ID: 1029906009

View in Genome Browser
Species Human (GRCh38)
Location 7:104094014-104094036
Sequence TTCAGCCAAGTCTCCAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029906009_1029906014 26 Left 1029906009 7:104094014-104094036 CCTAAATTGGAGACTTGGCTGAA No data
Right 1029906014 7:104094063-104094085 ACAAGATGAATGCCCAGGGTTGG No data
1029906009_1029906011 21 Left 1029906009 7:104094014-104094036 CCTAAATTGGAGACTTGGCTGAA No data
Right 1029906011 7:104094058-104094080 TCCAGACAAGATGAATGCCCAGG No data
1029906009_1029906013 22 Left 1029906009 7:104094014-104094036 CCTAAATTGGAGACTTGGCTGAA No data
Right 1029906013 7:104094059-104094081 CCAGACAAGATGAATGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029906009 Original CRISPR TTCAGCCAAGTCTCCAATTT AGG (reversed) Intergenic
No off target data available for this crispr