ID: 1029912030

View in Genome Browser
Species Human (GRCh38)
Location 7:104163344-104163366
Sequence CCCTTTAGTGGCAACTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029912026_1029912030 -3 Left 1029912026 7:104163324-104163346 CCTAGTCTTTCACCTTCTTTCCC 0: 1
1: 0
2: 5
3: 49
4: 567
Right 1029912030 7:104163344-104163366 CCCTTTAGTGGCAACTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029912030 Original CRISPR CCCTTTAGTGGCAACTTCAG AGG Intronic
No off target data available for this crispr