ID: 1029909488

View in Genome Browser
Species Human (GRCh38)
Location 7:104130313-104130335
Sequence ATATAGAGACTACAGTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029909488_1029909491 -1 Left 1029909488 7:104130313-104130335 CCTTTCCACTGTAGTCTCTATAT 0: 1
1: 0
2: 0
3: 10
4: 201
Right 1029909491 7:104130335-104130357 TCCTCTATCTCTTCAAGGAATGG 0: 1
1: 0
2: 1
3: 21
4: 269
1029909488_1029909493 17 Left 1029909488 7:104130313-104130335 CCTTTCCACTGTAGTCTCTATAT 0: 1
1: 0
2: 0
3: 10
4: 201
Right 1029909493 7:104130353-104130375 AATGGTTATTTTCCCCTTCCAGG No data
1029909488_1029909490 -6 Left 1029909488 7:104130313-104130335 CCTTTCCACTGTAGTCTCTATAT 0: 1
1: 0
2: 0
3: 10
4: 201
Right 1029909490 7:104130330-104130352 CTATATCCTCTATCTCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029909488 Original CRISPR ATATAGAGACTACAGTGGAA AGG (reversed) Intronic
900737357 1:4307530-4307552 ATGCAGAGACTACAGGGAAAAGG - Intergenic
901329984 1:8399478-8399500 AAATAGAGACGTCAGTGTAATGG - Intronic
901365241 1:8742072-8742094 ATATACATACTACACTGGGATGG - Intronic
906913419 1:49982108-49982130 AAATAGTGAATACAGTTGAATGG + Intronic
907100495 1:51829601-51829623 AAGTAGAGACAACAGTTGAAGGG - Intronic
908719289 1:67107068-67107090 ATACAGAAACTATAGTGCAAAGG + Intronic
910157629 1:84237525-84237547 AAATAGAGAGTAAAATGGAATGG - Exonic
910734463 1:90437255-90437277 TTTTAGAGGCTACAGAGGAAAGG - Intergenic
911894760 1:103418313-103418335 ATATATAGAGTAAAGAGGAAAGG - Intergenic
912753667 1:112306540-112306562 ATTTAGAGAGTACAGAGGCAGGG - Intergenic
912962760 1:114210546-114210568 ATATGGAAAATCCAGTGGAAGGG - Intergenic
913398586 1:118401133-118401155 ATATAGAGAGTATAGGGTAAGGG - Intergenic
916197530 1:162238350-162238372 GGATAGAGTCTACAGGGGAAGGG + Intronic
916222837 1:162461769-162461791 ATAAAAAGGCTACAGTTGAAAGG + Intergenic
916309274 1:163376552-163376574 TTATAGAGAGCACAGTGTAATGG + Intergenic
917191808 1:172426070-172426092 TTATAGAGGAGACAGTGGAAGGG - Intronic
918250039 1:182694983-182695005 ATATACACACTACAGTGCATTGG + Intergenic
919108943 1:193192589-193192611 AAATAGGGACTTCAGTGTAAAGG + Intronic
921354685 1:214274973-214274995 AAATAGAGAATACACTAGAAGGG - Intergenic
921920445 1:220663182-220663204 TTATAGATATTACAGTGGCAGGG - Intronic
923902693 1:238345453-238345475 ATATATGGAACACAGTGGAAGGG - Intergenic
924399625 1:243664771-243664793 ATGTAGATACTCCAGAGGAAAGG - Exonic
924906480 1:248458672-248458694 AAATAGAGAATACAGTTGTAAGG + Intergenic
924921407 1:248633355-248633377 AGATAGAGAATACAGTTGTAAGG - Intergenic
1064118059 10:12595776-12595798 ATAAAGAGACCACAGAAGAAAGG + Intronic
1066170914 10:32844241-32844263 ACATAAAAACTCCAGTGGAAAGG + Intronic
1066660295 10:37732341-37732363 AAATAGACAATAAAGTGGAAGGG - Intergenic
1068967965 10:62932832-62932854 ATATAGAAACTACAATAGAGAGG - Intergenic
1070093995 10:73318330-73318352 ATATATAGAAAACATTGGAAAGG - Intronic
1071865594 10:89727165-89727187 ATAGAGTGACTACTGTGGAGTGG + Intronic
1072397322 10:95058074-95058096 ATATAGACACTGCAGTCAAATGG - Intronic
1072988711 10:100168388-100168410 ATATAAGGATTACAGTGGAATGG + Intronic
1080485310 11:32700449-32700471 ATAGAAACACTGCAGTGGAATGG + Intronic
1081072947 11:38632577-38632599 ATATGCAGACTTCAGTTGAATGG + Intergenic
1081307340 11:41529635-41529657 ATACTGAGAATACAGTGTAAAGG + Intergenic
1084290225 11:68160197-68160219 ATATAAAGAATAAAGTTGAATGG + Intronic
1084292085 11:68179170-68179192 ATACTGACAATACAGTGGAAGGG + Intronic
1086539400 11:87889881-87889903 ATACAGAGAATACAGAGGAGAGG - Intergenic
1088855834 11:113752723-113752745 AGATAGAGACATGAGTGGAAAGG - Intronic
1089227951 11:116942528-116942550 AGACAGAGACTACAGAGCAATGG + Intronic
1093816337 12:23553018-23553040 AAAAAGAGACTTCAGTGGAGTGG - Intronic
1095805699 12:46317959-46317981 ATAAAGTTACTATAGTGGAATGG + Intergenic
1096899754 12:54864174-54864196 ATACAGAGACTACAGTAATATGG + Intergenic
1097748123 12:63322047-63322069 ATAGAGAGACCACAGAAGAAAGG + Intergenic
1100132745 12:91516802-91516824 ATGCAGAGACTCCAGTGGATAGG - Intergenic
1103140145 12:118541104-118541126 AGATAGAGACGCCACTGGAAGGG - Intergenic
1103782417 12:123407842-123407864 ATTTAAATACTACAGTGAAAAGG - Exonic
1104062901 12:125282899-125282921 ATATAAGGACCACATTGGAATGG - Intronic
1105217703 13:18298871-18298893 ATTTAAATACTACAGTGAAAAGG - Intergenic
1105463465 13:20614060-20614082 ATATAAAGTCTACAATGCAATGG - Intronic
1105872002 13:24513326-24513348 GAGTAGAGAATACAGTGGAAAGG + Intergenic
1106086317 13:26545205-26545227 ATTTTGCTACTACAGTGGAAGGG - Intergenic
1106872922 13:34041260-34041282 AAGTAGAGACCACAGTGGGATGG + Intergenic
1107165172 13:37275474-37275496 ATATAGAGACTGGATTGGAGGGG - Intergenic
1107509102 13:41063655-41063677 AAAGACAGACTACACTGGAAGGG - Intronic
1109836134 13:67859401-67859423 ATATATAGAATACAGTGATATGG + Intergenic
1110200031 13:72839104-72839126 ATGTAGAGAATAGATTGGAATGG + Intronic
1111429029 13:88127890-88127912 ATATGGAGATTACATTGGCAGGG + Intergenic
1112088788 13:96059661-96059683 ATACTGAGTCTAAAGTGGAATGG - Intergenic
1112951931 13:105008900-105008922 ATATAGAAACCACAGTGTCAAGG + Intergenic
1115507888 14:34110211-34110233 ATCTAGAATCTTCAGTGGAAGGG + Intronic
1120029170 14:79620878-79620900 AGATAGAGACAAAAGTTGAAGGG + Intronic
1120886976 14:89459508-89459530 ATCTAGAGCCTGCAGTGGACTGG + Intronic
1122007616 14:98718418-98718440 ATATAAAGTCTAGTGTGGAAAGG + Intergenic
1123630086 15:22255124-22255146 ACATAGAGACTTCGGGGGAAAGG - Intergenic
1124870204 15:33533855-33533877 TTATAAAGGATACAGTGGAATGG - Intronic
1136604639 16:31325151-31325173 ATGAAGAGACAACAGTGGAGGGG - Intronic
1140318095 16:73919233-73919255 ATATATAGACTTGAGGGGAAAGG - Intergenic
1141973008 16:87495533-87495555 ACATAGAGACTTCGGGGGAAAGG + Intergenic
1146118712 17:30169125-30169147 AGATATAGTCTACATTGGAAAGG + Intronic
1149115152 17:53085109-53085131 ATATAGTCAGTACAGTGGATTGG + Intergenic
1151812249 17:76451590-76451612 AGACAAAGACTACAGAGGAACGG - Intronic
1155015532 18:21835292-21835314 GTATAGAGAATAGAGTGGAAAGG + Intronic
1156660078 18:39336285-39336307 AAAAAGAGACTCCAGTGGACAGG + Intergenic
1157402299 18:47398684-47398706 AGATGGAGACTGCAGTGCAAGGG - Intergenic
1158121294 18:54051104-54051126 GTATAAAGACAACGGTGGAATGG - Intergenic
1159113826 18:64090674-64090696 AAAGAGAGACTGCAGAGGAAAGG - Intergenic
1159688193 18:71449873-71449895 ATAAAGAGACTACAATGGGGGGG - Intergenic
1164354508 19:27404795-27404817 ATTTTGAGCCTACAGTGAAAAGG - Intergenic
1168057481 19:53871264-53871286 CTAGAGAGAGTTCAGTGGAAGGG + Intronic
925665837 2:6254789-6254811 ATTTAGTGAATAAAGTGGAATGG - Intergenic
925883772 2:8376419-8376441 ATAAAGAGAGGACAGTGAAAAGG - Intergenic
927262838 2:21111372-21111394 ATTTCCAGACTACAGTGCAAGGG - Intergenic
927384074 2:22512902-22512924 ATATAAAGAATACAGAGGTAAGG + Intergenic
928133437 2:28670148-28670170 TCATAGAGACAACAGTCGAATGG + Intergenic
929433013 2:41904503-41904525 TTATAGAGACTAGGGTGGGAGGG + Intergenic
929891146 2:45919454-45919476 ATAAACACACTTCAGTGGAAAGG - Intronic
930794303 2:55371636-55371658 ATATAATAATTACAGTGGAATGG - Intronic
931379901 2:61742978-61743000 ATATAGACCCCGCAGTGGAATGG + Intergenic
932949204 2:76272887-76272909 ATATAGAGACAAGTGTGGCACGG - Intergenic
933152021 2:78927023-78927045 CTTTAGAGAACACAGTGGAAAGG + Intergenic
934038339 2:88107539-88107561 ATATGGAGTCTACAGAGGCAGGG + Intronic
934296605 2:91747779-91747801 ATTTAAATACTACAGTGAAAAGG + Intergenic
935027422 2:99290673-99290695 AGATAGAGACTTCTGGGGAATGG - Intronic
935791008 2:106590182-106590204 ACATAAAGACAACAGAGGAATGG - Intergenic
936459796 2:112705098-112705120 CTATAGAGACTACAGAGGAGTGG - Intergenic
936690117 2:114876922-114876944 AGAGAGAGACTGCAGAGGAAAGG - Intronic
937317704 2:120942387-120942409 AGACAGAGACTACAGGGAAATGG - Intronic
939940098 2:148339060-148339082 ATATAGACACCACAGTGTGAAGG + Intronic
943171038 2:184400595-184400617 ATATAAAGACTACAGTGCTGTGG - Intergenic
943569559 2:189556972-189556994 GTAAAGACACTCCAGTGGAAAGG - Intergenic
945814591 2:214588896-214588918 AAATATAGACAACAGTGTAATGG + Intergenic
946151138 2:217771855-217771877 ATATAGAAACTAGAGAGGGAAGG + Intergenic
946796949 2:223364580-223364602 TTTTAGAGAGTACAGTTGAAGGG + Intergenic
947735888 2:232455208-232455230 ACATAGAGACAGAAGTGGAATGG - Intergenic
1169022852 20:2342443-2342465 ATAAAGAGACTATAGTCCAAAGG + Intergenic
1171160563 20:22918750-22918772 AGATAGAAAGTACAGTAGAAGGG - Intergenic
1171950308 20:31415651-31415673 ATATATATATTACAGTAGAACGG + Intergenic
1172202275 20:33134918-33134940 AAAGAAAGACTACAGTGGGAAGG - Intergenic
1174397314 20:50255251-50255273 ACATAGATGCTCCAGTGGAAAGG - Intergenic
1174742004 20:53023950-53023972 AAACAGTGACTACAATGGAAAGG - Intronic
1178290058 21:31359492-31359514 ACATAGAAAATACAGTGAAAGGG + Intronic
1183104919 22:35608797-35608819 ATATCTAGAAAACAGTGGAACGG + Intronic
1203308047 22_KI270736v1_random:123374-123396 ATAAAAAGAGTGCAGTGGAATGG + Intergenic
1203313540 22_KI270736v1_random:162534-162556 ATAAATGGACTGCAGTGGAATGG + Intergenic
949316125 3:2757505-2757527 CTTGAGAGACCACAGTGGAACGG - Intronic
950934742 3:16827114-16827136 ATATATAAAATACAGTAGAAAGG + Intronic
951038202 3:17957519-17957541 ATATAGAGAGAATAGTGTAATGG + Intronic
951179227 3:19639444-19639466 ATATCAAGACTATAGTAGAATGG + Intergenic
951897768 3:27626759-27626781 AAATAGCCACTACACTGGAATGG + Intergenic
951963019 3:28349394-28349416 AAACAGAGGCTACAGAGGAACGG - Intronic
952779424 3:37080647-37080669 TTACAGAGAATACAGAGGAAAGG + Intronic
953564898 3:44022933-44022955 ATATAGAAAATACAGTTGAAGGG - Intergenic
955091621 3:55757349-55757371 ATAGAGAGACCAGTGTGGAAGGG - Intronic
955551000 3:60085398-60085420 ATATAGATGCTTCAGTGAAAAGG - Intronic
955870694 3:63435517-63435539 ATACAGAGAAAACAGTGGAGTGG + Intronic
956202785 3:66723518-66723540 TTCTAGAGACTTCAGTAGAAGGG - Intergenic
956203358 3:66730573-66730595 CAATAGAGAATACAGTGAAACGG - Intergenic
959247139 3:103886079-103886101 ACATAGATACTACAGTAGATTGG - Intergenic
963587365 3:147209317-147209339 ATATGGAGAATGCATTGGAAGGG - Intergenic
964257829 3:154797250-154797272 ATATGGAGACTTCATTGGATAGG + Intergenic
964649315 3:158993045-158993067 ATATAGAGACTTCACTGGAGGGG + Intronic
964959424 3:162405062-162405084 ACATAGGGAATAAAGTGGAATGG + Intergenic
965047277 3:163595648-163595670 ATATATTGACTACAGTAGCAGGG - Intergenic
965215971 3:165865204-165865226 ATATAGAGACTTAGATGGAAGGG + Intergenic
965562535 3:170075418-170075440 ATATAGAGAATAATGAGGAATGG + Intronic
969309738 4:6346399-6346421 CTGAAGAGACCACAGTGGAACGG - Intronic
969358096 4:6643035-6643057 ATATAGCGATTACAGTTGCAGGG + Intergenic
970224086 4:13839110-13839132 ACAAAGTGACTACAGAGGAATGG - Intergenic
970879436 4:20911024-20911046 AAAAATAGACTCCAGTGGAATGG + Intronic
973295170 4:48510789-48510811 TTATAAAGACTACATTGGAATGG - Intronic
974113332 4:57550796-57550818 AAATAAAGAGTACAGTGGGATGG - Intergenic
974323550 4:60385573-60385595 ATATGGAGGCTACAGTGGCCAGG - Intergenic
975402730 4:73956228-73956250 AAATAGAGACAAAAGTGCAAAGG - Intergenic
976908847 4:90275041-90275063 AGAAAGAGATTACAATGGAAGGG - Intronic
978608157 4:110504957-110504979 ATATGTAGACAACAGTGGAGCGG + Intronic
979088387 4:116445069-116445091 AAATATATACTACAGTGGCATGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980918115 4:139053482-139053504 ATAAAGATTCTACAGTGCAATGG + Intronic
981310171 4:143290126-143290148 AAATAGAGACTATGGTGAAATGG - Intergenic
982512154 4:156296705-156296727 AGATAGAAACTCCAGTGGAGGGG - Intergenic
983197848 4:164827068-164827090 AAATAGATACTGCAGGGGAAAGG + Intergenic
984182773 4:176505672-176505694 ACATAGAGAATACAGTGAATAGG - Intergenic
988104126 5:26721512-26721534 ATATAAAGACAAAAGTGAAAGGG - Intergenic
990854542 5:60249125-60249147 ATCTAGAAACTTCAGAGGAAGGG - Intronic
990932201 5:61105258-61105280 ATTTAGAGACAACACTGAAATGG - Intronic
991004633 5:61815598-61815620 AAATGGAAACTACAGGGGAAAGG + Intergenic
992587985 5:78261100-78261122 ATATACAGACAACAGTTGAAAGG - Intronic
993491146 5:88551629-88551651 TTATAGAAACTGCACTGGAAGGG - Intergenic
993496032 5:88610175-88610197 ATTTAGAGACTACAGTCCATAGG + Intergenic
996524972 5:124469258-124469280 ATATACAGACCACAGAGGGAGGG + Intergenic
996948993 5:129102289-129102311 CCATAGAGAATACAGTGGCAAGG - Intronic
997959539 5:138309064-138309086 GTACAGAGACTAGAATGGAAAGG - Intronic
999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG + Intronic
1001952111 5:175823624-175823646 ATACAGAGACTATAATGGAGTGG + Intronic
1005231884 6:23711191-23711213 ATCTAGAGAGCACCGTGGAAGGG + Intergenic
1005871954 6:29981028-29981050 ATATGGAGTCTACATTGCAAAGG - Intergenic
1010828314 6:80499256-80499278 TGAAAGAGACTACAGTGGATTGG + Intergenic
1016398762 6:143655429-143655451 ATTTAAAGTATACAGTGGAATGG - Intronic
1018181802 6:161229696-161229718 AAAAAGAGAATACAGTAGAAAGG - Intronic
1022838967 7:34144448-34144470 AGATAGAGAATAAATTGGAAGGG + Intronic
1024393136 7:48837751-48837773 ATACAGAGATTTCAGAGGAAGGG - Intergenic
1026379878 7:69788406-69788428 AAATAGAGGCTTCAGGGGAAGGG + Intronic
1029909488 7:104130313-104130335 ATATAGAGACTACAGTGGAAAGG - Intronic
1032992619 7:137410678-137410700 ATATAGAAAATAAAATGGAAGGG + Intronic
1034683382 7:152948173-152948195 AGATAGAGACTAGAGAGAAAGGG + Intergenic
1036038729 8:5049234-5049256 ATATAAAGACTAGAGAGGCACGG - Intergenic
1038971208 8:32637655-32637677 ATAAAGAAACTACAGAGGATAGG - Intronic
1040812371 8:51469468-51469490 ACATCGAGACTACAATGCAAAGG - Intronic
1041530422 8:58859699-58859721 ATGGAGAGACCACAGTGTAAAGG - Intronic
1042796254 8:72666345-72666367 ATATATAAAATAAAGTGGAAGGG - Intronic
1043143844 8:76625620-76625642 AGAGAGAGACTACAGTTAAATGG - Intergenic
1044079264 8:87863814-87863836 ACATAGAGTCAACACTGGAATGG - Intergenic
1044847162 8:96393135-96393157 ATATGGAGAATACATTGGACAGG - Intergenic
1046173029 8:110537317-110537339 ATATAGAGACAAAAGAGAAATGG + Intergenic
1046762896 8:118039859-118039881 ATAAAGCCACTACAGTAGAAAGG + Intronic
1047173038 8:122513317-122513339 ATGCAGTGACTTCAGTGGAATGG - Intergenic
1051363369 9:16302175-16302197 AGAGAGAGACTACAGAGGAAAGG + Intergenic
1051461016 9:17315621-17315643 ATATATGGAATACAGTGAAAAGG - Intronic
1051745158 9:20288465-20288487 AACTATAGAATACAGTGGAAAGG + Intergenic
1052808354 9:33033728-33033750 ATATAAATACTACAATAGAAGGG + Intronic
1053100488 9:35367689-35367711 ATATCCTGACTACAGTGGAATGG - Intronic
1055122549 9:72678989-72679011 AAATATAGACTTCAGTGGGATGG - Intronic
1055368374 9:75570534-75570556 ATATAAAAACTACAGGGAAAAGG + Intergenic
1055996959 9:82170571-82170593 ATACAGAGAAGACAATGGAAAGG - Intergenic
1057224355 9:93281542-93281564 ATATAGAGATTACAGTGAGATGG + Intronic
1058400090 9:104605619-104605641 AAATAGAGAGTAAAATGGAATGG - Exonic
1186900718 X:14052457-14052479 ATGTTTAGACTACAATGGAATGG + Intergenic
1187701640 X:21969141-21969163 TTATAGAGAGAATAGTGGAAGGG - Intronic
1188430071 X:30096665-30096687 ATATAGAAACTAGAGAGCAAAGG + Intergenic
1188518636 X:31013667-31013689 ACAGAGAGAATACAGAGGAAGGG + Intergenic
1192157481 X:68757336-68757358 CTAGAGAGACTTCATTGGAAAGG + Intergenic
1193361003 X:80578184-80578206 AAATAGAGACTAAAGTCTAATGG + Intergenic
1194337006 X:92660394-92660416 TTATAGAGACTTCATTGGATAGG - Intergenic
1195278509 X:103307694-103307716 ATAGAGAGGCTAGAGTTGAAAGG - Intergenic
1195869599 X:109472342-109472364 ACATACAAAATACAGTGGAAAGG - Intronic
1196560425 X:117140700-117140722 ATTTAAAGACTAAAGTGCAATGG - Intergenic
1197797606 X:130315036-130315058 ATTTAAAGAGTACAGTGCAATGG + Intergenic
1198433903 X:136596568-136596590 ATATAGAGAATGGATTGGAATGG + Intergenic
1200645439 Y:5777130-5777152 TTATAGAGACTTCATTGGATAGG - Intergenic
1201079629 Y:10225960-10225982 CTTTGCAGACTACAGTGGAAAGG - Intergenic
1202086604 Y:21143740-21143762 ATATATTGACTAAAGTTGAAGGG + Intergenic