ID: 1029915739

View in Genome Browser
Species Human (GRCh38)
Location 7:104208041-104208063
Sequence GCTGCCGTCACGCCGCAGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029915739_1029915742 14 Left 1029915739 7:104208041-104208063 CCGGGCTGCGGCGTGACGGCAGC 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1029915742 7:104208078-104208100 TCGCCGCCGCTCTAGTCTCAGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1029915739_1029915744 18 Left 1029915739 7:104208041-104208063 CCGGGCTGCGGCGTGACGGCAGC 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1029915744 7:104208082-104208104 CGCCGCTCTAGTCTCAGGGCCGG 0: 1
1: 0
2: 1
3: 4
4: 62
1029915739_1029915741 13 Left 1029915739 7:104208041-104208063 CCGGGCTGCGGCGTGACGGCAGC 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1029915741 7:104208077-104208099 GTCGCCGCCGCTCTAGTCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029915739 Original CRISPR GCTGCCGTCACGCCGCAGCC CGG (reversed) Exonic
900116008 1:1028230-1028252 GCTGCCGTGACCCCACAGCTGGG + Intronic
900561877 1:3311229-3311251 GCTGCCGCCACTCCGAGGCCGGG + Intronic
901203403 1:7479543-7479565 GCTGCCTTCTCCCAGCAGCCAGG - Intronic
902332353 1:15736774-15736796 GCTGGCCTCACGCAGCAACCAGG + Exonic
903907585 1:26697118-26697140 GCCGCCGCCGCGCCGGAGCCCGG - Exonic
906863626 1:49390953-49390975 TCTTCCCTCACACCGCAGCCTGG - Intronic
907865042 1:58391210-58391232 GCTGCCGGCCAGCAGCAGCCAGG + Intronic
913453172 1:119006710-119006732 GCTGTCGGCGCGCCGGAGCCAGG + Intergenic
915107248 1:153542268-153542290 GCTGCAGTCCCACCCCAGCCTGG + Intergenic
916231513 1:162545462-162545484 GCTGCCGTCAGGCCAGGGCCAGG - Intergenic
919916926 1:202144620-202144642 GCTGCCCTCGCGCTGCGGCCCGG + Exonic
924052533 1:240092818-240092840 ACTGCCGTCTCCCCTCAGCCCGG + Exonic
924547628 1:245045049-245045071 GCTGCCATCACACGGCAGCCTGG - Intronic
1063120281 10:3101064-3101086 GCTGCTGTGACACCGCAGGCTGG + Intronic
1066443063 10:35457314-35457336 GCTTCAGTCCCGTCGCAGCCTGG + Intronic
1067091290 10:43266872-43266894 GCCGCCCTCGCGCCGCAGTCGGG + Intronic
1073761085 10:106629475-106629497 GCTGCCATCATGCCTGAGCCAGG - Intronic
1076052601 10:127347448-127347470 GCTGCCTTCACCACCCAGCCGGG - Intronic
1077422801 11:2460851-2460873 GAAGCAGTCACGCCCCAGCCTGG - Intronic
1077479722 11:2807885-2807907 GCTTCCCTCATGCTGCAGCCAGG - Intronic
1077509815 11:2952612-2952634 CCTGGCGCCACGCAGCAGCCAGG + Intronic
1078450458 11:11437023-11437045 GCTCCAGTCCTGCCGCAGCCGGG + Intronic
1083885247 11:65570332-65570354 GCAGCCGACACGCCCCACCCCGG + Intergenic
1089457664 11:118634829-118634851 GCTCCCCTCCCGCCGCTGCCGGG + Intronic
1091345213 11:134847699-134847721 GCTGCTGTCTCTCCGGAGCCAGG + Intergenic
1091752877 12:3033502-3033524 GCTGCCTCCACGGTGCAGCCCGG - Intronic
1095261616 12:40105396-40105418 GCTGCCGTCTCGGCGCTGGCCGG - Exonic
1104553762 12:129780996-129781018 GCTGCTGTCACCCCCCAGCAGGG - Intronic
1104598181 12:130134050-130134072 GCTGCCGGCACACCACAGCTAGG + Intergenic
1104820240 12:131672866-131672888 GCTGGCTTCAGGCCACAGCCCGG + Intergenic
1104953296 12:132451905-132451927 GCTGCCCTCCCACTGCAGCCAGG - Intergenic
1105964414 13:25371960-25371982 CCCGCCCCCACGCCGCAGCCCGG + Intergenic
1113888654 13:113725089-113725111 GCTGCCGTCAGGGTGCAGGCTGG + Intronic
1122736648 14:103847423-103847445 GCTGCCGCCTCGCCGCGGCCGGG - Exonic
1123122686 14:105925356-105925378 GCTGCCATCAGGCCCCACCCAGG + Intronic
1125698838 15:41661789-41661811 GCAGCCGTCACGCCGCCCCCAGG - Intronic
1128934881 15:71737931-71737953 GCAGCCCCCACGGCGCAGCCGGG + Exonic
1129717971 15:77862874-77862896 CCTGCCATCAGGCTGCAGCCGGG + Intergenic
1130223717 15:82043325-82043347 GCTGCCTTTACGCCGAAGCCCGG + Exonic
1132643750 16:989505-989527 GCTGCACTCAAGCCTCAGCCAGG + Intergenic
1132643760 16:989548-989570 GCTGCACTCAAGCCTCAGCCGGG + Intergenic
1132757584 16:1493578-1493600 GCTGCAGTCACCCGGGAGCCGGG + Exonic
1137619742 16:49868418-49868440 GCCGCCGGCGGGCCGCAGCCAGG + Intergenic
1141431269 16:83971400-83971422 GCTGCCTTCGAGCCTCAGCCTGG + Intronic
1142308252 16:89297852-89297874 GCTGAGGTCACGCAGCAGACAGG - Intronic
1146884849 17:36464087-36464109 GCAGCCGCCACTCCCCAGCCTGG - Intergenic
1147962537 17:44176957-44176979 GGAGCCGGCGCGCCGCAGCCTGG - Exonic
1150336627 17:64335016-64335038 GCTGCCGTCACGCTGGGGCCCGG - Intronic
1150650382 17:67006163-67006185 GCTGCCGTGTCGAGGCAGCCAGG + Intronic
1151381044 17:73726003-73726025 GCTGCCATCTGGCAGCAGCCGGG - Intergenic
1152751815 17:82065760-82065782 GCCGCCGCCGGGCCGCAGCCGGG + Intronic
1156171660 18:34493688-34493710 GCTGCGGTCCCTGCGCAGCCGGG - Intronic
1157733295 18:50023366-50023388 ACTGTGGTCACGCCGCAGCTTGG - Intronic
1157738212 18:50069563-50069585 GTTGCCCTCACTCCTCAGCCTGG + Intronic
1158931262 18:62326258-62326280 GCTGCCGTCCCTCCGCAGCCGGG + Intronic
1160769015 19:822040-822062 GCAGCCCAGACGCCGCAGCCAGG + Intergenic
1161162253 19:2767978-2768000 GCCCCCACCACGCCGCAGCCGGG - Intronic
1161357136 19:3825423-3825445 GCGGCCCTCACGCGGGAGCCCGG - Intronic
1161787137 19:6333714-6333736 GCTGCTGTCACTGCACAGCCAGG - Intergenic
1162366418 19:10252285-10252307 GCTGCCGGTAGGCCGAAGCCAGG - Exonic
1162771625 19:12952862-12952884 CCTGCAGTCACCCCTCAGCCAGG - Intronic
1163402377 19:17101875-17101897 GGTGCCGTCCAGCCGCAGGCTGG - Exonic
1164560782 19:29290732-29290754 GCAGCCGGCAGGCCCCAGCCTGG + Intergenic
1166098092 19:40554212-40554234 GCTGGCGTCGCTGCGCAGCCCGG + Exonic
929788108 2:45006307-45006329 GCTGCCGTCCCTGCACAGCCTGG - Exonic
932910816 2:75804595-75804617 CCTTCCTTCACACCGCAGCCAGG + Intergenic
935177709 2:100664130-100664152 CCTGCCCTCACCCCGAAGCCGGG + Intergenic
935956104 2:108378062-108378084 TCTGCTGTGACGCCACAGCCTGG + Exonic
943427061 2:187750228-187750250 GGTGCTGTCACAACGCAGCCAGG - Intergenic
943669865 2:190649089-190649111 GCCGCCCGCGCGCCGCAGCCTGG + Intronic
944582094 2:201140087-201140109 GCCGCTGCCACGCTGCAGCCAGG + Intronic
948479018 2:238239085-238239107 GCTGCCCTCACGCAGCGGCATGG + Exonic
948703545 2:239775745-239775767 GCCGCCGTCACGGGGCAGCACGG + Intronic
948738304 2:240025376-240025398 GCTGCCGTGACGTCACGGCCGGG + Exonic
1170091279 20:12592177-12592199 GCTGCCCTCACAGCCCAGCCAGG + Intergenic
1171213055 20:23331671-23331693 GCTGCAGTCACACCTCAGCCTGG + Intergenic
1171346527 20:24469902-24469924 GCGGGCGCCACGCCGCCGCCGGG - Intronic
1172884549 20:38222475-38222497 GCTGGCATCATGCTGCAGCCTGG + Exonic
1175428879 20:58889251-58889273 CCAGCCGCCGCGCCGCAGCCCGG - Intronic
1175972473 20:62693638-62693660 GATGCAGCCACGCCTCAGCCAGG + Intergenic
1176048058 20:63102827-63102849 GCGCCCCTCACGCTGCAGCCTGG + Intergenic
1176077362 20:63254514-63254536 GCTCCCCACGCGCCGCAGCCTGG + Exonic
1176121704 20:63457003-63457025 GCAGCCGCCACGCTGCAACCTGG + Intronic
1176123750 20:63465939-63465961 GCTGCCGTCCCGAGGCGGCCCGG + Intronic
1176207205 20:63895475-63895497 GCTGCTGCGACGCCGCGGCCTGG + Intronic
1179568054 21:42261357-42261379 GCTCCCGTCACCCCACATCCAGG - Intronic
1179912175 21:44456171-44456193 GCCGCCGCCACTCCGCCGCCCGG + Intronic
1179926524 21:44538102-44538124 GCTGCAGTCACCCCACAGCCAGG - Intronic
1181514283 22:23402433-23402455 GCGCCCGTCTCCCCGCAGCCAGG + Intergenic
1183697393 22:39430969-39430991 GCTGTCGTCAGGCCTGAGCCAGG + Exonic
1184432714 22:44450706-44450728 GCTCCTGTCATCCCGCAGCCTGG - Intergenic
1184523873 22:45010094-45010116 ACTGCCGCCCCGCCGCGGCCCGG + Intergenic
962018637 3:131472007-131472029 GCTGCAGTCAAGCATCAGCCAGG - Intronic
963606725 3:147419147-147419169 CCTCCCGCCACCCCGCAGCCTGG + Intronic
968452444 4:681757-681779 GCCGCCCTCACCCCGCACCCGGG + Intronic
969721298 4:8894226-8894248 GCTCCCGCCGCTCCGCAGCCAGG + Intergenic
981688513 4:147481251-147481273 GCCGCCGCCGCGCCGGAGCCCGG + Exonic
983591183 4:169413209-169413231 CATGCCGTCACGCTCCAGCCTGG - Intronic
987409933 5:17604748-17604770 GCTGCTGTCACGGAGCAGACTGG + Intergenic
988482104 5:31639443-31639465 GCGACCGTCCCGCTGCAGCCGGG + Intronic
997963117 5:138337765-138337787 GCAGCCTTCACGCCGCGGACGGG + Intronic
1002889039 6:1317667-1317689 GCCGCCGTCCCGGCCCAGCCTGG + Intergenic
1003343100 6:5240618-5240640 GCTTCCGTCTCCCCGCAGACAGG + Intronic
1004193873 6:13487273-13487295 GCGGCCGCGCCGCCGCAGCCCGG + Exonic
1015394025 6:132715343-132715365 GCTGCAGTCAAGCAGCTGCCAGG + Intergenic
1017164018 6:151391098-151391120 GCCGCCGACTCGCCGCCGCCTGG + Intronic
1022310930 7:29195038-29195060 ACTGCCCTCGCCCCGCAGCCTGG + Intronic
1026100471 7:67379789-67379811 GCTGCTGTCTCCCCGCACCCAGG - Intergenic
1026915996 7:74120776-74120798 ACTGCAGTCAGGCTGCAGCCAGG + Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029915739 7:104208041-104208063 GCTGCCGTCACGCCGCAGCCCGG - Exonic
1031743793 7:125468434-125468456 GGTGCCGTCACAACCCAGCCTGG - Intergenic
1033366060 7:140673246-140673268 GCTGCGGTGAAGCCGAAGCCCGG - Exonic
1035352738 7:158257891-158257913 GCTGCTGTCACCGCGAAGCCAGG - Intronic
1041719232 8:60961384-60961406 GCTCCCATCACTCTGCAGCCAGG + Intergenic
1042039521 8:64577538-64577560 GCTGACGTCACCCCTCCGCCCGG + Intergenic
1042461547 8:69074772-69074794 TCTGCCATCACACTGCAGCCTGG - Intergenic
1046547446 8:115669138-115669160 GCAGCCGGCTCGCCGCGGCCGGG - Intronic
1048214405 8:132481319-132481341 CCCGCCGTCACGCCCCATCCAGG - Intergenic
1049780847 8:144428190-144428212 GCAGCCGTCACGGAGCCGCCAGG + Intronic
1049803396 8:144528435-144528457 GCTGACTTCTCGCCGCTGCCAGG - Intronic
1057426056 9:94950709-94950731 GCTGCTGCCACGCCTGAGCCAGG - Intronic
1058885780 9:109320500-109320522 GCTGCCGCTGCGCCGCCGCCCGG + Exonic
1060173278 9:121479000-121479022 GCTGCAGCCAAGCTGCAGCCTGG - Intergenic
1189137314 X:38562476-38562498 GGTGACGTCACCCCTCAGCCAGG + Intronic