ID: 1029881132

View in Genome Browser
Species Human (GRCh38)
Location 7:103811257-103811279
Sequence AATTGCCTGTATCTGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 350}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029881130_1029881132 -1 Left 1029881130 7:103811235-103811257 CCAATCTGCCTAAATAAAAATAA 0: 1
1: 0
2: 8
3: 80
4: 942
Right 1029881132 7:103811257-103811279 AATTGCCTGTATCTGAAAAATGG 0: 1
1: 0
2: 0
3: 27
4: 350
1029881131_1029881132 -9 Left 1029881131 7:103811243-103811265 CCTAAATAAAAATAAATTGCCTG 0: 1
1: 0
2: 2
3: 84
4: 831
Right 1029881132 7:103811257-103811279 AATTGCCTGTATCTGAAAAATGG 0: 1
1: 0
2: 0
3: 27
4: 350
1029881129_1029881132 21 Left 1029881129 7:103811213-103811235 CCTGCTTGTGGGGCAATAGAAGC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1029881132 7:103811257-103811279 AATTGCCTGTATCTGAAAAATGG 0: 1
1: 0
2: 0
3: 27
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029881132 Original CRISPR AATTGCCTGTATCTGAAAAA TGG Intronic
900204154 1:1424633-1424655 GATTGCCTGAACCTGGAAAATGG + Intergenic
901146426 1:7067906-7067928 AATTTCCTGGCTCTTAAAAAAGG + Intronic
901451203 1:9337982-9338004 AGCAGCCTGTCTCTGAAAAAAGG + Intronic
902252098 1:15160756-15160778 AATTGCCTGTAGCTAAACACCGG + Intronic
904016673 1:27426834-27426856 TATTTTCTTTATCTGAAAAATGG + Intronic
907167211 1:52424173-52424195 AAATACCTGTATGTGAAAAAAGG + Intronic
907880175 1:58542165-58542187 AATTGGTTGTATTTCAAAAAGGG - Intronic
908027145 1:59965116-59965138 AATTGTCATTTTCTGAAAAAGGG + Intergenic
908424351 1:63991386-63991408 AACTGCACATATCTGAAAAATGG - Intronic
909800368 1:79799128-79799150 AGTTGCCTTTATGTGAATAATGG + Intergenic
910024613 1:82634908-82634930 CATTTCCTATTTCTGAAAAATGG + Intergenic
910407279 1:86902292-86902314 AATTCCAAGTATCTCAAAAATGG - Intronic
911115661 1:94244467-94244489 AATTTCTTCTATCTGATAAAGGG + Intronic
912054073 1:105572589-105572611 AAATGACTGAATCTGAAAATAGG - Intergenic
912539698 1:110404959-110404981 AATTGCCTGAACCTGGGAAATGG + Intronic
913377569 1:118170642-118170664 TATTGTCTCTATCTGACAAAAGG + Intronic
913389964 1:118299769-118299791 ATTTTCCCTTATCTGAAAAATGG + Intergenic
913512098 1:119571453-119571475 AATGGGCTGACTCTGAAAAACGG + Intergenic
914460767 1:147882122-147882144 AACTTCCTTAATCTGAAAAATGG - Intergenic
918287830 1:183075720-183075742 AATTCCCTGTTTCTGAGAGAAGG - Intronic
919591967 1:199515230-199515252 AAATACATGTATCTGACAAAGGG + Intergenic
919684741 1:200473269-200473291 AATTGCCTGAACCTGAGAGATGG + Intergenic
920006480 1:202836996-202837018 AACTGTCTTTATCTGTAAAACGG + Intergenic
920838323 1:209532791-209532813 AATGGTTTGAATCTGAAAAAAGG + Intergenic
921024687 1:211266959-211266981 AAGGGGCTGTATCTCAAAAACGG - Intronic
921395802 1:214668139-214668161 TACTGCCTGTATCTAAAAAGTGG + Intergenic
922302309 1:224312384-224312406 AATTTCCTGTATCAAAAAAGAGG + Intronic
924027660 1:239852471-239852493 TATTGCTTGTATCTGAAATTTGG - Intronic
924133394 1:240936789-240936811 AACTTACTGTATCTGACAAAAGG - Intronic
924297344 1:242601420-242601442 AATTGCCTGTACCTGGAAGGCGG - Intergenic
924592520 1:245417091-245417113 CACTGGCTGTGTCTGAAAAATGG + Intronic
1063924840 10:10967503-10967525 AAATGCCTGTATGAGAAAATGGG + Intergenic
1064178789 10:13098006-13098028 CATTCCCTTTATCTGTAAAATGG - Intronic
1064229519 10:13517731-13517753 GAGAGCCTGTCTCTGAAAAATGG + Intronic
1064479301 10:15723249-15723271 AATTGCTTGAATCTGGAAGACGG + Intergenic
1064767548 10:18690269-18690291 AATTCATTGTATCTGAAAAATGG + Intergenic
1066321614 10:34308552-34308574 AACTGCCATTATCTGAGAAAGGG + Intronic
1067348057 10:45452334-45452356 AATTTCATTTATCTGAGAAATGG + Intergenic
1068420761 10:56789387-56789409 AATTGCTTTTATCTTCAAAAAGG + Intergenic
1068439780 10:57037165-57037187 ATTTGCACGTATCTGACAAAGGG - Intergenic
1068546360 10:58350502-58350524 TATTACATGTATCTGACAAAAGG - Intronic
1069397338 10:68004019-68004041 AATGGCTTTTATCTGAAAGAGGG - Intronic
1070701070 10:78602143-78602165 AATTATCTTTATCTGCAAAATGG - Intergenic
1070994089 10:80760484-80760506 TATATCCTGTATCTGTAAAATGG - Intergenic
1071342270 10:84659852-84659874 AATTCCATCTATCTGGAAAAGGG - Intergenic
1072136888 10:92555680-92555702 AATTTCCTCAACCTGAAAAAGGG + Intronic
1072166789 10:92821331-92821353 AATTGCCTGAACCTGAAAGGTGG + Intergenic
1073591781 10:104764811-104764833 AACTCCCTGTCTCTGAAAACTGG - Intronic
1073936419 10:108638022-108638044 GATTGTGTGTATCTGAAGAATGG - Intergenic
1074130529 10:110569326-110569348 AATTGTCTGTCTCTGAAATAAGG - Intronic
1074295234 10:112181202-112181224 AATTGTCTTTATATAAAAAATGG - Intronic
1075156211 10:119978035-119978057 AATTGCCTGTATTTAAAATCGGG - Intergenic
1076281327 10:129249109-129249131 AATTCCCTGATTCTGAAATAGGG - Intergenic
1077203665 11:1329124-1329146 AATTCCCTCAATCTGATAAAGGG + Intergenic
1077959214 11:7055563-7055585 AACTGCCATTACCTGAAAAAGGG - Intronic
1079218279 11:18535289-18535311 AAATGGTTGTCTCTGAAAAATGG + Intronic
1079494538 11:21026932-21026954 AATTGCCTGTATTTCTAAGAAGG - Intronic
1079875104 11:25846427-25846449 AAATGCCTGTATCTGAATGCTGG - Intergenic
1081407074 11:42710179-42710201 AATTGCTTGAATCTGAAAGGCGG + Intergenic
1083786286 11:64949857-64949879 ATTTGCTTTTATCTGGAAAATGG + Exonic
1084540555 11:69783671-69783693 AATTGCTTGAATCTGAAAGGCGG - Intergenic
1085559879 11:77461942-77461964 AATTGCATGTTACTGAAAAATGG - Intronic
1085587290 11:77721570-77721592 AATTTCCCTCATCTGAAAAAAGG + Intronic
1085612088 11:77959797-77959819 AATTGACTGAATCTGGTAAAAGG - Intronic
1085831456 11:79905677-79905699 AATAGGCTGTGTATGAAAAAAGG - Intergenic
1086104123 11:83130640-83130662 AATTGTATTTATCTGATAAAAGG - Intergenic
1086926077 11:92642082-92642104 AAATGCATGTATCTGAAAAGGGG + Intronic
1090140073 11:124248253-124248275 AAATACATATATCTGAAAAAGGG - Intergenic
1091538917 12:1441143-1441165 AATTGCTTGAACCTGAAAAGGGG - Intronic
1093461947 12:19414834-19414856 AATTGCTTGAATCTGGAAAGTGG + Intronic
1093791744 12:23259410-23259432 AAATGCATTTATCTGTAAAATGG + Intergenic
1094332565 12:29311207-29311229 AAATGCCTATATTTGGAAAATGG - Intronic
1095535948 12:43247676-43247698 AATGGCCTGGATCTCAAAATTGG + Intergenic
1098420870 12:70296166-70296188 GATGGCCTATATCTGAAAGATGG - Intronic
1098444081 12:70548239-70548261 AATTGCTTGAATCTAAAAAGTGG + Intronic
1099335542 12:81352137-81352159 AAGTGACTGTATTTGAAAATAGG + Intronic
1100284110 12:93148452-93148474 CAGTGCCTTTATCTGTAAAATGG - Intergenic
1100393431 12:94164020-94164042 CAGTGACTGTATCTGTAAAATGG - Intronic
1100633262 12:96409095-96409117 GGTTGCCTGTGTCTGAAGAAGGG + Intergenic
1103248355 12:119477864-119477886 AATTGTCTGTATTTTAAAATTGG - Intronic
1104493064 12:129211011-129211033 AGTTTTCTCTATCTGAAAAATGG - Intronic
1104812676 12:131628059-131628081 AATTGCCTGTTACTAAAAATGGG - Intergenic
1106024583 13:25944911-25944933 TATTTCCTTTATCTGTAAAATGG + Intronic
1107084381 13:36410155-36410177 AATTGCTTGAATCTGGAAAGTGG + Intergenic
1110205708 13:72910482-72910504 AACTTCCTCGATCTGAAAAAGGG + Intronic
1110211209 13:72975538-72975560 GATTGTCTGTATCTGAGAAATGG + Intronic
1111107041 13:83659813-83659835 GATTGACTTTATCTGATAAAAGG + Intergenic
1111128700 13:83946239-83946261 AATCGCTTGTACCTGAAAGATGG - Intergenic
1112801447 13:103114507-103114529 TATTGCCTGTGTCTTAACAACGG + Intergenic
1113043153 13:106125902-106125924 AATAGCCTTTATTTGAAACAGGG - Intergenic
1114501968 14:23176553-23176575 AATTACCTGTACGTTAAAAATGG - Intronic
1116243214 14:42373999-42374021 AATTACTTGAAGCTGAAAAATGG - Intergenic
1116477387 14:45356846-45356868 AATTGGTTGTCTCTGAAAATGGG - Intergenic
1117926079 14:60780456-60780478 ATTTGGTTGTACCTGAAAAATGG + Intronic
1118406184 14:65425888-65425910 AATTGCTTGAACCTGAAAGACGG + Intronic
1118668337 14:68095272-68095294 AATTACCTGCAACTGAAAGAGGG + Intronic
1118859291 14:69649908-69649930 AATTCCATTTATCTGTAAAATGG + Intronic
1119190268 14:72677022-72677044 AATTGAATTCATCTGAAAAAGGG + Intronic
1119948667 14:78721773-78721795 AATGACATGTATCTGAGAAAGGG + Intronic
1120450425 14:84659712-84659734 AATTGCCCTCATCTGAAACATGG + Intergenic
1122161747 14:99789705-99789727 AATTGCCTTTCTATGAATAAAGG + Intronic
1124088588 15:26576666-26576688 AACTGCAGGTATCTGAAACATGG - Intronic
1124862938 15:33460711-33460733 AAGTGCCTTTACCTGTAAAATGG + Intronic
1125465961 15:39952932-39952954 AATTGCTTGAACCTGAGAAATGG - Intronic
1126096964 15:45096870-45096892 ATTTGCCTGTCTCTGAGAGAAGG + Intronic
1126368399 15:47920058-47920080 AATTGCCTGGATCAGGAAATTGG - Intergenic
1126709151 15:51437858-51437880 AAGTGCCTACATCTGAAAAGAGG - Intergenic
1127222959 15:56899642-56899664 AATTGCATGTATTTGTAAGACGG + Intronic
1127376722 15:58391944-58391966 CATTTCCTTTATCTGTAAAATGG - Intronic
1127445401 15:59057319-59057341 AATTGCTTGTACATAAAAAAGGG - Intronic
1128430929 15:67592369-67592391 AATTTCCTCTTTCTGTAAAATGG - Intronic
1129055190 15:72814325-72814347 TATTGCCTGTATCTGGTACAGGG + Intergenic
1130141676 15:81231210-81231232 AATACCTTGTCTCTGAAAAAAGG + Intronic
1131553969 15:93380695-93380717 AATTGCCTGCCTCTGAAGAGAGG - Intergenic
1132174239 15:99696623-99696645 AAATGCCTATATTTGAAAAGAGG + Intronic
1133189158 16:4120708-4120730 AATTGCCTGAACCTGGGAAATGG - Intergenic
1133949960 16:10383293-10383315 AATTGCTTGAACCTGAAAGAAGG - Intronic
1135035120 16:19070662-19070684 AATTGCCTGAGTCTGAAAGGTGG + Intronic
1135915878 16:26605056-26605078 AAATGCCTGTATTAGAAAACTGG + Intergenic
1137837721 16:51609345-51609367 AATTGCTTGTAATTGAGAAAAGG + Intergenic
1137913916 16:52407445-52407467 AATTGCCTGTACATGGGAAATGG - Intergenic
1138977276 16:62222812-62222834 AATTTCTTTTATCTGCAAAATGG + Intergenic
1141070906 16:80953901-80953923 AAATACCTGTATCAAAAAAAAGG + Intergenic
1145084577 17:19926317-19926339 AAATTCCTGAATCTGAAAAAAGG + Intronic
1146080631 17:29777123-29777145 AATTGCTTGAATCTGGAAGATGG + Intronic
1148294063 17:46484487-46484509 AATTTCCTATAGCTGAAGAAAGG - Intergenic
1148316246 17:46702190-46702212 AATTTCCTATAGCTGAAGAAAGG - Intronic
1148373844 17:47124368-47124390 AATTGCTTGAATCTGAGAAGCGG - Intronic
1148501458 17:48094641-48094663 AATTGCTTGAATCCGGAAAACGG + Intronic
1149161317 17:53696555-53696577 AATCGCTTGTATCTGAGACAGGG + Intergenic
1150349341 17:64430664-64430686 CATTGCCTGTAGCAGAGAAAGGG + Intergenic
1152329530 17:79664259-79664281 AATTGCTTGAATCTGGAAAGTGG - Intergenic
1155763565 18:29598706-29598728 CATTGCATGTATCTGACAAATGG + Intergenic
1156123151 18:33869920-33869942 AATTTCTTGTATATGAAGAAAGG + Intronic
1156911858 18:42420500-42420522 AATTGCCTATATAGGAAAACTGG + Intergenic
1158367132 18:56749231-56749253 AATTTCCTAAATGTGAAAAACGG - Intronic
1159467232 18:68799943-68799965 AATTGCAAGTTTCTGAAAAGAGG + Intronic
1159828344 18:73242506-73242528 CATTGCCTGGCTCTGAAAACAGG + Intronic
1164215033 19:23137081-23137103 AATTGCTTGAATCTGGGAAATGG + Intronic
1164908179 19:31984646-31984668 AATTGCCTGTAACTGAGATAAGG - Intergenic
1165618526 19:37224356-37224378 AATTGCCAATATCTGATAAGAGG + Intronic
1167320202 19:48792893-48792915 AATTGCTTGAATCTGGGAAATGG - Intergenic
1168522536 19:57063788-57063810 AACTGCTTTCATCTGAAAAAAGG + Intergenic
926896454 2:17694823-17694845 AATTTGATGTATTTGAAAAATGG + Intronic
928714055 2:34039720-34039742 AATTGCTTGAACCTGAAAAGCGG + Intergenic
929104943 2:38355784-38355806 AATTGCTTGTACCTGCAAGACGG - Intronic
931967060 2:67546049-67546071 CATTGCCTGGATGTGAAACATGG - Intergenic
932041092 2:68300528-68300550 AATTGCTTGAACCTGGAAAACGG + Intronic
932121232 2:69102517-69102539 AACTGCCTGGATTTGAAAACTGG + Intronic
932744414 2:74320820-74320842 AAAAACCTGGATCTGAAAAATGG + Intronic
933098628 2:78222114-78222136 GAATGTCTGTATCTGAAAGAGGG - Intergenic
935923778 2:108044185-108044207 AATTGCCTTAATCTGATAAAAGG + Intergenic
936674453 2:114698912-114698934 AATTGCCTGTTACTGACCAATGG - Intronic
937592215 2:123628555-123628577 AAATGCCTGCATATGAAATATGG - Intergenic
937595330 2:123665363-123665385 AATTGTCTGTGTCTTAAAAAGGG - Intergenic
937623400 2:124016134-124016156 AATTATTTGTATCTGTAAAATGG - Intergenic
938024028 2:127929335-127929357 AATTGACTCTAAATGAAAAATGG + Intergenic
938304066 2:130238549-130238571 AATTGCTTGAATCTGGAAAGTGG - Intergenic
938452618 2:131435737-131435759 AATTGCTTGAATCTGGAAAGTGG + Intergenic
939188769 2:138890822-138890844 AATTGCTTGTACCTGGGAAATGG + Intergenic
939234768 2:139477166-139477188 AATGACGTGTCTCTGAAAAAAGG + Intergenic
939776436 2:146393093-146393115 AATTGCCTGTTACTAAAAATGGG - Intergenic
939855571 2:147354770-147354792 AATTACCTGTATGAAAAAAATGG - Intergenic
941078800 2:161036361-161036383 GATTGCCAGTATCTGAACCAGGG + Intergenic
941411394 2:165160939-165160961 GATAGGCTGTCTCTGAAAAATGG - Intronic
941572372 2:167187430-167187452 AATTGGCTGTACATGAAACAAGG + Intronic
941824481 2:169878272-169878294 AATTGCTTGAATCTGAGAAGTGG + Intronic
942100321 2:172575014-172575036 AATTTCCTCAATCTGATAAAGGG - Intronic
942382706 2:175408705-175408727 AATTGCCTGAATCTGGGAGATGG - Intergenic
943102291 2:183502407-183502429 AAATGCCTGTATCAGAAGAGTGG - Intergenic
943218033 2:185064451-185064473 AATTACCTTTACCTGAAAAAGGG - Intergenic
943331169 2:186560912-186560934 AATTGCCTGTTTGTCAGAAATGG - Intergenic
944840516 2:203619633-203619655 AGTTTCCTGTGTCTGAAACAGGG + Intergenic
945540277 2:211077330-211077352 ACTTGACTGTAAATGAAAAAGGG + Intergenic
946968170 2:225061830-225061852 AAGTTCCTGTATCTAAAAAAGGG + Intergenic
947325907 2:228976343-228976365 AATTTGCTATCTCTGAAAAAAGG - Intronic
947846461 2:233248113-233248135 AATTGCCTGTATTTGAACCCAGG + Intronic
947870094 2:233430514-233430536 GTTTGCATGTATCTTAAAAATGG + Intronic
1168821722 20:777960-777982 AGGTGCCTGTATCAGGAAAAAGG + Intergenic
1169786264 20:9362568-9362590 GATTGCCAGCAACTGAAAAAGGG + Intronic
1170522667 20:17204152-17204174 AATTACTTGTATTTTAAAAATGG - Intergenic
1170843409 20:19942021-19942043 AATTGCTTGAACCTGAAAGATGG + Intronic
1172866412 20:38102552-38102574 AATTGCTTGAACCTGAAAAGTGG + Intronic
1173035026 20:39400585-39400607 GATTCCCTGTATCAGAAAATTGG + Intergenic
1173538838 20:43836430-43836452 CATTGCCTCTATTTGTAAAATGG - Intergenic
1173732618 20:45339205-45339227 AATGGGCTTTATCTGAAAAGAGG - Intronic
1177510531 21:22081383-22081405 AATTGGCTGTATCTGAACAGTGG - Intergenic
1178168018 21:30004368-30004390 AATTGACTGGAGCTGAGAAATGG - Intergenic
1178281793 21:31289728-31289750 AATTGCCTTTATATTAAAAGAGG - Intronic
1184442470 22:44526066-44526088 AAATCCATGTTTCTGAAAAATGG - Intergenic
949120468 3:378101-378123 AATTTCTTTTATATGAAAAAAGG - Intronic
949267541 3:2175993-2176015 TATTCCATGTATGTGAAAAAAGG + Intronic
950021647 3:9792174-9792196 AAAAGTCTGAATCTGAAAAATGG + Intronic
950381154 3:12616454-12616476 AATCCCCTATATCTGAACAATGG - Intronic
953519503 3:43627971-43627993 AATCGCCTGTATCTGGGAGACGG - Intronic
954956439 3:54523852-54523874 AATTACCAGAATCTGAAAGAGGG - Intronic
955086404 3:55706971-55706993 CATTTCCTATATCTAAAAAATGG + Intronic
955713544 3:61804890-61804912 AAATGCCTGTGTCTGCAAAGGGG - Intronic
955835635 3:63051832-63051854 AATTTCCTGTGTCTGTGAAAAGG + Intergenic
956762251 3:72454324-72454346 AAGAACCTGTCTCTGAAAAAAGG + Intergenic
957125903 3:76159959-76159981 AATTGCCTGTACTTGATGAAAGG + Intronic
957239291 3:77637940-77637962 AATTGCCAGCATTTCAAAAAGGG + Intronic
957750627 3:84410598-84410620 CATTGCGGGTATCTGAAGAAAGG + Intergenic
957844877 3:85718997-85719019 AATTGCTTGAATGTGAAAAGTGG - Intronic
958068775 3:88581796-88581818 ACTTGCCTCTGTCTGTAAAATGG - Intergenic
958126236 3:89359154-89359176 CATTGTCTTTATCTGAAATAAGG - Intronic
958222153 3:90703500-90703522 AAACGCCTCTATCAGAAAAAAGG + Intergenic
959579610 3:107970030-107970052 GCTTTCCTATATCTGAAAAAGGG - Intergenic
959916866 3:111826220-111826242 AATTGCTTGAATCTGAGAGATGG + Intronic
960026090 3:113012064-113012086 ATTTGCCCGTATCTGTAAGAAGG - Intronic
960262966 3:115589119-115589141 AATTTCCTTCATCTGCAAAAAGG - Intergenic
960723113 3:120643884-120643906 AATTGCTTGTATTTGAAATAGGG + Intronic
961124501 3:124404238-124404260 CTTTTCCTTTATCTGAAAAATGG + Intronic
962581250 3:136799910-136799932 AGTTGCCCATATCAGAAAAATGG - Intergenic
962612278 3:137088570-137088592 AATTGCATATATTAGAAAAAAGG - Intergenic
962911862 3:139859544-139859566 AAATGACCTTATCTGAAAAAAGG + Intergenic
963274864 3:143319892-143319914 ATTTTCCTGTCTCTGAAACAGGG + Intronic
964326835 3:155556030-155556052 AATTGCCAGTATTTAAAAATTGG - Intronic
964952579 3:162314669-162314691 AAGTGCCTGTATCAAAAAGAAGG - Intergenic
965046446 3:163584521-163584543 AATGCCCTGTATGTGAAACATGG - Intergenic
965711692 3:171562056-171562078 CATTCTCTTTATCTGAAAAATGG - Intergenic
965738273 3:171845786-171845808 CATTCCCTTTATCTGTAAAATGG + Intronic
966041922 3:175501637-175501659 AATGTCCTTTATCTGAAATAAGG + Intronic
967734517 3:192938107-192938129 AATTGGCTGTAACTCAGAAATGG - Intergenic
968461656 4:729011-729033 AATTGCTTGAATCTGGAAAGTGG + Intronic
968761561 4:2444896-2444918 TATTTCCTGTATCTGTACAAGGG + Intronic
970506587 4:16736392-16736414 ATTTGCCTGTATTTTTAAAAAGG + Intronic
970896293 4:21108122-21108144 TATTTCCTGTATCTGAATATTGG + Intronic
970931853 4:21521287-21521309 AACTGCCTTCATGTGAAAAATGG + Intronic
970984738 4:22143699-22143721 AATTTCCTCGATCTGATAAATGG - Intergenic
971172931 4:24252095-24252117 ATTTCCCTGAATTTGAAAAAGGG + Intergenic
971311764 4:25531171-25531193 AGTTGTCTTAATCTGAAAAATGG + Intergenic
971838060 4:31794915-31794937 AATTGTCTTTATCTAAAAGATGG - Intergenic
973537550 4:51898554-51898576 AATTGCCTTTAAATGGAAAATGG + Intronic
974226516 4:59052331-59052353 ATTTTCCTGCATCTGTAAAAAGG - Intergenic
974311670 4:60219252-60219274 AATTGTCTGTTTCTGTAACATGG + Intergenic
974701166 4:65449239-65449261 ATTTTCCTGATTCTGAAAAACGG - Intronic
975044527 4:69784943-69784965 AATATCCTGTATCTGACATAAGG - Intronic
975115079 4:70671149-70671171 AATTTCCTCTATCTGTAAAAGGG + Intronic
977987587 4:103402232-103402254 AATTGCCTCTATTGGAAAGAAGG - Intergenic
979030733 4:115641761-115641783 TATTGCCTATATATGTAAAATGG - Intergenic
979156159 4:117392862-117392884 AACTGCCTGGATCTGGAAGAGGG - Intergenic
979228048 4:118312926-118312948 AATCATCTGTATCTGAAAAATGG - Intronic
979341183 4:119526170-119526192 AAGTTCCTGTACTTGAAAAATGG - Intronic
979385498 4:120060235-120060257 ATTTGGTTGTACCTGAAAAATGG - Exonic
979679409 4:123443405-123443427 AAATGGCTGTGTCTGAAAATTGG - Intergenic
980431087 4:132697339-132697361 TATTGCCTCTATCTTCAAAAGGG - Intergenic
980658554 4:135824862-135824884 CATTGTCTCTATCTGAAATAAGG - Intergenic
980748814 4:137060391-137060413 TATTGCCTGTATTTGAAACATGG - Intergenic
981075123 4:140583289-140583311 AATTTCCAGTCTCTGAAAACTGG - Intergenic
982520354 4:156408733-156408755 GTTTGTCTGTTTCTGAAAAAGGG - Intergenic
982981916 4:162148279-162148301 ACTAGCCTGTCACTGAAAAATGG + Intronic
983115013 4:163804284-163804306 AATTGGCTGTGGCTCAAAAATGG - Intronic
984192015 4:176617410-176617432 AGATGCCTGAATCTGTAAAATGG - Intergenic
986016101 5:3758395-3758417 AAAGGCCTGTGTCTGAAGAATGG + Intergenic
986209502 5:5657372-5657394 AATTGCATGTAGTTGAAAATGGG + Intergenic
986732625 5:10646637-10646659 AATTGCATGTCACTTAAAAAAGG - Intronic
987634958 5:20527382-20527404 AATTTCCTGAATCTGAATAATGG - Intronic
988925454 5:35986155-35986177 AATGGCTTTTATCTGAAAAACGG + Intronic
989810672 5:45669280-45669302 AATTGCCTGTACTTGAAGAGAGG + Intronic
990052471 5:51522120-51522142 AATTGCCTGTACTCTAAAAAAGG + Intergenic
990322725 5:54645693-54645715 AATTTCCTGTATATGTAAAATGG - Intergenic
990662473 5:58032312-58032334 TATTGCCTATATTAGAAAAAAGG - Intergenic
990975757 5:61560166-61560188 ATTTGCCTGTGTTTGAAAAGAGG - Intergenic
992415422 5:76548159-76548181 AATTTCCTCTATCAGAAAACTGG - Intronic
992739171 5:79755761-79755783 TATTTCCTGTTTCTGAAAAAAGG + Intronic
993719993 5:91312929-91312951 AATTTCCTCAGTCTGAAAAATGG + Intergenic
994765884 5:103917598-103917620 AATTTTCTGTCTCTGAAATAAGG - Intergenic
996405749 5:123100449-123100471 AATTGTTTTTATCTGAGAAAAGG - Intronic
998502044 5:142641961-142641983 AATTTCATGGAGCTGAAAAATGG + Intronic
998882427 5:146657090-146657112 AATTGCATGTCTCTGAAGCAAGG - Intronic
998975912 5:147647348-147647370 AAATGCATATATTTGAAAAAAGG + Intronic
999190930 5:149746921-149746943 ATTTGCCTGTATTTTAAAATTGG + Intronic
1000040764 5:157483541-157483563 AAATGTCTGTAACAGAAAAAAGG + Intronic
1000081113 5:157848184-157848206 AATTGCTTGAATCTGGAAAGTGG - Intronic
1000082363 5:157860135-157860157 AATTGACTTTATCTGTAAAGTGG - Intergenic
1000589072 5:163136311-163136333 AATTGCTTGAACCTGAGAAACGG + Intergenic
1001336570 5:170802421-170802443 AAATGTCTGCTTCTGAAAAATGG - Intronic
1001757404 5:174181062-174181084 ACTTCCCAGTGTCTGAAAAATGG + Intronic
1003359466 6:5410901-5410923 AGGTTCCTGCATCTGAAAAACGG - Intronic
1004287064 6:14330800-14330822 AATTGCTTGAATCTGGAAACCGG + Intergenic
1004481044 6:16019490-16019512 AATTGCCTGCCTTTGAAAACTGG + Intergenic
1004930214 6:20455809-20455831 AATTGCCTGGAGTTGTAAAAGGG - Intronic
1005690749 6:28302913-28302935 CATTGCTTGCATCTTAAAAATGG - Intergenic
1006299697 6:33187039-33187061 AATGGAACGTATCTGAAAAATGG - Intronic
1006571812 6:35011793-35011815 AAATGACTGTAAATGAAAAATGG + Intronic
1006596097 6:35193454-35193476 AATTACCTGTATTTTAACAAAGG + Intergenic
1007904307 6:45443935-45443957 AATTGCTTGAATCTGGAAGATGG - Intronic
1008833530 6:55799125-55799147 ATTTCCCTGTATATTAAAAATGG + Intronic
1010168369 6:72943942-72943964 AAATGTCTTTATCTGTAAAAAGG - Intronic
1010706733 6:79122275-79122297 AATGTCCTGAATCTGATAAAAGG + Intergenic
1010838050 6:80613731-80613753 TATTTCCTGTATTTGAAAATTGG - Intergenic
1011112888 6:83857873-83857895 CATTACCTGTAATTGAAAAAGGG + Intergenic
1012237975 6:96839405-96839427 ATTTGCCTTTATCTACAAAAAGG + Intergenic
1012795822 6:103759597-103759619 AATTTCCAGTATCTAAAAAGGGG + Intergenic
1013181901 6:107724152-107724174 AATTTCCTCAATCTGACAAAGGG + Intronic
1013343006 6:109233659-109233681 AATTGCCAATATCAGAAAGATGG - Intergenic
1014131151 6:117835484-117835506 AATAGCTTTTATCAGAAAAATGG + Intergenic
1014174415 6:118315834-118315856 AATTTCCTGTGTTTGAAAAAAGG - Exonic
1014599137 6:123386882-123386904 AATTGTCTCAATCTCAAAAAGGG + Intronic
1017198432 6:151727002-151727024 AACTACCTGAATCTGATAAATGG - Intronic
1017386201 6:153886879-153886901 AATTGTCTGTGGATGAAAAAAGG + Intergenic
1018236513 6:161729533-161729555 AATTGCCTTGAACTGTAAAATGG - Intronic
1018305097 6:162446722-162446744 AAGTGCCATTATGTGAAAAATGG + Intronic
1018361534 6:163075734-163075756 AATTCCCTGTATCAGATTAAGGG - Intronic
1018458923 6:163978963-163978985 CAAGGCTTGTATCTGAAAAAAGG + Intergenic
1018526268 6:164713376-164713398 AATTCCCAGTGTCGGAAAAAGGG + Intergenic
1021297330 7:18924111-18924133 AATTGCCTGTTTTAAAAAAAAGG + Intronic
1025534282 7:61928930-61928952 AATTTCCTGAATCAGAAGAAAGG - Intergenic
1026371291 7:69702245-69702267 AACTGCCTGCTTCTGAATAAAGG - Intronic
1026413460 7:70152973-70152995 AATTGGTTGTATCTTTAAAAAGG - Intronic
1026722758 7:72846215-72846237 AATTGCTTGAATCTGAGAAGTGG - Intergenic
1026854945 7:73747046-73747068 AATTGCTTGTATCTGAGACGTGG + Intergenic
1027435502 7:78159990-78160012 ATTTGCCTGCATTTGAATAAGGG - Intronic
1028153672 7:87405511-87405533 AATCGCCTGAACCTGAGAAACGG - Intronic
1028530988 7:91838403-91838425 AATTGCCTTCCCCTGAAAAAAGG - Intronic
1029182244 7:98711381-98711403 AAGTGCCTGTATTTGAAGATGGG + Intergenic
1029881132 7:103811257-103811279 AATTGCCTGTATCTGAAAAATGG + Intronic
1030773576 7:113505202-113505224 ACTTCCCTGAATGTGAAAAAAGG + Intergenic
1031516839 7:122711203-122711225 ACATCTCTGTATCTGAAAAATGG + Intronic
1031920116 7:127594284-127594306 ACTTGCCTGTATATGAAAGCAGG + Intronic
1033470619 7:141645681-141645703 AACTGCCTTAATCTGATAAAGGG - Intronic
1033817322 7:145089389-145089411 AATTTCCTTAATCTGATAAAAGG - Intergenic
1034027565 7:147723037-147723059 AGTTTCCTTTATCTGCAAAATGG - Intronic
1035929991 8:3770005-3770027 AATTGGCCGGATCTAAAAAAAGG - Intronic
1036954946 8:13178044-13178066 AATTCCCTGTTTCAGTAAAATGG + Intronic
1037064801 8:14564920-14564942 AATTTGCTGTATAAGAAAAACGG + Intronic
1037328677 8:17721222-17721244 AATTTCCTGTTTCTGATAATGGG - Intronic
1038170294 8:25125601-25125623 AATTGCCAGTGGCTGAAAAGAGG - Intergenic
1039297879 8:36176873-36176895 AATTGTCTGCATCTGACGAATGG - Intergenic
1040479780 8:47814220-47814242 AATTTCCTCAATCTGATAAAAGG + Intronic
1041356169 8:57003209-57003231 AATTGCTTGAACCTGGAAAAAGG - Intergenic
1041443279 8:57922073-57922095 AACTGTCTGAATCTGATAAAGGG + Intergenic
1042667362 8:71221586-71221608 AACTACCTGTATGTGAAAATTGG - Intronic
1043873633 8:85462903-85462925 AAATGCGTGTTTATGAAAAAGGG + Intergenic
1044652618 8:94513248-94513270 AATTGCTTGAATCTGGAAGATGG + Intronic
1045129584 8:99134521-99134543 AATTTCCTGAATCTTAAAATTGG + Intronic
1046199955 8:110912094-110912116 CATTTTCTGTATATGAAAAATGG - Intergenic
1046714579 8:117553573-117553595 AATTGCCTGTAGCTGCCACATGG - Intergenic
1046919695 8:119715269-119715291 AGTTGGCTTTATTTGAAAAAGGG - Intergenic
1047596674 8:126385026-126385048 AATTGCGGATATCTGAAATATGG + Intergenic
1047879903 8:129181594-129181616 AATTTCCTGTCCCTGAGAAATGG - Intergenic
1049295651 8:141834397-141834419 AATTTCCTGGATCTGAGGAAAGG - Intergenic
1049631526 8:143661159-143661181 AATTGCTTGTATCTGGAAAGTGG - Intergenic
1049862162 8:144906800-144906822 AAATGTCTGTAGCTAAAAAATGG - Intergenic
1050403867 9:5286313-5286335 ACATGGCTGAATCTGAAAAATGG + Intergenic
1050508662 9:6371924-6371946 AATTGCCTATCTGTGAAAAGAGG + Intergenic
1051145586 9:14023938-14023960 AAATGTCTGTATCTGTAAAATGG + Intergenic
1051524245 9:18024996-18025018 ATTTGCATTTATCTGAAAATTGG + Intergenic
1052681357 9:31697507-31697529 AATTTCCTCTTTCTGAAAAAGGG + Intergenic
1053033776 9:34807190-34807212 AATTTCCTTAATCTGATAAAGGG - Intergenic
1057756019 9:97836438-97836460 AATTTCCTCAATCTGAAAGAGGG + Intergenic
1058396832 9:104563608-104563630 AATTGCCTGGCTCTTGAAAATGG - Intergenic
1058558887 9:106202858-106202880 TATTTCCTGTATTTGAAAATTGG + Intergenic
1059044294 9:110848111-110848133 AAATTTCTGAATCTGAAAAAGGG + Intergenic
1059662024 9:116411296-116411318 AATTGCCTGTGTTTGGATAATGG + Intergenic
1185600917 X:1338665-1338687 ATTTGCCTGTATCTGGACATAGG - Intronic
1185666679 X:1770914-1770936 AATTGCTTGAATCTGAGAGACGG - Intergenic
1185697147 X:2203848-2203870 AATTGCTTGAATCTGGGAAACGG - Intergenic
1188175079 X:26978964-26978986 AATTGCAAGTATATGAAATATGG - Intergenic
1190847447 X:54207598-54207620 AATTGCCTGAATCTGGGAAGCGG - Intronic
1192378044 X:70584865-70584887 AATAGCCTCAATCTGATAAAGGG + Intronic
1193501539 X:82281606-82281628 AATTGTCTGTGGATGAAAAAAGG - Intergenic
1194150037 X:90312789-90312811 AATTTCTTTTATCTGACAAATGG - Intergenic
1194908132 X:99604567-99604589 AATTGTCTGTTTGTGAAAGAAGG - Intergenic
1196169541 X:112572652-112572674 AATTGCCTGTATGTACAAAATGG + Intergenic
1197368858 X:125600879-125600901 AATTACCTGGATGTGAAACATGG + Intergenic
1197520120 X:127486860-127486882 AAGTGCCTACATCAGAAAAAGGG - Intergenic
1198634027 X:138675656-138675678 AATTGCATCAATGTGAAAAAAGG - Intronic
1199658923 X:150027115-150027137 AAATGCTTATATCAGAAAAAGGG + Intergenic
1200496465 Y:3889869-3889891 AATTTCTTTTATCTGACAAATGG - Intergenic
1201621278 Y:15961254-15961276 ACATACATGTATCTGAAAAATGG - Intergenic
1201851453 Y:18486801-18486823 AATTCCATGTGTCTAAAAAATGG + Intergenic
1201881866 Y:18833578-18833600 AATTCCATGTGTCTAAAAAATGG - Intergenic
1202276117 Y:23121712-23121734 AAATACCTGTATCCGAAAAGTGG + Intergenic
1202289911 Y:23298979-23299001 AAATACCTGTATCCGAAAAGTGG - Intergenic
1202429110 Y:24755434-24755456 AAATACCTGTATCCGAAAAGTGG + Intergenic
1202441681 Y:24914655-24914677 AAATACCTGTATCCGAAAAGTGG - Intergenic