ID: 1029891114

View in Genome Browser
Species Human (GRCh38)
Location 7:103931463-103931485
Sequence AGGCACTTACACCTTACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029891114 Original CRISPR AGGCACTTACACCTTACCAA GGG (reversed) Intronic
900289185 1:1916657-1916679 AGGCACTGACACCTGACCCAGGG - Intronic
900583314 1:3419949-3419971 AGTGACTTACAACTTAACAAAGG + Intronic
904868192 1:33599122-33599144 AAGCATTTACACCATAGCAAGGG + Intronic
906042448 1:42798550-42798572 AGGCTCTCACTCCTTTCCAAGGG - Intergenic
907934947 1:59033657-59033679 AGGTGCTTACACCTTAGCAGAGG - Intergenic
919648502 1:200121308-200121330 AGGCACATAGAAATTACCAATGG - Intronic
919944108 1:202307389-202307411 AGGCACTTACAGCTTGACCAGGG - Exonic
920180562 1:204129636-204129658 GGGCACATTCACCTTCCCAACGG - Intergenic
920725421 1:208430332-208430354 AGGCACATACACCTAACGAGAGG - Intergenic
921958693 1:221011592-221011614 AGGCACTGACACATTAGCAGGGG - Intergenic
1068960226 10:62860013-62860035 CAGAACTTAGACCTTACCAAAGG + Intronic
1070460724 10:76667071-76667093 AGGCACTTAAAGCATTCCAAGGG - Intergenic
1070873366 10:79778307-79778329 AGTCCCATACTCCTTACCAAAGG + Intergenic
1071640295 10:87300458-87300480 AGTCCCATACTCCTTACCAAAGG + Intergenic
1071654937 10:87437488-87437510 AGTCCCATACTCCTTACCAAAGG - Intergenic
1071671702 10:87615088-87615110 AGGCACTTACATCTTCCCCAAGG + Intergenic
1080281504 11:30562646-30562668 AGGCACCTACAGCTTATTAAGGG + Intronic
1080866947 11:36203916-36203938 AGGCAGTTACAGCTCACCAGAGG + Intronic
1080893343 11:36428186-36428208 AGGCACCTACACCTCACCCCTGG - Intronic
1084895117 11:72260963-72260985 AGGAACAGACACCTCACCAAAGG - Intergenic
1086774619 11:90814773-90814795 ACTCACTTACACATCACCAATGG - Intergenic
1092888256 12:12944471-12944493 AGGCACACTCACCTTACCAGGGG - Intronic
1097419587 12:59358037-59358059 AGGAATTTACACCTTATCCATGG + Intergenic
1100054179 12:90489406-90489428 AGGCACATACATCTCACAAATGG - Intergenic
1102284703 12:111646406-111646428 AGGCACTTACACACTAGCACTGG + Intronic
1104340414 12:127943768-127943790 AGGCATTTACTCCTCAGCAATGG + Intergenic
1105663349 13:22524342-22524364 AGTCAATTACACTTTAACAAGGG + Intergenic
1106001914 13:25731629-25731651 AGGCACATTCCACTTACCAATGG - Intronic
1108219722 13:48220968-48220990 AGGCAATCTCACTTTACCAATGG - Intergenic
1110099443 13:71578292-71578314 AGGCATTTACTCCATACCATTGG + Intronic
1110778088 13:79433028-79433050 AGGCACCTACATCTGGCCAAGGG - Intergenic
1117461743 14:55952219-55952241 AGGTACTTACATCTTTCAAATGG - Intergenic
1119056683 14:71429224-71429246 AGGCACTCAAACCTTATAAATGG - Intronic
1124238529 15:28010973-28010995 AGGAACAGACACATTACCAATGG + Intronic
1124480176 15:30072692-30072714 AGGCACTTGCACCTTTGAAAAGG + Intergenic
1126140803 15:45436968-45436990 AGGCTCTTACAGCTTAGGAAAGG + Intronic
1129032855 15:72630814-72630836 AGCCTCTTCCACCTTCCCAAAGG - Intergenic
1129407654 15:75329634-75329656 AGCCTCTTCCACCTTTCCAAAGG - Intergenic
1129734178 15:77950727-77950749 AGCCTCTTCCACCTTCCCAAAGG + Intergenic
1129841405 15:78745264-78745286 AGCCTCTTCCACCTTCCCAAAGG - Intergenic
1132768320 16:1546407-1546429 AGGCACTCACAGCTGACCAGGGG - Intronic
1134688252 16:16173445-16173467 AGGCACATACACCCCACCATTGG - Intronic
1135245779 16:20855706-20855728 ATGCAATTACAGCTTACCAGGGG + Exonic
1150684684 17:67310869-67310891 AGGCACTAACTCCTTCCCCAGGG + Intergenic
1151348615 17:73518378-73518400 AAGCACTTACCCCTTTCCATAGG - Intronic
1157568829 18:48698853-48698875 AGGAACTTCCACTCTACCAAGGG - Intronic
1165544868 19:36526924-36526946 AGGCACTTACATCTTAGAGAAGG - Intronic
1165682767 19:37791562-37791584 AGGCTCTTACACCTTCCCCTGGG - Intronic
938078127 2:128352617-128352639 AGGCCCCTCCACCTCACCAAGGG - Intergenic
941074302 2:160989620-160989642 TGGCAATTAGACCTCACCAAGGG + Intergenic
942369710 2:175270509-175270531 TGTCACTTACAGCTTACCACTGG - Intergenic
1169759519 20:9075909-9075931 AAGCACTTACAGCTAACAAAAGG - Intronic
1175998008 20:62819970-62819992 AGGCACTTACCCGTTCCCCAGGG - Exonic
1178137137 21:29640387-29640409 AGGTACCTACACCCTGCCAAAGG + Intronic
1179274617 21:39880823-39880845 AGGCACTTACAAATGGCCAAAGG - Intronic
1183796367 22:40121753-40121775 AGGCACATAAGCCTTAGCAAAGG - Intronic
954005832 3:47589751-47589773 AGGCATATAGAACTTACCAAAGG - Intronic
954953579 3:54496663-54496685 AGGCACTTACATTTTAAAAATGG - Intronic
956985863 3:74699629-74699651 AGGCACTTAGTGCTTATCAAAGG - Intergenic
957309761 3:78504984-78505006 AGCCACTTACAACTTACAAGTGG + Intergenic
971745855 4:30579370-30579392 ATGCATTTGCACCTTTCCAAGGG + Intergenic
973254426 4:48094751-48094773 AGGCACTTTCAGCTTAGCCACGG + Intronic
974829476 4:67172653-67172675 AGGCACTTACATCTGGCCAGAGG + Intergenic
974896900 4:67950936-67950958 AGGCTCTTCCACCTCACCAGGGG - Intronic
975375025 4:73632979-73633001 ATGCACTGAGATCTTACCAAGGG - Intergenic
984196376 4:176662614-176662636 AGGCAGTTATACCTTTACAAGGG - Intergenic
986144932 5:5068961-5068983 AGGCACATCCACATTACCAGAGG + Intergenic
986842005 5:11708339-11708361 AAGCAATTAAACATTACCAAAGG + Intronic
995870256 5:116737220-116737242 AAGCACTAATACCTTAACAAAGG - Intergenic
1000745993 5:165034677-165034699 AGGCACCTACATATTCCCAAAGG - Intergenic
1002878431 6:1231574-1231596 AGGCACTTAAAGCTTTCCATAGG + Intergenic
1004149833 6:13105722-13105744 AAGCACTTACACCTAATTAAAGG + Intronic
1011403354 6:86989105-86989127 ATGCACATACCCCTTACCCAAGG + Intronic
1011443919 6:87417378-87417400 AGACACTAACACCTTATCAGTGG - Intronic
1012277175 6:97288564-97288586 AGGCACTTAGTCATTAACAAGGG + Intergenic
1013319923 6:108977720-108977742 GGACACATACACCTTCCCAAGGG - Intergenic
1014805028 6:125819971-125819993 AGGCTCTCACACCTTATCAGAGG - Intronic
1016463243 6:144300699-144300721 AGCCACTCACACCTTTCCAGTGG - Intronic
1017390093 6:153928661-153928683 AGGCACATTCACATTACCAAGGG - Intergenic
1017446020 6:154508656-154508678 TGCCACTTACTCTTTACCAAGGG + Intronic
1022956703 7:35387475-35387497 AGGCACAGACACCCTCCCAAAGG - Intergenic
1024172592 7:46805477-46805499 ACTCAGTTACACCTTACAAATGG + Intergenic
1029891114 7:103931463-103931485 AGGCACTTACACCTTACCAAGGG - Intronic
1037267925 8:17087618-17087640 AGGTACTAAGACCTTACAAACGG + Intronic
1042876447 8:73444617-73444639 AGGAACTTACAATTTACCATGGG - Intronic
1051607974 9:18935296-18935318 AGGCATTCACACTTTGCCAATGG + Intronic
1054814683 9:69463796-69463818 TGGCACTTTCACCTAAACAAAGG - Intronic
1059812664 9:117873160-117873182 AGGCACTTACATCCCACCCAAGG - Intergenic
1060961703 9:127685298-127685320 AGGCTCTCAGACCTTACCAAGGG - Intronic
1191821475 X:65313574-65313596 AGGCCCAAACAGCTTACCAAAGG + Intergenic
1192114411 X:68396870-68396892 AGCCACTTACTACTTATCAAGGG - Intronic
1194659073 X:96608684-96608706 AGGCACTTTCAGCCTATCAAAGG - Intergenic