ID: 1029899336

View in Genome Browser
Species Human (GRCh38)
Location 7:104022619-104022641
Sequence CAGGATGACCAGCTGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029899329_1029899336 7 Left 1029899329 7:104022589-104022611 CCCTGGGCTCAGCCAGAGCTGAG No data
Right 1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG No data
1029899327_1029899336 17 Left 1029899327 7:104022579-104022601 CCCATAAAAGCCCTGGGCTCAGC 0: 27
1: 73
2: 217
3: 301
4: 591
Right 1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG No data
1029899324_1029899336 26 Left 1029899324 7:104022570-104022592 CCTCTAGGGCCCATAAAAGCCCT No data
Right 1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG No data
1029899323_1029899336 27 Left 1029899323 7:104022569-104022591 CCCTCTAGGGCCCATAAAAGCCC No data
Right 1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG No data
1029899333_1029899336 -5 Left 1029899333 7:104022601-104022623 CCAGAGCTGAGCTGGTATCAGGA No data
Right 1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG No data
1029899330_1029899336 6 Left 1029899330 7:104022590-104022612 CCTGGGCTCAGCCAGAGCTGAGC No data
Right 1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG No data
1029899328_1029899336 16 Left 1029899328 7:104022580-104022602 CCATAAAAGCCCTGGGCTCAGCC 0: 65
1: 121
2: 262
3: 300
4: 619
Right 1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG No data
1029899322_1029899336 28 Left 1029899322 7:104022568-104022590 CCCCTCTAGGGCCCATAAAAGCC No data
Right 1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029899336 Original CRISPR CAGGATGACCAGCTGCAGGG AGG Intergenic
No off target data available for this crispr