ID: 1029891585

View in Genome Browser
Species Human (GRCh38)
Location 7:103935582-103935604
Sequence GGGATCCTTTGGCATGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029891585 Original CRISPR GGGATCCTTTGGCATGTAGA TGG (reversed) Intronic
901268100 1:7927910-7927932 GGAGTCCTTTGGCATATATATGG - Intronic
906153596 1:43601571-43601593 GGGATGCTTTGGCGGGTGGAAGG + Intronic
906204658 1:43980280-43980302 GGGATGCTTGGGCCTGGAGATGG - Intronic
907558753 1:55368677-55368699 GCCATCCTTTGTCATCTAGATGG - Intergenic
910041079 1:82852098-82852120 GGAATCCTTTGGAATCTAGGTGG + Intergenic
913158280 1:116121707-116121729 GGGATTCTTTAGCAGGGAGAGGG - Intronic
914905674 1:151741609-151741631 GGCATACATTGGCTTGTAGATGG - Intergenic
916247703 1:162705304-162705326 GGGATCCATTGGCTCGTAGCTGG - Intronic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
917258422 1:173141175-173141197 GCCGTCCTTTGCCATGTAGATGG + Intergenic
920927862 1:210359600-210359622 AGGATAATTTGGCAGGTAGAGGG - Intronic
922199413 1:223389455-223389477 GGGATGCTTTGATATGGAGAAGG - Intergenic
922577550 1:226672660-226672682 GAGATCCTTAGGCCTTTAGAGGG - Intronic
923216809 1:231856218-231856240 TGAATCCTGTGGCATGTGGATGG + Intronic
923331521 1:232929480-232929502 AGAAGCCTTTGGCATTTAGATGG + Intergenic
924599887 1:245479148-245479170 GGGAATCATTGGCATCTAGATGG + Intronic
1063414231 10:5860163-5860185 GGGAGCCTGGGGCATGTAGCTGG - Intergenic
1063580997 10:7306947-7306969 GGGATGCTTTGGCATGAGGATGG - Intronic
1063906278 10:10783386-10783408 GGCATCCCTTGGTTTGTAGATGG - Intergenic
1064524404 10:16238998-16239020 AGGATCCTTTTGCATGTACATGG - Intergenic
1064707742 10:18090517-18090539 GGTATACTTTGGGTTGTAGATGG + Intergenic
1068011729 10:51460117-51460139 GGGGTCCTCTGGCATTTAGTGGG - Intronic
1069555358 10:69394203-69394225 GAGATCCTTGAGCATGGAGAGGG + Intronic
1070200089 10:74196041-74196063 GGGAGGCTGAGGCATGTAGATGG - Intronic
1072264474 10:93714118-93714140 GGGACACATTGGCATGCAGATGG - Intergenic
1072581863 10:96746907-96746929 GGGATCTTTTGGGATGGGGAAGG - Intergenic
1073773199 10:106757893-106757915 GGGAACCTATGGCATAGAGAAGG - Intronic
1075549143 10:123379360-123379382 GGGAGCCTTGGGCAAGCAGAGGG - Intergenic
1077593635 11:3512879-3512901 TAGATCCTGTGGCCTGTAGATGG - Intergenic
1080063229 11:27980180-27980202 GGTATTCTTTGGCTTGTAGATGG + Intergenic
1083907479 11:65682628-65682650 GGCATACTTTGGGTTGTAGATGG + Intergenic
1084823350 11:71709866-71709888 TAGATCCTGTGGCCTGTAGATGG + Intergenic
1084873637 11:72114756-72114778 GGGAGTCATTGGCATGTAGATGG + Intergenic
1087176916 11:95104753-95104775 GGGACCCTTTGGTTTCTAGAAGG - Intronic
1089023820 11:115246768-115246790 TGTATCCTATGGCATGGAGATGG + Intronic
1092419742 12:8321025-8321047 TAGATCCTGTGGCCTGTAGATGG - Intergenic
1092868488 12:12785146-12785168 GGGATCATTTGGCATGCAGCGGG - Intronic
1094292680 12:28869895-28869917 GGCATTCGTTGGCTTGTAGATGG + Intergenic
1095976688 12:47945069-47945091 GGGTTCCCTTGGCATGTATCAGG + Intergenic
1101405392 12:104424171-104424193 GGGATCCTGTGGGATACAGAGGG + Intergenic
1102270265 12:111528313-111528335 GGGATCTTTTGGTTTGAAGACGG - Intronic
1106155065 13:27146966-27146988 GGCATTCCTTGGCTTGTAGATGG - Intronic
1107129844 13:36883509-36883531 GGGAGGCTTTGGCAGGCAGATGG + Intronic
1107332824 13:39319990-39320012 GTTATCCTTGGGCATCTAGAAGG + Intergenic
1107496298 13:40928847-40928869 TGAAACCTTTGGCATTTAGAAGG + Intergenic
1109462224 13:62676453-62676475 GAGATCTATTGGCATTTAGAAGG - Intergenic
1115075485 14:29384755-29384777 GGGTGCATTTAGCATGTAGAGGG + Intergenic
1116663546 14:47744912-47744934 GAGGGCCTATGGCATGTAGAAGG + Intergenic
1118090361 14:62469066-62469088 GGGTTCCTTTGGCAGCTAGATGG - Intergenic
1122084670 14:99291231-99291253 GGGACACATTGGCATGTAGATGG - Intergenic
1122285388 14:100648799-100648821 GGCATCCTTTGAAATCTAGAGGG - Intergenic
1122835147 14:104427138-104427160 GGGAGCCTGTGGCTTGGAGACGG + Intergenic
1128328205 15:66738790-66738812 GGGATGCTTTGGCAGTTTGAGGG + Intronic
1131303749 15:91223066-91223088 GGAAGCCTTAGGCTTGTAGATGG + Intronic
1132734252 16:1377746-1377768 GGGATCCTTTGCCAGGGAGGAGG - Intronic
1135215026 16:20558347-20558369 AGGATGCTTTGGCATGCAGGGGG - Intronic
1135946769 16:26871994-26872016 TGGATCCTTTGGCAAATACAAGG + Intergenic
1136641241 16:31567485-31567507 GGGAACCTTTGCCATGTGGAAGG - Intergenic
1138160871 16:54752997-54753019 GGGAGTCATTAGCATGTAGATGG - Intergenic
1138415183 16:56867580-56867602 GGGATCTTATGGGATGTAGAAGG + Intronic
1138683944 16:58708246-58708268 GCCATCTTTTGTCATGTAGATGG + Exonic
1142888761 17:2929556-2929578 GGGATCGTTTGGCATCAACACGG + Intronic
1144827571 17:18114923-18114945 GGGAGTCATTGGCATCTAGATGG - Intronic
1152187771 17:78868917-78868939 CGGGTGCTGTGGCATGTAGAGGG + Intronic
1155671031 18:28371374-28371396 GGCATTCTTAGGAATGTAGAAGG - Intergenic
1156739708 18:40309461-40309483 GAGTTCCTCTGGCATGTGGAGGG - Intergenic
1157663671 18:49467524-49467546 GGCATTCCTTGGCTTGTAGAAGG + Intergenic
1158450723 18:57561961-57561983 GTGTTCCTTAGGCATGTAAAGGG - Intronic
1159639014 18:70841512-70841534 GGAATCATTTGGCAGGTAGGGGG + Intergenic
1164716683 19:30396241-30396263 GGGATAATTTTGCCTGTAGATGG + Intronic
1168495330 19:56843077-56843099 GGGAGCCATTGGCATGTAGGTGG - Intergenic
925326484 2:3026080-3026102 GGCATCCTGTGGCTTCTAGATGG - Intergenic
926227906 2:10981400-10981422 GGGAGCCTCTGGCATGGTGATGG - Intergenic
927081026 2:19630799-19630821 GACATTCTTTGGCATGTAGATGG - Intergenic
928023580 2:27722239-27722261 GGGAGCCATTGGCATGTGGAAGG - Intergenic
930520248 2:52456873-52456895 AGGATACTTTGGCCTGCAGAGGG - Intergenic
935195686 2:100814346-100814368 GGGAACCTATGGAATGCAGAAGG - Intergenic
940372433 2:152918206-152918228 GGTATCCTTTGACATTTAGGTGG - Intergenic
942372504 2:175300402-175300424 GGGGCTCTTTGGCATGAAGATGG + Intergenic
942740841 2:179175779-179175801 GTGATCCCCTGGCATGTAGTAGG - Intronic
946375410 2:219305640-219305662 GGAATTCTTTGGCATATAGATGG - Intronic
947047546 2:226005333-226005355 GGAATCCTTTGAAATCTAGATGG + Intergenic
948074660 2:235156534-235156556 GCAATCCTTTGGCATGAAGTGGG - Intergenic
948584636 2:239011679-239011701 GGGTTCCATTGGCATCCAGAGGG + Intergenic
1170277270 20:14605321-14605343 GAGTTCCTTTGGCTCGTAGATGG + Intronic
1171384119 20:24756004-24756026 GGGATCCTTTGGCCAAGAGAGGG + Intergenic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1173331124 20:42077248-42077270 GGGGTCCTTGGGCCTCTAGAAGG - Exonic
1173468370 20:43302391-43302413 GGTATCCTTTTCCATGTAGGAGG - Intergenic
1174529196 20:51197649-51197671 GGGCACCATTGGCATTTAGAGGG - Intergenic
1175959323 20:62627061-62627083 GAGATCTTGTGGCATGGAGAGGG - Intergenic
1178417180 21:32413150-32413172 GTGAGCCCTTGGCATATAGATGG + Intronic
1179440934 21:41393702-41393724 GGGAGTCACTGGCATGTAGATGG - Intronic
1180893325 22:19307792-19307814 GGGAGGCTGTGGCAGGTAGATGG - Intergenic
1183578596 22:38708489-38708511 AGAAGACTTTGGCATGTAGATGG + Intronic
1184261243 22:43317959-43317981 GGGATTCCTTGGCTTATAGATGG - Intronic
951352218 3:21619949-21619971 GGGAAACTTGGGCATGAAGAGGG + Intronic
951594779 3:24306168-24306190 GGTTTGCTTTGGCATGCAGAAGG + Intronic
951692144 3:25407702-25407724 AGCAGCCTTTGGCATGTAGAAGG - Intronic
952557376 3:34548190-34548212 GGGATCTGTTGGTATGTAAATGG + Intergenic
954080073 3:48208375-48208397 GAGATCTTTTGGCATGTATGAGG + Intergenic
958253749 3:91300615-91300637 GGGATTCTTTGGCATTTATATGG - Intergenic
959905184 3:111703367-111703389 GGGATCATTTTGAATATAGAGGG - Intronic
961897427 3:130180214-130180236 TAGATCCTGTGGCCTGTAGATGG - Intergenic
963266871 3:143248720-143248742 GGGAATCATTGGCTTGTAGATGG - Intergenic
967414903 3:189205431-189205453 GGGATATTTTGGCATGAAAAGGG - Intronic
967897918 3:194414929-194414951 GGGAGCCTTTAACATATAGATGG + Intronic
969343057 4:6554300-6554322 GGCATTCTTTGGCTTGTAGATGG - Intronic
971868798 4:32208769-32208791 GGGATCTATTGGCAGGCAGAGGG - Intergenic
972322675 4:37986845-37986867 GGGATCCTTTGATATGTGAAGGG + Intronic
972606612 4:40619597-40619619 GGGAACGCTTGGCATGTTGAGGG - Intronic
974001142 4:56511858-56511880 GGGAGCCATTAGCATATAGATGG - Intronic
978301176 4:107270663-107270685 GGGATCCTCTGGGATGGAGCTGG - Intronic
980593176 4:134918040-134918062 GGCATTCCTTGGCTTGTAGATGG - Intergenic
980748591 4:137057300-137057322 GGTGACCTTTGGCCTGTAGAAGG - Intergenic
980968546 4:139547152-139547174 GGGACCCTTTGGCAGCTGGAGGG - Intronic
988054975 5:26083178-26083200 GGGAACTTTTTGCATGTAGTGGG - Intergenic
988316621 5:29639202-29639224 AGTTTCCTTTGCCATGTAGAAGG - Intergenic
991321967 5:65383841-65383863 GGCATCCTTTGGAATCTAGGTGG + Intronic
993557830 5:89363801-89363823 AGGATCCCTTGGTCTGTAGACGG + Intergenic
994530599 5:100965477-100965499 GGGAGTCATTGGCATGTACAAGG - Intergenic
995244442 5:109920662-109920684 GGGCTCCTGGGGCATGTGGAAGG + Intergenic
999124148 5:149234330-149234352 TGGCTCCTTTGGCTTGTGGAAGG - Intronic
999799840 5:155023262-155023284 GGCATCCTTTGACTTGTGGAAGG - Intergenic
1002160119 5:177310039-177310061 GGGGTCCTTGGGACTGTAGAGGG - Intronic
1003811955 6:9794024-9794046 GGCATCCTTTGGCATGAGGTAGG - Intronic
1009502579 6:64434188-64434210 GGTCTCCTTTTGCTTGTAGATGG - Intronic
1012430241 6:99156451-99156473 GGGATCCTGTGGAATGTATTGGG + Intergenic
1013825878 6:114210929-114210951 GGGAACCTTTGGCCTGGAGGAGG - Intronic
1019973033 7:4557559-4557581 TGGGTCCTTTGGTCTGTAGAGGG - Intergenic
1020502052 7:8935748-8935770 GGGAGGTTTTGGCATGTAGGTGG + Intergenic
1029891585 7:103935582-103935604 GGGATCCTTTGGCATGTAGATGG - Intronic
1030727699 7:112945444-112945466 GGAATCTTTTGGCCTGTTGAGGG + Intergenic
1033006314 7:137568356-137568378 GGGAGCCTGTGGCATGCAGTTGG - Intronic
1033420895 7:141203797-141203819 GGGAGCCTCTGGCATGTGGTCGG + Intronic
1033435642 7:141331198-141331220 GGGAGTCTTTGGCATGCAGATGG + Intronic
1036636829 8:10556744-10556766 GGGATACTTTGAGTTGTAGATGG + Intergenic
1039831216 8:41216560-41216582 AGGATTCCTTGGCCTGTAGATGG + Intergenic
1043565356 8:81541649-81541671 GGAAGCCTTTGGCAGGTAGCAGG - Intergenic
1044564913 8:93652561-93652583 GGGATCCTTTGGCAATTGGGTGG - Intergenic
1045718030 8:105071183-105071205 GGGAGTCATTGGCAGGTAGATGG + Intronic
1047909384 8:129510691-129510713 GGCATCCTTTGGCTTATAGGTGG + Intergenic
1050451707 9:5788432-5788454 GGAATCCTTTGGCATTTGGGTGG + Intronic
1053529700 9:38868166-38868188 GGCATTGTTTGGCTTGTAGATGG - Intergenic
1054201925 9:62092593-62092615 GGCATTGTTTGGCTTGTAGATGG - Intergenic
1054636432 9:67495766-67495788 GGCATTGTTTGGCTTGTAGATGG + Intergenic
1056730915 9:89166148-89166170 GGGATTATCTGGCATGTGGATGG - Intronic
1057020483 9:91693565-91693587 GGGAGCCTTTGGCATATGGATGG - Intronic
1058680771 9:107438510-107438532 GGGAGCAATTGGCATGCAGATGG - Intergenic
1061014637 9:127974661-127974683 GGGATCCAGTGGGATGCAGAAGG + Intronic
1061482045 9:130902189-130902211 GGGCTCCCTTGGCTTCTAGATGG + Intergenic
1061646599 9:132007784-132007806 GGGATCCATCAGCAAGTAGATGG + Intronic
1061971569 9:134048149-134048171 GGCATCCACTGGCTTGTAGAAGG + Exonic
1187279752 X:17848913-17848935 GGGATCTTTTGGGAGGAAGAGGG - Intronic
1189167089 X:38870851-38870873 GGAATCATGTGACATGTAGATGG + Intergenic
1189880524 X:45486968-45486990 GGCATCCTTTGAAATCTAGATGG - Intergenic
1190450149 X:50571298-50571320 GGGAGTCATTGGCATGTAGACGG + Intergenic
1192205416 X:69092725-69092747 GGGAGTCATTGGCATATAGATGG + Intergenic
1193113835 X:77756569-77756591 GGGTTCCTTTGGCTTGGGGAAGG + Intronic
1195121123 X:101753579-101753601 GGGAACTTTTGGCAGGCAGAAGG + Intergenic
1196228602 X:113194722-113194744 GGAATCTTTTGGCTTGTAGATGG - Intergenic
1198686137 X:139229968-139229990 AGGATCATATGGCTTGTAGAAGG - Intergenic
1199116189 X:143996005-143996027 AGGTTCTTTTGGCATGCAGAAGG - Intergenic