ID: 1029887505

View in Genome Browser
Species Human (GRCh38)
Location 7:103888688-103888710
Sequence TACCAAGCTGTGGCATCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029887505_1029887510 9 Left 1029887505 7:103888688-103888710 CCCCATGATGCCACAGCTTGGTA 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1029887510 7:103888720-103888742 TGTATTCTCCTAACAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029887505 Original CRISPR TACCAAGCTGTGGCATCATG GGG (reversed) Intronic
901031557 1:6310121-6310143 TCCCAAGCTCTGGCAGCCTGTGG - Intronic
901083210 1:6595278-6595300 TACTAAGCTGTGTAATCATAGGG + Intronic
902384210 1:16067218-16067240 AACCAGCCTGTGACATCATGGGG - Intronic
906201098 1:43960929-43960951 CACACAGCTGTGGCACCATGGGG - Exonic
907324701 1:53629359-53629381 TATCACTCTGTAGCATCATGCGG + Intronic
911216147 1:95197772-95197794 TACCAAGCTGTGACCTCAGTGGG - Intronic
913109945 1:115648726-115648748 TTCCTAGCTGTGACATCAGGGGG - Intronic
915076314 1:153310795-153310817 TACCATCCTGTGGCTTCCTGAGG + Intergenic
915080384 1:153348070-153348092 TACCATCCTGTGGCCTCCTGAGG + Intronic
918331971 1:183470351-183470373 TACCAGGCGCTGGCAGCATGAGG + Intergenic
1066695882 10:38077135-38077157 TACCCAGCTGTGGCTTAAAGGGG - Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1077992471 11:7424280-7424302 TCCAAACCTTTGGCATCATGGGG - Intronic
1084490899 11:69477757-69477779 TCCCAGGCTGTGGCAGCTTGGGG - Intergenic
1085781404 11:79412301-79412323 CACCCAGCTGGGCCATCATGAGG - Intronic
1086524738 11:87711880-87711902 TATAAAGCTGTGGCATCCTGTGG + Intergenic
1087232935 11:95686222-95686244 TACCAAGGTTTGGCATCAAAAGG + Intergenic
1087353023 11:97057614-97057636 TAGCAGGCTGTGGCAGCATTAGG + Intergenic
1091395633 12:152784-152806 TCCCTAGCTGTGGGAGCATGGGG + Intronic
1092758461 12:11787130-11787152 AAGCAAGCTGTGGAAGCATGAGG + Intronic
1094673148 12:32590657-32590679 GAGGAAGCTGTGCCATCATGAGG - Intronic
1097327716 12:58297578-58297600 TACCAAGAGGTGCCATCATGTGG - Intergenic
1104401140 12:128477358-128477380 TTCCAAGCTTTGGCCTCATGCGG - Intronic
1105943955 13:25174171-25174193 TCCCAAGCTGGGGCAGGATGGGG - Intergenic
1114405497 14:22452570-22452592 TACTAAGCTGTGTGATCTTGAGG - Intergenic
1119414847 14:74463000-74463022 TACCAAGATGTCGGATCATGGGG + Intergenic
1129300236 15:74621220-74621242 TGCCATCCTGTGGCAGCATGTGG - Intronic
1129308725 15:74689272-74689294 TACCAAGTTTTGGCAAGATGAGG - Intronic
1131582652 15:93660193-93660215 TATCCAGCTTCGGCATCATGGGG + Intergenic
1133851547 16:9509077-9509099 TTCCCAGCAGTGGCATCATTGGG - Intergenic
1137743887 16:50806776-50806798 TACAAATCTGTGGCTTTATGGGG + Intergenic
1139239493 16:65376316-65376338 TGCCAAGCGGGGGCATCATTGGG + Intergenic
1139646388 16:68334154-68334176 CACCCAGCTGAGGCATCCTGAGG + Intronic
1140289622 16:73640877-73640899 TGCAAAGCTGTGCCTTCATGTGG - Intergenic
1140322329 16:73965230-73965252 TACTAAGCTGTGGGATATTGAGG - Intergenic
1141039635 16:80661824-80661846 TACCAGACTGTGGCCTCTTGAGG + Intronic
1142270472 16:89086505-89086527 TTCGAGGCTGTGGCACCATGTGG - Intergenic
1142470567 17:161196-161218 TGCTAAGCTGAGGGATCATGGGG - Intronic
1146139714 17:30355097-30355119 TTCCAAGCTGTGGCATTTAGTGG - Intergenic
1149726597 17:58901081-58901103 CATCATGCTGTGGCATGATGTGG - Intronic
1150936108 17:69637467-69637489 TTCCCAGCTGTGGTATCTTGGGG - Intergenic
1152631516 17:81412742-81412764 TACCCAGTTGTGAGATCATGTGG - Intronic
1154053221 18:10983383-10983405 TACCAAGTTGTGCCACCTTGAGG - Intronic
1155225170 18:23723379-23723401 GACCATTCTATGGCATCATGTGG - Intronic
1155938582 18:31779881-31779903 TTCCAAGCTGTGGCATAGAGAGG - Intergenic
1157198798 18:45641719-45641741 TGCTAGGCTGTGGCTTCATGAGG - Intronic
1159112103 18:64071316-64071338 TACTAAACTCTGCCATCATGGGG - Intergenic
1160273962 18:77412874-77412896 TAACAATGTGTGGCATTATGTGG + Intergenic
1163137928 19:15326316-15326338 TATCCAGGTGTGGCAGCATGGGG + Intronic
925315369 2:2918943-2918965 TACCAAGATGAGTCAACATGGGG + Intergenic
925782360 2:7393226-7393248 GACCAAGAGGGGGCATCATGTGG + Intergenic
926944571 2:18172802-18172824 AACCAATGGGTGGCATCATGTGG - Intronic
928393943 2:30929980-30930002 TTGCCACCTGTGGCATCATGTGG + Intronic
928619167 2:33071461-33071483 TACCAGGCAGTGGGATCATTGGG + Intronic
929040965 2:37743976-37743998 CACTGAGCTGTGACATCATGGGG - Intergenic
932502049 2:72191469-72191491 CAACCAGCTGTGGCATCTTGGGG - Intronic
935384490 2:102486406-102486428 CACGAAGATGTGGCATCATTAGG - Intronic
940982896 2:160023451-160023473 TTACAAGCTGTGGCAACATCAGG + Intronic
941195824 2:162450500-162450522 TAGCAAGCATTAGCATCATGAGG + Intronic
944244080 2:197514281-197514303 TTTCCACCTGTGGCATCATGTGG - Intronic
948486660 2:238285620-238285642 CATCAAGCTGTGACCTCATGAGG - Intronic
1169068670 20:2708460-2708482 TGCCAAGCTCTGGGATAATGGGG - Intronic
1172332681 20:34086473-34086495 TAACAAACTATGGCATAATGTGG + Intronic
1178264649 21:31131887-31131909 TTCCTAGCTGTGGCTTCATATGG - Intronic
1178377772 21:32082187-32082209 TACCAGGCTGTGGAATTACGTGG - Intergenic
1179381784 21:40906084-40906106 TACCAAGCAGTGCCAGGATGTGG + Intergenic
1183001664 22:34864792-34864814 GACCAAGTTATGGCCTCATGGGG - Intergenic
1183722427 22:39570517-39570539 TTCCAAGCTGGGTGATCATGGGG - Intergenic
953498330 3:43408000-43408022 TAGCAAGCTGTGGCAGCAAAAGG + Intronic
956956656 3:74348938-74348960 TACCAAGGTGTGGTAGCATATGG + Intronic
957511470 3:81194066-81194088 TAGCTAGCTGTGTCTTCATGTGG + Intergenic
962487598 3:135860380-135860402 GATGAAGCTGAGGCATCATGGGG - Intergenic
964928748 3:161989240-161989262 TAACAAGCTGTGCCATCCAGAGG + Intergenic
965317837 3:167212541-167212563 TAACAAGCTGTGGGAGTATGTGG - Intergenic
965480890 3:169218424-169218446 ACCCAAGCTGTGGCATTATTGGG - Intronic
966937143 3:184718162-184718184 TTTCAAGCTGTGGGACCATGGGG + Intergenic
969415707 4:7056728-7056750 TACTGAGCAGTGGTATCATGAGG + Exonic
970240164 4:14001051-14001073 TACCCAGCTGTAGCAGGATGAGG - Intergenic
980152492 4:129063938-129063960 AACCGAGCTGTGCCATCTTGGGG + Intronic
983935580 4:173500681-173500703 GACCAACCTGGGGCAACATGGGG - Intergenic
986537505 5:8805958-8805980 GCACAGGCTGTGGCATCATGGGG + Intergenic
986722602 5:10570492-10570514 AGCCAAGCTGAAGCATCATGAGG - Intronic
987016852 5:13829042-13829064 TACCAGGTTCAGGCATCATGAGG - Intronic
988637074 5:32996090-32996112 TGCCAAGATGAGGTATCATGTGG + Intergenic
989434024 5:41390496-41390518 TACCAAGCATTGGTACCATGTGG - Intronic
989799177 5:45514655-45514677 TTCCAAGCTGAGGCAGGATGAGG - Intronic
991290725 5:65031494-65031516 TACGGGGCTGTGGCATCATTGGG + Intergenic
996146986 5:119988633-119988655 TGCCAGGCTTTGGCATCAGGAGG + Intergenic
999153563 5:149442369-149442391 TGCCCAGCTGTGGCGTCATTGGG - Intergenic
1005174745 6:23031861-23031883 TACTAAGCAGTGGTATCACGAGG - Intergenic
1010638181 6:78285794-78285816 TACCCAGCAGTGGCATTGTGGGG + Intergenic
1013336646 6:109169655-109169677 TACCAAGAGGTAGCATAATGAGG - Intergenic
1015803273 6:137082219-137082241 TACCAATCAATGGCATCAAGTGG - Intergenic
1015929523 6:138343898-138343920 TATCCAGGTGTGGCATGATGGGG + Exonic
1016467151 6:144336960-144336982 TACCAAGTGGTGGCATCACTTGG + Intronic
1023393529 7:39732416-39732438 CACCAAGCTGGGGCCTCAGGAGG + Intergenic
1023419838 7:39967607-39967629 TACCCAGAAGTGGGATCATGTGG + Intronic
1027691927 7:81358572-81358594 TCCCAAGCAGGGGCTTCATGGGG - Intergenic
1027778504 7:82495460-82495482 TTCCAAGCTGTGGCATTGTCAGG + Intergenic
1029887505 7:103888688-103888710 TACCAAGCTGTGGCATCATGGGG - Intronic
1034186975 7:149185670-149185692 TAACAGCATGTGGCATCATGAGG - Intergenic
1036283650 8:7423651-7423673 TTCCAAGCTGTGACAACATGAGG - Intergenic
1036337818 8:7887878-7887900 TTCCAAGCTGTGACAACATGAGG + Intergenic
1038138440 8:24816123-24816145 TAGGAAGCTGTGGCCTCGTGAGG + Intergenic
1038222560 8:25624582-25624604 TTCCATGCTGTGTCATCATATGG - Intergenic
1039409940 8:37344605-37344627 TACTAAGGTGAGGCTTCATGAGG + Intergenic
1048527214 8:135214103-135214125 TACCAAGTTGTGAGATCTTGAGG - Intergenic
1048987195 8:139740983-139741005 TCCCAAGCTGTGGAATCAAATGG - Intronic
1050612413 9:7366794-7366816 GACCAAGATTTGGCACCATGAGG + Intergenic
1058751784 9:108046177-108046199 TACCAAGCTTTGGCCCAATGAGG - Intergenic
1187524660 X:20043449-20043471 AAGCCAGCTGTGGCATCATTTGG + Intronic
1196703776 X:118699034-118699056 TACCAAGATGTGGCCCAATGAGG + Intergenic
1198393800 X:136202793-136202815 TATCAAGCTTTGACTTCATGAGG - Intronic
1200986531 Y:9306977-9306999 TACCCAGCAGTGGGATAATGGGG + Intergenic