ID: 1029881129

View in Genome Browser
Species Human (GRCh38)
Location 7:103811213-103811235
Sequence GCTTCTATTGCCCCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029881129_1029881132 21 Left 1029881129 7:103811213-103811235 CCTGCTTGTGGGGCAATAGAAGC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1029881132 7:103811257-103811279 AATTGCCTGTATCTGAAAAATGG 0: 1
1: 0
2: 0
3: 27
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029881129 Original CRISPR GCTTCTATTGCCCCACAAGC AGG (reversed) Intronic
902393164 1:16117964-16117986 CCTACTACTGCCCCATAAGCTGG - Intergenic
903125641 1:21245569-21245591 GCTCCTACTGCCCCACCTGCAGG + Intronic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
908645969 1:66278278-66278300 GTTTCTCTGGCCCCATAAGCAGG - Intronic
913995948 1:143652107-143652129 TCTGCGATTTCCCCACAAGCGGG - Intergenic
916337802 1:163692829-163692851 GCTTGTATTGCTCCGCCAGCTGG + Intergenic
1065467979 10:26045698-26045720 GCTCCTTTTGCTCCCCAAGCAGG + Intronic
1070444569 10:76483571-76483593 GCCCCTATTGCCCCAGAACCAGG - Intronic
1075216710 10:120542826-120542848 CCATCTTTTGCCCCACAATCAGG - Intronic
1076211215 10:128646502-128646524 GCTCCAATTGTCCCACTAGCAGG - Intergenic
1084889736 11:72230780-72230802 GCTGCTGTTCCCCCAGAAGCGGG + Exonic
1108637264 13:52347901-52347923 GCTTCTAACACCCAACAAGCTGG - Intergenic
1118120989 14:62842615-62842637 GCGTCTCTTGCTCAACAAGCAGG + Intronic
1122296128 14:100706614-100706636 GCTGCTGTTGCCCCCAAAGCTGG - Intergenic
1127347853 15:58118914-58118936 ACTTCCATTCCCCCACTAGCAGG - Intronic
1128053449 15:64682843-64682865 GCTTATATTGGCCCACATGGAGG - Exonic
1129127722 15:73458885-73458907 GGTTCTATTACCCCATAAGAAGG + Intronic
1137726282 16:50658892-50658914 GCTCCTGTTGCTCCACATGCTGG - Intergenic
1148961723 17:51398934-51398956 CCTTCTATGGCCCCAGCAGCTGG + Intergenic
1149990497 17:61380618-61380640 GCTTCTTTTGTCCCTCAAGAGGG + Intronic
1154365426 18:13703539-13703561 GTTTCTAGTGCCTAACAAGCAGG - Intronic
1156844213 18:41645259-41645281 TCTTCTAATGCCCCACACGGTGG - Intergenic
1158160154 18:54472602-54472624 GCTTCTATTTCCACTGAAGCAGG + Intergenic
1161526491 19:4759355-4759377 GCTTCTTATGCCCCAGAAGCAGG - Intergenic
1161895929 19:7080297-7080319 CCTTCTTTTCCCCCACAAGATGG - Intronic
1168026515 19:53647671-53647693 GTCTCCATTGCCCCCCAAGCGGG + Intergenic
929156679 2:38794570-38794592 GCTTATTTTCCCCCACATGCAGG + Intergenic
935084648 2:99833121-99833143 GCTTCTCTTGTCCCACCATCCGG + Intronic
938887712 2:135670022-135670044 GCTTCTCTTGCCCAAGGAGCTGG - Intronic
940112903 2:150173765-150173787 GCTACTGTTGCCCCAGTAGCGGG - Intergenic
941018052 2:160379187-160379209 TCCTCTATTGCCCCCCAAGCTGG - Intronic
1168748804 20:267530-267552 GCTTCTAGTGCCCCATTACCCGG - Intergenic
1171099797 20:22372277-22372299 GCTTGGATTGCCCCGAAAGCAGG - Intergenic
1173688571 20:44941378-44941400 CCTTTTATTGCCTCATAAGCAGG - Intronic
1173912454 20:46680471-46680493 GCACCTATTGCCCCAGAGGCAGG + Intronic
1177475648 21:21618285-21618307 GCTACTTTTGCCTCAGAAGCAGG - Intergenic
1177911255 21:27035431-27035453 GCTTCAAGTGTCCCACAGGCTGG - Intergenic
1179260576 21:39755081-39755103 ACTTCTAGTCCCCGACAAGCAGG - Intronic
1182298520 22:29325227-29325249 GCTACTATTTCCACACAAGAAGG + Intergenic
1182477389 22:30583539-30583561 GCTTCTAGTGCCCCGCAGGTGGG - Intronic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
962335602 3:134527547-134527569 GCTTTTCTTGCCCCACCAGCAGG - Intronic
962883453 3:139600836-139600858 GATTCTAATGCTCCAAAAGCAGG - Intronic
966830948 3:184008134-184008156 GCTTCTATTGGTGGACAAGCAGG + Intronic
981511885 4:145566554-145566576 GCTTCCTTTTCCCCACCAGCAGG + Intergenic
986451554 5:7869725-7869747 CCTGCTACTGCCCCACAATCCGG - Intronic
998870649 5:146548367-146548389 GATTCTACTGCACCACGAGCAGG - Intergenic
1007806602 6:44454855-44454877 GCTGCTCTTGCCACACAAGAAGG + Intergenic
1012978887 6:105809440-105809462 ACTTCTATTGGGCCACTAGCCGG + Intergenic
1013295831 6:108757625-108757647 GCTTCTATGGTCCCAGAAGTTGG - Intergenic
1018578068 6:165280544-165280566 GCTTTTTCTGCCCCATAAGCTGG + Intronic
1021110212 7:16685252-16685274 GATTCTCTTGCCCCAGAGGCAGG - Intronic
1021498782 7:21306471-21306493 GTTTCTCTAGCCTCACAAGCTGG + Intergenic
1022426708 7:30276205-30276227 GCATCTACTGCCCCCCAAGAGGG - Intergenic
1028083047 7:86600831-86600853 GCTTTACTTGCCCCACTAGCAGG + Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1034267437 7:149788042-149788064 GCTTCTCCTGTCCCACAAGACGG + Intergenic
1037471279 8:19213695-19213717 GTTTCTGTTTCCTCACAAGCAGG - Intergenic
1038075733 8:24071512-24071534 GCCTCAGTTGCCCTACAAGCTGG - Intergenic
1038358834 8:26857231-26857253 GCTTCAATTGCCAGGCAAGCTGG + Intronic
1039287346 8:36056447-36056469 TCTTCTTTTGCCTAACAAGCAGG - Intergenic
1040960542 8:53027439-53027461 GCTTCAATGACCCCACCAGCTGG + Intergenic
1041721170 8:60976821-60976843 GTTTCTATTGCCCCACTGGGCGG - Intergenic
1050111971 9:2226663-2226685 GCTTCTATAGCCCCAGCACCTGG - Intergenic
1051564474 9:18481571-18481593 TTTTCAATTTCCCCACAAGCTGG + Intronic
1052216225 9:25969346-25969368 GATTCTATTGCTTCACATGCTGG - Intergenic
1058312525 9:103522040-103522062 GCTTCTATTTACCTACAAACTGG - Intergenic
1062430088 9:136523064-136523086 GCTTCCATGGCCCCACCTGCCGG - Exonic
1193328366 X:80207914-80207936 GCTTCTGTTGCCCCACAAAGAGG - Intergenic
1194221442 X:91197630-91197652 TCTTCTATTGCACCTCAAACTGG + Intergenic
1198560275 X:137842408-137842430 GCTTCTATTGGCACCCAAGTTGG + Intergenic
1200557954 Y:4661383-4661405 TCTTCTATTGCACCTCAAACTGG + Intergenic
1200684243 Y:6245493-6245515 GCTTCCAGAGCCCCACCAGCAGG + Intergenic
1200958318 Y:8972842-8972864 GCTACTATGCCCCCACATGCCGG - Intergenic