ID: 1029907924

View in Genome Browser
Species Human (GRCh38)
Location 7:104111031-104111053
Sequence TTTCAAATGCTGACAGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029907924_1029907927 11 Left 1029907924 7:104111031-104111053 CCTCTCACTGTCAGCATTTGAAA No data
Right 1029907927 7:104111065-104111087 CCATGACAACTGAACCCCACAGG No data
1029907924_1029907928 12 Left 1029907924 7:104111031-104111053 CCTCTCACTGTCAGCATTTGAAA No data
Right 1029907928 7:104111066-104111088 CATGACAACTGAACCCCACAGGG No data
1029907924_1029907929 22 Left 1029907924 7:104111031-104111053 CCTCTCACTGTCAGCATTTGAAA No data
Right 1029907929 7:104111076-104111098 GAACCCCACAGGGTCCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029907924 Original CRISPR TTTCAAATGCTGACAGTGAG AGG (reversed) Intergenic
No off target data available for this crispr