ID: 1029893603

View in Genome Browser
Species Human (GRCh38)
Location 7:103958108-103958130
Sequence AAGGATTAACTAAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029893601_1029893603 -6 Left 1029893601 7:103958091-103958113 CCTCACTGTGTTCATACAAGGAT 0: 1
1: 0
2: 3
3: 11
4: 163
Right 1029893603 7:103958108-103958130 AAGGATTAACTAAAGCAGGATGG 0: 1
1: 0
2: 0
3: 19
4: 255
1029893599_1029893603 26 Left 1029893599 7:103958059-103958081 CCTGAGCTATACAATGGGCAGAA 0: 1
1: 0
2: 2
3: 23
4: 239
Right 1029893603 7:103958108-103958130 AAGGATTAACTAAAGCAGGATGG 0: 1
1: 0
2: 0
3: 19
4: 255
1029893598_1029893603 27 Left 1029893598 7:103958058-103958080 CCCTGAGCTATACAATGGGCAGA 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1029893603 7:103958108-103958130 AAGGATTAACTAAAGCAGGATGG 0: 1
1: 0
2: 0
3: 19
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029893603 Original CRISPR AAGGATTAACTAAAGCAGGA TGG Intronic
902130596 1:14257078-14257100 AAGGATAAATTATAGCAGAAGGG - Intergenic
902444422 1:16452885-16452907 TAGGAATCAGTAAAGCAGGAAGG - Intronic
904860133 1:33531316-33531338 ATGGATACACTAAAACAGGATGG + Intronic
906580893 1:46934517-46934539 AAGGCTCAACTACAGAAGGAGGG - Exonic
906602830 1:47144377-47144399 AAGGCTCAACTACAGAAGGAGGG + Exonic
907310262 1:53535016-53535038 AAGCATGAACAAAAGCAGGGAGG + Intronic
907751628 1:57268915-57268937 AAGGATTAGCAAGAGCAGGAAGG + Intronic
908006690 1:59735286-59735308 AGATGTTAACTAAAGCAGGAAGG - Intronic
908678129 1:66629080-66629102 AAGCATTTACTAAAGCTGAAGGG - Intronic
909176872 1:72371872-72371894 CAGGATAAATCAAAGCAGGAGGG - Intergenic
909754241 1:79203536-79203558 CAGGATTAACAAAATAAGGAGGG + Intergenic
909889721 1:80989279-80989301 AAGGATTAAGAAAAACATGATGG - Intergenic
910066791 1:83163118-83163140 AGGGACTAACTATATCAGGAGGG - Intergenic
910892792 1:92034938-92034960 AAGTATTAACTAAAGTGGGTCGG - Intronic
911724206 1:101224762-101224784 AAGGCTTAACCAAAGAATGAAGG + Intergenic
912576449 1:110675625-110675647 AACTATTCACTAAAGCAGCAGGG - Intergenic
912632164 1:111255241-111255263 AGGGAGTAACTCCAGCAGGATGG - Intergenic
913481696 1:119294868-119294890 AAGCTTTAACAAAAGAAGGAGGG - Intergenic
914446351 1:147753688-147753710 AAGCAGTAACTAAAACAGCATGG - Intergenic
915762556 1:158329640-158329662 CAGGCTTCACTAAGGCAGGAAGG + Exonic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
917665915 1:177225504-177225526 AAGGAAAAACTGAAGCACGATGG + Intronic
921453997 1:215344876-215344898 AAGGAAAAACTAAAGTGGGAGGG - Intergenic
921491015 1:215776034-215776056 AAGGATTAACTAAATAATTAAGG - Intronic
921778434 1:219130886-219130908 AAGAATTCACTGAAGCAGTAGGG + Intergenic
1063000704 10:1918250-1918272 AAGGATTACCTAAAACAAAAAGG - Intergenic
1063474113 10:6313602-6313624 AAGGATAAACTAATGCACAAAGG - Intergenic
1063988366 10:11532937-11532959 AAGGAGTAAATAAAACAGAATGG - Intronic
1064906051 10:20347322-20347344 AGGGATTAGCTAACCCAGGAAGG - Intergenic
1065186876 10:23176838-23176860 AAGGATGAAGTAAAGAGGGATGG - Intergenic
1065246182 10:23760462-23760484 CAGGAATAAGCAAAGCAGGAGGG + Intronic
1065814556 10:29472441-29472463 AATGATTAACGATAGCAGGAGGG - Intronic
1066003373 10:31125269-31125291 CAGGATTATCTAAACCACGAAGG + Intergenic
1067389680 10:45851734-45851756 AAGGAAGAACTAATGCAGAAGGG + Intronic
1067444568 10:46332797-46332819 AAGGAAGAACTAATGCAGAAAGG - Intergenic
1067501786 10:46812109-46812131 AAGGAAGAACTAATGCAGAAGGG - Intergenic
1067592794 10:47527899-47527921 AAGGAAGAACTAATGCAGAAGGG + Intronic
1067639910 10:48035982-48036004 AAGGAAGAACTAATGCAGAAGGG + Intergenic
1067873585 10:49984322-49984344 AAGGAAGAACTAATGCAGAAGGG - Intronic
1068378592 10:56216796-56216818 GAGGATTAGCTAAAACAGGTTGG + Intergenic
1070114752 10:73517489-73517511 AAGGTTTACCTAAAGCACCAGGG - Exonic
1070136869 10:73701952-73701974 AAGGAAGAACTAATGCAGAAGGG + Intergenic
1071444084 10:85729951-85729973 AAGGAGTAATTAAAGAAAGAGGG - Intronic
1071839771 10:89457751-89457773 AAATAGTAGCTAAAGCAGGATGG - Intronic
1072184827 10:93026934-93026956 AATGATTAACTTAATGAGGAAGG + Intronic
1073351703 10:102824598-102824620 AAGGACTAGCTAAAACAGGTAGG + Intergenic
1075035107 10:119058894-119058916 AAGAAATAACTTAAGCAGGAGGG + Intronic
1077466448 11:2735875-2735897 AAGAAGTAATTAAAGCAGAATGG - Intronic
1081993295 11:47348970-47348992 ATGGGTTAACTAAAGCCTGAGGG - Intronic
1082221945 11:49649231-49649253 AAGTATTAATTAAAGTAGCAGGG + Intergenic
1083354652 11:62057252-62057274 GAGGATTAAATAAAGCACTAAGG - Intergenic
1084906614 11:72353264-72353286 GAGGATTCACTAAAGTAGGTGGG + Intronic
1085228200 11:74941805-74941827 AAGAATTAAAAAAAGAAGGATGG + Intronic
1085997378 11:81935986-81936008 AAGGAATAAGTAAAGAATGAAGG + Intergenic
1090023762 11:123150389-123150411 AAAGATGAACAAAAGAAGGAAGG + Intronic
1090109003 11:123884566-123884588 CAGGATTAAGTTAAGGAGGAAGG + Exonic
1090412112 11:126516386-126516408 AAGGAAAAAGTAGAGCAGGATGG - Intronic
1091348403 11:134871983-134872005 AAGGATGAACTGACTCAGGATGG - Intergenic
1092521687 12:9281774-9281796 CAGTATTGACTAAAGCAGGCTGG - Intergenic
1093670350 12:21866976-21866998 AAGGGTTAATTAATGCAGTAAGG + Intronic
1095309218 12:40677562-40677584 AAGGATTAAAAAAAGTAGGCTGG - Intergenic
1095526475 12:43131761-43131783 AAGGAAGAAAGAAAGCAGGAGGG - Intergenic
1096720273 12:53516237-53516259 ATGGTTAAACTAAAGAAGGAGGG + Exonic
1099474587 12:83092856-83092878 AAAGCTGAACAAAAGCAGGAAGG + Intronic
1100948966 12:99823968-99823990 CAGTATTAACTAAAACAGCATGG - Intronic
1108482516 13:50889174-50889196 AATCATTAAATAAAGCTGGATGG - Intergenic
1109258094 13:60108713-60108735 AAGCTTGAACTAAAGCAGGGGGG + Intronic
1109268784 13:60231078-60231100 AAGAAATAAGCAAAGCAGGAAGG - Intergenic
1110518003 13:76439321-76439343 AAGGAGTCACTAAGGCAGGCAGG - Intergenic
1111142529 13:84138944-84138966 AAAGATTATCTAAAGCTGTATGG + Intergenic
1111632422 13:90859339-90859361 AAAGATTAAATAAAGGAGTAGGG + Intergenic
1111956597 13:94765923-94765945 GAGGACTAACTAAAACAGGGAGG + Intergenic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1114252386 14:20972322-20972344 ATGGAAAAAATAAAGCAGGAAGG + Intergenic
1114757192 14:25272858-25272880 AAAGAGTAACTGAAGCAGGGGGG - Intergenic
1114900414 14:27050612-27050634 AAGAAATCACTAAACCAGGATGG - Intergenic
1115043921 14:28966320-28966342 AAGTTTTAACTGAAGAAGGATGG - Intergenic
1115818399 14:37187906-37187928 GAGGGTTAACCAAAGGAGGATGG + Intergenic
1117281045 14:54241379-54241401 AAGAATAACCTAATGCAGGAGGG - Intergenic
1120288179 14:82532368-82532390 AAGAATGAAGGAAAGCAGGAAGG - Intergenic
1120291855 14:82584306-82584328 AAGGAATAAAAAAAGAAGGAGGG - Intergenic
1125108186 15:35998662-35998684 AAGGATTATGTAAATCAGAATGG + Intergenic
1125219478 15:37317223-37317245 AAGGGTGAACTGAAGCAGGGTGG + Intergenic
1125258840 15:37799005-37799027 AAGGAATAACTAGGTCAGGAAGG - Intergenic
1125573252 15:40737303-40737325 CAGGATTTTCCAAAGCAGGAAGG - Exonic
1127660730 15:61098045-61098067 AAGGATTAAGGAAGGAAGGAAGG - Intronic
1129286771 15:74531862-74531884 TAGGATTAACTACCCCAGGAAGG - Intergenic
1129297930 15:74610026-74610048 AAGCATTATCTAGAGAAGGAAGG - Intronic
1129686297 15:77687935-77687957 AAGGATAAACTGAAGCCCGATGG - Intronic
1131241416 15:90747022-90747044 AAGGATAAATGAAAGCTGGAAGG - Intronic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1134823958 16:17269708-17269730 AAGAATTACCAAAAGCAGGAAGG - Intronic
1135284016 16:21177912-21177934 AAGAATTCACTAATGCAGGCTGG - Intronic
1135584731 16:23660933-23660955 AAGGAAAAACCAAGGCAGGAGGG - Intronic
1135961020 16:26994620-26994642 AAGGAATAAATAAAGCGGGGGGG + Intergenic
1138076793 16:54050531-54050553 AAAGATTATCCAAAGCAGGGTGG + Intronic
1138837519 16:60456734-60456756 AAGGCAGAACTAAACCAGGAAGG - Intergenic
1139001158 16:62511827-62511849 AAGGATTACCTGAAGCTGGGTGG + Intergenic
1140136511 16:72210576-72210598 CAGGAGTAATTAAAGCAGGAGGG - Intergenic
1140816928 16:78629695-78629717 GTTGATTAGCTAAAGCAGGATGG - Intronic
1142576355 17:910966-910988 AAAGATAAGCTAGAGCAGGAAGG - Exonic
1143746018 17:8994697-8994719 AGGGATTAACTAACCCTGGAAGG + Intergenic
1145290312 17:21539503-21539525 AAAGATTACATAAATCAGGAAGG + Intronic
1145757202 17:27401335-27401357 AAGGCTCAACCATAGCAGGAGGG + Intergenic
1146148499 17:30444977-30444999 GAGTGTTAACTAAAGCAGCAGGG + Intronic
1146547967 17:33755449-33755471 AAAGATAAACCAAACCAGGAAGG - Intronic
1146616552 17:34361493-34361515 GAGGTTTAACAAAAGCATGAGGG - Intronic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1151275419 17:73030456-73030478 AAGGAAAAAAGAAAGCAGGAAGG + Intronic
1153405251 18:4731307-4731329 AAGCAATAACTACAGCAGGGCGG + Intergenic
1153731154 18:8013246-8013268 AAGGGTTAACTAAAACAGATTGG - Intronic
1155423759 18:25684678-25684700 AAGGAAAAACCAAAGCAGGTGGG + Intergenic
1155680579 18:28481399-28481421 AAGGATCAACTAAACCAAAATGG + Intergenic
1156472287 18:37384792-37384814 AAGGAGCAGATAAAGCAGGAGGG - Intronic
1156635188 18:39019554-39019576 AAGGATCAAGAAAGGCAGGAAGG - Intergenic
1158136922 18:54218303-54218325 CAGGATTATTTAAAGCTGGAGGG + Intronic
1158775900 18:60578820-60578842 AAGAATTAAACACAGCAGGAAGG + Intergenic
1162782919 19:13016240-13016262 AAGGACTAAGCAAAGCAGGCTGG - Intronic
928058096 2:28078912-28078934 AATGATTAACGAAGGAAGGATGG - Intronic
928670146 2:33594843-33594865 TAGGTTTACCTACAGCAGGAAGG + Intronic
929335916 2:40745418-40745440 CAAAATTAACTAATGCAGGATGG - Intergenic
930917162 2:56706885-56706907 AAGAATCAACTAAAGCAGAAAGG - Intergenic
933026976 2:77271736-77271758 AAGTGGTAACTAAAACAGGAAGG - Intronic
934874969 2:97909227-97909249 AAGGATTAAAAAAAGCAGTGTGG + Intronic
935606139 2:104973898-104973920 AATGATTAATTAAAACAGTATGG + Intergenic
935819243 2:106877697-106877719 AAGGATTAATGAATGCAGTAAGG - Intronic
935893603 2:107708441-107708463 AGGAATAAACAAAAGCAGGATGG + Intergenic
936972933 2:118192076-118192098 AAGGTTGGACTAAACCAGGATGG + Intergenic
939767061 2:146263964-146263986 AAGGATTAACCAAAGTAGAAAGG + Intergenic
940347979 2:152647014-152647036 AAGGATTTTCTTATGCAGGAGGG + Intronic
940372653 2:152920186-152920208 TAGGAATAACAAAAGCAAGAAGG - Intergenic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
941462270 2:165785539-165785561 AAGAATTAAATAAAACAGAAAGG + Intronic
941788250 2:169522485-169522507 AAGGATGAACTAATGAAGGCCGG + Intronic
941854295 2:170214588-170214610 AAGGATTACTAACAGCAGGAAGG + Intronic
943472971 2:188318167-188318189 CAGAATTAAATAAAGCAGAATGG + Intronic
944510896 2:200464971-200464993 AGGGAATATCTAAAGAAGGATGG - Intronic
944635321 2:201670904-201670926 AAGGGTAAACCAAAGCAGGGTGG + Intronic
945684186 2:212949365-212949387 AAGGAATAGCAAGAGCAGGATGG - Intergenic
948738761 2:240029101-240029123 AAGGATTCACTCAAGCAACACGG + Exonic
1168741911 20:199387-199409 ATGGACTAAATAAGGCAGGAGGG - Intergenic
1168857681 20:1020158-1020180 CAGGAGTAACTAAGGCAGGATGG + Intergenic
1169617162 20:7461126-7461148 AAGGACAAACTAATGAAGGAGGG - Intergenic
1174847433 20:53956367-53956389 AAGGAGTAACCAAATCAGCAGGG - Intronic
1175913964 20:62417104-62417126 CAGGATAAACTGAACCAGGAAGG - Intronic
1178181914 21:30171262-30171284 AAGGATTCTCTAATGAAGGAAGG + Intergenic
1178520498 21:33285189-33285211 AAGAAATAACTAAAACTGGATGG - Intronic
1181442042 22:22941757-22941779 AGGGATTATCTGATGCAGGAGGG - Intergenic
1184632500 22:45794179-45794201 GAGGACTAACTAAAACAGGTAGG - Intronic
949102529 3:163250-163272 AAATATTAAGAAAAGCAGGATGG - Intergenic
951392416 3:22122874-22122896 AAAGATGAAGTAAAGCAGTATGG + Intronic
951687679 3:25362767-25362789 AAGGATGAGCCAAAGCAGGGTGG - Intronic
952238884 3:31509348-31509370 GAGGATTAACTTAAGTAGCAGGG + Intergenic
952482914 3:33780326-33780348 AAACATGAACTAAACCAGGAAGG - Intergenic
953256034 3:41291400-41291422 AAAGAATAACGAAAGAAGGAAGG + Intronic
955472437 3:59299744-59299766 AAAGTTGAACTAAAGCAGGTTGG + Intergenic
960303880 3:116037570-116037592 AAGGATTAACTAAATCATTTAGG + Intronic
961050734 3:123744171-123744193 AAGCCTTAACTAAAGCATTACGG + Intronic
961480910 3:127180030-127180052 AAATATTAACAAAAGAAGGAGGG + Intergenic
962348772 3:134641755-134641777 AAGGGGGAAGTAAAGCAGGAAGG - Intronic
963705053 3:148676503-148676525 AAGGAATAAATAAAGCAGAACGG + Intergenic
964999313 3:162932194-162932216 AAGGAGTGACAAAAGCAAGAAGG + Intergenic
966387921 3:179421337-179421359 AAGGATTATCAAAAGGAAGACGG + Intronic
967562741 3:190935318-190935340 GAGGATGAACTGAAGCAGGTGGG - Intergenic
968014890 3:195320456-195320478 AAGGATTAAATAAGGAAGCAAGG - Intronic
968014892 3:195320475-195320497 AAGGATTAAATAAGGAAGCAAGG - Intronic
968191961 3:196675107-196675129 AAAGATTAAATAAGTCAGGAAGG - Intronic
972324546 4:38002990-38003012 AAGGGCTAAATAAAGCAGAAGGG - Intronic
974118341 4:57608096-57608118 AAGGATTAAGTAAATCAGAAGGG - Intergenic
974323624 4:60386317-60386339 AAGGATTATCTAAAGAAAGAGGG - Intergenic
974653346 4:64784210-64784232 AAGGACTAAATAAAGCATGCAGG + Intergenic
975748774 4:77501109-77501131 AGGAATTAAGTAAAGCAGGGTGG - Intergenic
975929314 4:79499591-79499613 CAGGATTAACTAAAGAGAGAAGG - Intergenic
976279062 4:83308677-83308699 AATGATTTACTAAAGCTTGAGGG - Intronic
977374299 4:96181611-96181633 TAGTACTAAATAAAGCAGGATGG + Intergenic
977987604 4:103402429-103402451 AGGAAATAACTAAATCAGGATGG - Intergenic
978655912 4:111065160-111065182 AAGCATAAACTAAGGCAGCAAGG - Intergenic
980221475 4:129922413-129922435 AAGGACAAACTAAAGAAAGAAGG - Intergenic
981689414 4:147490399-147490421 GAAGATTGACAAAAGCAGGAAGG + Intronic
983331468 4:166334038-166334060 GAGGATTAGCCAAAGCAGGGTGG - Intergenic
984186943 4:176556281-176556303 AAGGATTAACAAAAGCAACAAGG - Intergenic
984288503 4:177763672-177763694 AAAGAATCACTATAGCAGGAAGG - Intronic
986153075 5:5145764-5145786 AAGGATGACAGAAAGCAGGATGG - Intronic
986829807 5:11563536-11563558 CCAGATTAACCAAAGCAGGATGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987594342 5:19976898-19976920 AAGGATTAAGTAGAGTAGTATGG + Intronic
987687107 5:21219088-21219110 AAAGCTTAAATAAAGCAGGAGGG + Intergenic
988401712 5:30770093-30770115 AAAGATTAACTTAAGGAGAATGG - Intergenic
988942469 5:36160013-36160035 AAAGATTAAATAATGCAGCAGGG - Intronic
989504016 5:42204293-42204315 AAAGATAAACTAAAGCAGTTTGG + Intergenic
989761208 5:45018892-45018914 AGGGATTAAGTGAAGCAGGAAGG - Intergenic
990118285 5:52416150-52416172 AAGGAATAAAGAAAGAAGGAGGG + Intergenic
991112523 5:62917057-62917079 AAGGATAAACTAAAGAAGGTAGG + Intergenic
992484624 5:77182369-77182391 AAGCATTAACTAAACCAGTCAGG - Intergenic
992678719 5:79131763-79131785 AAGAATAAACTTAAACAGGATGG - Exonic
992844478 5:80731542-80731564 TAGGATTAATGAAAGAAGGAAGG + Intronic
996534604 5:124564488-124564510 GAGGATTCGCTAAAGAAGGAAGG - Intergenic
998078366 5:139254846-139254868 AAGGCTTAACTAGAGCTGGAGGG - Intronic
999953453 5:156674888-156674910 AAGAATTTCCTAAAGCAGAATGG + Intronic
1000240280 5:159402604-159402626 AAGGATGAAGAAAAGCATGAAGG - Intergenic
1000710960 5:164577710-164577732 AAGAAATATCTAAAGTAGGAGGG - Intergenic
1001657188 5:173360658-173360680 AAGGATGGAGTAAAGCAGAAAGG - Intergenic
1005125372 6:22441177-22441199 AAGCATTAACTAGATGAGGAGGG + Intergenic
1006491942 6:34395105-34395127 GAGGCTTAACTAAAGGAGGCTGG + Intronic
1007848767 6:44783146-44783168 AAGGCTTGACTGAAGCTGGATGG - Intergenic
1008117108 6:47564532-47564554 AAGGGTTAAACAAAGAAGGAAGG - Intronic
1008335174 6:50295058-50295080 AAAGTTTCACTGAAGCAGGAAGG + Intergenic
1008763538 6:54882766-54882788 AATCATGAACAAAAGCAGGAAGG - Intronic
1010514620 6:76758534-76758556 AATGATTAAAAAAAGCAGAATGG + Intergenic
1010917793 6:81641999-81642021 AAGAATGAACTGAAGAAGGAAGG + Intronic
1011462733 6:87622518-87622540 AAGGAATATCAAAAGAAGGAGGG + Intronic
1012824841 6:104134696-104134718 ATGGATTAAATCAAGCAGGCAGG - Intergenic
1016783079 6:147981369-147981391 TAGCACTTACTAAAGCAGGATGG + Intergenic
1017604789 6:156122439-156122461 AAGGATAAACTATAGGATGATGG - Intergenic
1017702953 6:157093837-157093859 AATGATAAAATAAGGCAGGAAGG - Intronic
1018132475 6:160745775-160745797 AAGCACTAACTATAGCAAGATGG - Intronic
1018378754 6:163238870-163238892 ATGGATTAACTCAAGTATGAAGG - Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1021151783 7:17160359-17160381 AATGATCAAATAAAGCAAGATGG - Intergenic
1021260892 7:18455931-18455953 AAGGATAAAATAAAGAAGCAAGG + Intronic
1021530863 7:21642999-21643021 ATCGATTAACTAAAGGATGATGG + Intronic
1021790479 7:24199708-24199730 TAGGATTAACTCTAGCTGGATGG - Intergenic
1021849645 7:24795227-24795249 CAGGATTCACTAAAGCCGGCAGG + Intergenic
1021952756 7:25791188-25791210 ATGGATTAGCGAAAGCTGGAGGG - Intergenic
1022076785 7:26979153-26979175 AAGAAATAACAAAAGCAGGCTGG - Intronic
1023045063 7:36203433-36203455 AAGGATAAACTAAACCGGGCAGG - Intronic
1024357909 7:48435218-48435240 AAGAATTAACTTAATCATGAGGG - Intronic
1024961703 7:54983069-54983091 AAGAATTAACTAAAGCTACATGG - Intergenic
1026528376 7:71175541-71175563 GAGGATGAAATAAAGAAGGAAGG + Intronic
1027911584 7:84258879-84258901 AGGGATTATCTAAACCAGAAGGG + Intronic
1028022165 7:85791055-85791077 AAGGGTGAGCCAAAGCAGGAGGG + Intergenic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028090535 7:86695114-86695136 AAGGGATAAATAAATCAGGAAGG - Intronic
1029893603 7:103958108-103958130 AAGGATTAACTAAAGCAGGATGG + Intronic
1030500898 7:110357078-110357100 GAGGATGAACAAAAGCAGGGTGG - Intergenic
1031385705 7:121148390-121148412 AAAGATTAAATAAGGCAAGAAGG - Intronic
1031824089 7:126541358-126541380 AAGTATTAAGAATAGCAGGAAGG + Intronic
1034015882 7:147586033-147586055 AAGGTGAAACTGAAGCAGGAAGG + Intronic
1036936480 8:13007038-13007060 ATTGATTGACTAAATCAGGATGG + Intronic
1037210698 8:16383553-16383575 AAGCAGTAAATAAAGGAGGAAGG - Intronic
1037704483 8:21307661-21307683 AAAGGATAACTTAAGCAGGATGG + Intergenic
1039376471 8:37039429-37039451 GAGAAATAACCAAAGCAGGAAGG + Intergenic
1042760335 8:72265616-72265638 AAGGATTAATAATTGCAGGAGGG - Intergenic
1043787222 8:84418512-84418534 AAGGAGTAAATAAAACAGCATGG - Intronic
1043915838 8:85921219-85921241 AATGATTGAGTAAAGCAGAAAGG + Intergenic
1045395495 8:101756658-101756680 AAGAATTAACTAAAATAAGAGGG + Intronic
1045839269 8:106560855-106560877 GAGGATGAGCAAAAGCAGGATGG + Intronic
1046115956 8:109783399-109783421 AAGGTTTAACTGAAACAGAAAGG - Intergenic
1047825125 8:128565058-128565080 ATGGATTAACTAACTGAGGATGG + Intergenic
1049992313 9:1001624-1001646 CAGGCTGATCTAAAGCAGGAGGG + Intergenic
1050859540 9:10409366-10409388 AAGGATTAACTGGAGAGGGAAGG - Intronic
1053066005 9:35069802-35069824 AAGCATTAACCAAAGTAGGAAGG + Intronic
1053605603 9:39655473-39655495 AATGATTAACTAATTAAGGAAGG - Intergenic
1054247940 9:62686942-62686964 AATGATTAACTAATTAAGGAAGG + Intergenic
1054918887 9:70522251-70522273 ATGGGTTAAATATAGCAGGAAGG - Intergenic
1054947966 9:70816826-70816848 AAAAGTTAACTAAACCAGGATGG + Intronic
1055592169 9:77828439-77828461 AAGGCTTAATTACAGGAGGATGG - Intronic
1055817540 9:80224615-80224637 CAGTATTCACAAAAGCAGGAAGG + Intergenic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1061097773 9:128469696-128469718 AAGGTTTAACAAAAACAGGCCGG + Intronic
1185916684 X:4043401-4043423 AAGCATTAACAAAAACTGGAAGG + Intergenic
1187747795 X:22428694-22428716 AAGGATGAAAAAAGGCAGGAAGG - Intergenic
1188044879 X:25414023-25414045 GAGGGTTAGCCAAAGCAGGACGG - Intergenic
1189504041 X:41593306-41593328 AAGTAAGAACTGAAGCAGGAGGG + Intronic
1191064109 X:56329718-56329740 ATGAATGAACTAAAGCAAGAAGG - Intergenic
1192249673 X:69401398-69401420 AAGGAGTAATAAAAGAAGGAAGG - Intergenic
1193596284 X:83450564-83450586 ATGAATTAAGTAAAGCAGCAGGG - Intergenic
1195721155 X:107870216-107870238 AATGTTTAACAAAAGCAGCAGGG - Intronic
1197489747 X:127102390-127102412 AAGGATGAGCCAAAGCAGGGTGG + Intergenic
1198241993 X:134796478-134796500 AAGGATGAAGGAAAGAAGGATGG + Intronic
1199150465 X:144478962-144478984 AAGAATTAGCTAATGGAGGACGG + Intergenic
1202170553 Y:22039172-22039194 AATGTTTGACTAAAGTAGGAAGG + Intergenic
1202220811 Y:22547201-22547223 AATGTTTGACTAAAGTAGGAAGG - Intergenic
1202322302 Y:23648462-23648484 AATGTTTGACTAAAGTAGGAAGG + Intergenic
1202548468 Y:26021594-26021616 AATGTTTGACTAAAGTAGGAAGG - Intergenic