ID: 1029906767

View in Genome Browser
Species Human (GRCh38)
Location 7:104100645-104100667
Sequence CTCTAGTGAAGGAGATGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029906767_1029906772 0 Left 1029906767 7:104100645-104100667 CCTGGTCATCTCCTTCACTAGAG No data
Right 1029906772 7:104100668-104100690 GAAGCACCTACAGCCAAGGGTGG No data
1029906767_1029906773 1 Left 1029906767 7:104100645-104100667 CCTGGTCATCTCCTTCACTAGAG No data
Right 1029906773 7:104100669-104100691 AAGCACCTACAGCCAAGGGTGGG No data
1029906767_1029906771 -3 Left 1029906767 7:104100645-104100667 CCTGGTCATCTCCTTCACTAGAG No data
Right 1029906771 7:104100665-104100687 GAGGAAGCACCTACAGCCAAGGG No data
1029906767_1029906770 -4 Left 1029906767 7:104100645-104100667 CCTGGTCATCTCCTTCACTAGAG No data
Right 1029906770 7:104100664-104100686 AGAGGAAGCACCTACAGCCAAGG No data
1029906767_1029906774 2 Left 1029906767 7:104100645-104100667 CCTGGTCATCTCCTTCACTAGAG No data
Right 1029906774 7:104100670-104100692 AGCACCTACAGCCAAGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029906767 Original CRISPR CTCTAGTGAAGGAGATGACC AGG (reversed) Intergenic
No off target data available for this crispr