intronic
1150815145 17:68386828-68386850 GAGATGAGGCAGTTTTATTATGG - Intronic
1153577270 18:6535273-6535295 GAGAAGCTTCAGCCTAATAATGG + Intronic
1154258460 18:12807244-12807266 GATAATAGTCATTCTAATTGGGG - Intronic
1154278797 18:12981709-12981731 GACAAGTGGCAGTCTATTTAGGG + Intronic
1155782377 18:29852443-29852465 GAGAAGAGGCATTCTATTGAGGG - Intergenic
1156866811 18:41898037-41898059 GAGAAGAGTCAAGGTATTTAGGG + Intergenic
1159371588 18:67533819-67533841 GATAATAGTCATTCTAACTAGGG - Intergenic
1159992063 18:74920478-74920500 CAGAAAAGTAAATCTAATTAAGG - Intronic
928310225 2:30203608-30203630 GAGAATGGTCAGTCTACTTGAGG + Intergenic
929943201 2:46350819-46350841 GAGAAGTGTCAGTTGCATTATGG + Intronic
931580440 2:63765813-63765835 TAGAAGAGTCAGTGTCATGAGGG - Intronic
932523310 2:72436971-72436993 GAGAAGAGGCATTCTGATTTTGG + Intronic
933507533 2:83197782-83197804 AAGAATAGTCAGTCTAATTCAGG - Intergenic
935001272 2:99018184-99018206 TAGAAGAGTGAGTCTATTTAAGG - Exonic
937179936 2:119985416-119985438 GAGAAGATTCTGTTTAATTGTGG + Intergenic
939620839 2:144417074-144417096 AAGAAGAGTCACTGTCATTAAGG - Intronic
940525845 2:154812214-154812236 GAGAAGAGTCAATATTATAAAGG + Intronic
945931310 2:215857471-215857493 TAGAGGAGTCAGTCCAATTTTGG + Intergenic
946224527 2:218256946-218256968 GAGAAGAGTCAATCTGGATACGG - Intergenic
947177891 2:227385787-227385809 GGGAAGTGTCAGTCTAGCTATGG + Intergenic
1169136196 20:3199281-3199303 GAGAAGAGCCAGGATATTTAAGG + Intronic
1169180939 20:3566321-3566343 GAGAAGTCTCAGTCAAATAAGGG + Intronic
1170145744 20:13172686-13172708 CAGAAAAGTCTGTCTAATAAAGG + Intergenic
1170160483 20:13305133-13305155 AAGAAGAGTCAATCTCATTCTGG + Intergenic
1170787656 20:19481619-19481641 GAGCAGAGTGAGTCTGATTTGGG + Intronic
1171330834 20:24337606-24337628 GAAAAGAGTCAGTGTCATTGTGG - Intergenic
1173829040 20:46067000-46067022 GAGAAGAGTCAGAGAAATTCAGG - Intronic
1174048665 20:47751956-47751978 GACAAGTGTCACTCAAATTATGG + Intronic
1184300715 22:43557722-43557744 AATAAAAGTCAGTCTAGTTATGG + Intronic
1184672827 22:46024441-46024463 GTGAAGAGTTGGTCTAATTTTGG - Intergenic
949383634 3:3473905-3473927 GTGAAGAGTCATCCTGATTAAGG + Intergenic
949445978 3:4133964-4133986 GAGAAGAGTCATTGGAATTTAGG - Intronic
949484921 3:4528698-4528720 CAGAAAAATCAGTCTATTTAAGG + Intronic
949898858 3:8793245-8793267 GGGAAGAGACAGGCTAATTCTGG + Intronic
950932813 3:16808031-16808053 AAGAAGTGTCAGTCTCATTGTGG - Intronic
953353807 3:42237114-42237136 GATAAAAGTCATTTTAATTAGGG - Intergenic
958422044 3:93940563-93940585 AAGATGTGTCAGTCTAATAAGGG - Intronic
959693543 3:109224772-109224794 GAGAAGAGACAATCTAACTTTGG - Intergenic
960330390 3:116352509-116352531 GAGAAAACTGAGTCTAATGATGG + Intronic
962121428 3:132564836-132564858 GAGAAAAGGCAGACTATTTAGGG + Intronic
962615193 3:137118896-137118918 GAAAAGAGGAAGTCAAATTATGG + Intergenic
964140176 3:153388959-153388981 GAGCAGAAACAGTATAATTATGG - Intergenic
964997499 3:162902618-162902640 GATAATAGTCATTTTAATTAGGG + Intergenic
966138211 3:176725345-176725367 CAGAAAACTCAGTCTAATGATGG + Intergenic
967896952 3:194403701-194403723 GAGAAGACTCAGTCTATCTATGG + Exonic
968346327 3:198012514-198012536 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346343 3:198012625-198012647 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346370 3:198012810-198012832 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346408 3:198013069-198013091 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346415 3:198013106-198013128 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346423 3:198013143-198013165 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346446 3:198013291-198013313 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346462 3:198013365-198013387 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346469 3:198013402-198013424 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346476 3:198013439-198013461 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346483 3:198013476-198013498 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346508 3:198013661-198013683 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346515 3:198013698-198013720 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346521 3:198013735-198013757 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346528 3:198013772-198013794 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346551 3:198013920-198013942 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346559 3:198013957-198013979 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346566 3:198013994-198014016 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346599 3:198014253-198014275 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346605 3:198014290-198014312 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346612 3:198014327-198014349 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346624 3:198014401-198014423 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346631 3:198014438-198014460 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346638 3:198014475-198014497 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346645 3:198014512-198014534 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346657 3:198014586-198014608 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346664 3:198014623-198014645 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346675 3:198014698-198014720 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346680 3:198014735-198014757 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346687 3:198014772-198014794 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346698 3:198014846-198014868 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346713 3:198014920-198014942 GAGAGAAGTCAGACTACTTAGGG - Intronic
968346720 3:198014957-198014979 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346731 3:198015031-198015053 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346761 3:198015253-198015275 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346768 3:198015290-198015312 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346775 3:198015327-198015349 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346782 3:198015364-198015386 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346789 3:198015401-198015423 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346795 3:198015438-198015460 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346801 3:198015475-198015497 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346814 3:198015549-198015571 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346821 3:198015586-198015608 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346828 3:198015623-198015645 GAGAGAAGTCAGACTAGTTAGGG - Intronic
968346848 3:198015734-198015756 GAGAGAAGTCAGACTAGTTAGGG - Intronic
970316648 4:14834475-14834497 GAGAAGAGTCAGTATCTTCAAGG - Intergenic
976097486 4:81524717-81524739 GAGAAGAGGCAGTGTCATGAAGG + Intronic
977615126 4:99079996-99080018 AAGAAAAGTCAGTATATTTATGG + Intronic
978663949 4:111161012-111161034 GATAATAGTCATTCTAATTGGGG - Intergenic
979130167 4:117034458-117034480 GATAAGAGTTAGTATAATAATGG - Intergenic
979555794 4:122045836-122045858 GAGATGAGACAGTTAAATTATGG + Intergenic
979713305 4:123806685-123806707 GAAAAGATTCAGGATAATTAAGG - Intergenic
980558629 4:134442211-134442233 GAGAAGAGGCACTCTAGTTTTGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
985192709 4:187393611-187393633 GAGAAAAGTCAGTCTAAATCTGG - Intergenic
987177556 5:15331067-15331089 GAGAAGATTCATTCTTATGATGG + Intergenic
989391710 5:40907366-40907388 AAAAAGAGTTAGTCCAATTAAGG - Intergenic
989756138 5:44957265-44957287 GATAACAGTCATTCTAATTGGGG + Intergenic
990799735 5:59587141-59587163 GAGAACAGCCAGCCTTATTATGG - Intronic
992834160 5:80623748-80623770 AAAAAGAGGCAGTCTAATTCAGG + Intergenic
993620082 5:90157742-90157764 GAGAAGAGGTAGTTAAATTATGG + Intergenic
995081433 5:108054864-108054886 GAGAAGAGGCAGACTAACTAGGG - Intronic
999495739 5:152095136-152095158 GCGAAGAGGCAGTGTAATTCTGG + Intergenic
1000986171 5:167862961-167862983 GAGAAGAGTAATTTTAACTAGGG - Intronic
1001956016 5:175848608-175848630 GAGAAAAGTCATTCTAGTTGAGG + Intronic
1003547972 6:7076729-7076751 GACAAGATTCAGACTCATTAGGG - Intergenic
1004899362 6:20180211-20180233 GAGAAGAGCCAGGCTAGTAATGG - Intronic
1008221829 6:48863716-48863738 GAGAAGAGGAAGTCTATTGAGGG - Intergenic
1010654543 6:78496645-78496667 GACAAGAGTGAGTCTAAGTAGGG - Intergenic
1013722519 6:113048098-113048120 GGAAAGAGTTAGGCTAATTAAGG + Intergenic
1014697271 6:124639043-124639065 GATAATAGTCATTCTAACTAGGG - Intronic
1015195104 6:130517052-130517074 GAGAACAGTTAGTGAAATTATGG - Intergenic
1015997654 6:139011016-139011038 GAGAAGAGAGAGTTTAATAAGGG + Intergenic
1021967030 7:25929915-25929937 GAAAAGAGTCAGTATTATTATGG + Intergenic
1022998306 7:35781755-35781777 GAGAGGAGACAGTCTCCTTATGG + Intergenic
1023177849 7:37450700-37450722 AAGAAGAGTCAGAATAATTGAGG - Intergenic
1023490992 7:40741692-40741714 AAGCAGAGTCAGTTAAATTATGG + Intronic
1026653824 7:72239003-72239025 GTGAAGAGTCAGGCTGTTTAAGG - Intronic
1029879567 7:103793475-103793497 GAGAAGAGTCAGTCTAATTATGG - Intronic
1032161370 7:129513497-129513519 GAGAAGAGTCAGGTGAAATATGG - Intergenic
1032398044 7:131604854-131604876 GAGAAGAGACAGTCAAAGGATGG + Intergenic
1037297439 8:17415798-17415820 GATCATAGTCAGTCTAATTGGGG - Intergenic
1037330018 8:17735214-17735236 GAGAATAGTGAGTTTAATTCGGG - Intronic
1038158101 8:25009988-25010010 GAGATGAGTCATTGTAATTTGGG - Intergenic
1039177837 8:34829370-34829392 CAGAAGAGTCATTCTAGGTATGG - Intergenic
1040081242 8:43288494-43288516 GAGAGTTGTCAGGCTAATTATGG + Intergenic
1040997596 8:53417827-53417849 GAGAAGAGGAAGTCTATTGATGG - Intergenic
1041529807 8:58852503-58852525 TACAAGAGTGAGTCTCATTAAGG - Intronic
1041617830 8:59929020-59929042 GAAAAGAGTCAGCCTACATAGGG - Intergenic
1042929988 8:74003794-74003816 GAGATGAGTCAGCCTAATACAGG + Intronic
1043621200 8:82194451-82194473 GAGCAGATTCAGTGGAATTATGG + Intergenic
1047240281 8:123081180-123081202 AAGAAGAGTCAGTAAAATAAGGG - Intronic
1048118624 8:131554288-131554310 GAGAAGAGTGAGTATGATTTGGG + Intergenic
1052701567 9:31943553-31943575 AAATAGAGTCAGTCTAATTTGGG - Intergenic
1052727475 9:32246430-32246452 GAGAGGAGTTAGTTTAATGAAGG - Intergenic
1053234660 9:36442193-36442215 GAGAACATTCAGTCAGATTACGG - Intronic
1057376164 9:94525213-94525235 GAGAGAAGTCAGGCTAGTTAGGG - Intergenic
1058908913 9:109503289-109503311 GAGAAGCGTTAGTCAAATTCAGG + Intergenic
1059890091 9:118792209-118792231 AAGAAGAGACAGTATAATTATGG + Intergenic
1190464148 X:50708998-50709020 GAGAAGAGCCACTCTAAAGAAGG - Intronic
1191080974 X:56509007-56509029 GAGAAGAGTCATTCTGGTTTTGG - Intergenic
1193138225 X:77997039-77997061 GACCAGAGACAGGCTAATTAAGG + Intronic
1193486094 X:82086788-82086810 GGGAAGAGACAATCTAATTTTGG - Intergenic
1193906881 X:87254620-87254642 GAGAAGAGGCATTCTAGTTTTGG - Intergenic
1196921206 X:120586907-120586929 GAGAAGAGTCAGAGAAAGTAGGG + Intergenic
1196989424 X:121311753-121311775 GAGAAGAATGACTCTAATGATGG - Intergenic
1201264893 Y:12196563-12196585 GAGACAAGTCAGCCTAATAAGGG - Intergenic