ID: 1029927578

View in Genome Browser
Species Human (GRCh38)
Location 7:104333719-104333741
Sequence GAGGGTGCCACAAGATAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029927578 Original CRISPR GAGGGTGCCACAAGATAGGA TGG (reversed) Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900613631 1:3554700-3554722 GAGGCTGGCACAGGAGAGGAGGG - Intronic
902386775 1:16080439-16080461 GAGGGTGAAACAGGACAGGAGGG - Intergenic
902637805 1:17746386-17746408 GTGGGGGCCACAAGATCAGATGG - Intergenic
903469429 1:23575566-23575588 GAGGGTGTCACAAGAGTGGAGGG - Intergenic
904969564 1:34408584-34408606 GAGGGGGCAAGAAGAAAGGAAGG - Intergenic
909084444 1:71154858-71154880 TTGGGTGCCACAAGACAGTATGG - Intergenic
912652428 1:111451206-111451228 GATGGTGTCAAGAGATAGGATGG - Intronic
913966775 1:143383306-143383328 AAGGGTGACACGAGACAGGAAGG + Intergenic
914061152 1:144208913-144208935 AAGGGTGACACGAGACAGGAAGG + Intergenic
914117998 1:144757456-144757478 AAGGGTGACACGAGACAGGAAGG - Intergenic
914847668 1:151291774-151291796 AAGGGGGCCACAGGAGAGGAGGG + Exonic
917561573 1:176163125-176163147 TAGGGAGCCACTAGCTAGGAAGG - Intronic
918110208 1:181449026-181449048 GAGGGTGCAAGGAGATAGGATGG + Intronic
919416637 1:197318815-197318837 GTAGTTGCCACAAGATAGGGAGG + Intronic
919806120 1:201381949-201381971 AAGGGGGCCACTGGATAGGAAGG + Intronic
920191592 1:204197258-204197280 GTGGGTGCCACGAGACAAGAAGG - Intergenic
922188291 1:223295485-223295507 GAGTGTGCCATAATAGAGGATGG + Intronic
1065583080 10:27191281-27191303 GTGGTTGCCAGAAGTTAGGAGGG + Intergenic
1069399157 10:68023531-68023553 GTGGTTGCCACAAGAGAGTATGG + Intronic
1070752941 10:78974480-78974502 GAGGGTAGCAAAAGAGAGGAGGG - Intergenic
1071665798 10:87557002-87557024 GAGGCTGCCACATGAATGGAAGG - Intergenic
1074165682 10:110872084-110872106 GAGGCAGCCGCAAGATGGGAGGG + Intronic
1077504460 11:2923687-2923709 GAGGATGGCACAGGAGAGGAAGG + Intronic
1080305299 11:30828602-30828624 GAGGGTGCCAGAAGACTTGAAGG - Intergenic
1082013534 11:47467307-47467329 GATGGTGCCACAAGAGAGGAGGG + Intronic
1083201073 11:61121438-61121460 GAGGGTGCCAGAAGGAGGGAAGG + Intronic
1083287727 11:61671176-61671198 GAGAGTGGCACGAGATAGGGTGG + Intergenic
1086799130 11:91149709-91149731 GTGGTTGCCAGAAGCTAGGAAGG - Intergenic
1087929852 11:103964604-103964626 AAGGGTGCCACAGGGTAGGTAGG - Intronic
1088742654 11:112779580-112779602 CAGTGTGACACAAGATAGCAAGG + Intergenic
1089402839 11:118174473-118174495 GAGGATGCCACAAGTGACGAGGG - Intronic
1090693324 11:129208999-129209021 GAGTATGCCACAAGAAAGAATGG + Intronic
1095521978 12:43077447-43077469 GAGGTTGCCAGAGGTTAGGAAGG + Intergenic
1096464816 12:51842444-51842466 GAGGGAGCCGCATGATATGAGGG + Intergenic
1096647900 12:53048183-53048205 GCGAGTGCCACAGGATGGGAGGG + Intronic
1098044977 12:66391079-66391101 GAGAGTGACACAACATAGGCAGG + Intronic
1098073486 12:66700765-66700787 CAGGGAGCAACAAGACAGGAGGG + Intronic
1098682174 12:73369966-73369988 GAGGGAGACAGAAGAAAGGATGG + Intergenic
1099731752 12:86512756-86512778 GTGGTTGCCAGAAGATAAGAGGG + Intronic
1101710166 12:107257468-107257490 GGGGGGACCACAACATAGGATGG - Intergenic
1102412133 12:112729243-112729265 GTGTGTGCCACCAAATAGGAGGG - Intronic
1102641155 12:114367676-114367698 GGGGGTGCTTCAAGATAGAAGGG + Intronic
1103864660 12:124042293-124042315 GGGGGTTCCCCCAGATAGGAGGG + Intronic
1107518674 13:41157909-41157931 GAGGGTGGCAAGAGAAAGGAGGG + Intergenic
1108315369 13:49231745-49231767 TAGGATGGCACAAGAGAGGAAGG + Intergenic
1113877019 13:113601093-113601115 GATGGTGCCACCACAGAGGAGGG - Intronic
1117203965 14:53421494-53421516 GAAGAAGCCACAAGATAGAATGG - Intergenic
1119362959 14:74067147-74067169 GAGGCTGCCATGAGCTAGGATGG + Intronic
1119729456 14:76941838-76941860 GCAGCTGCCACTAGATAGGAAGG - Intergenic
1120829880 14:88988308-88988330 GATGGAGCCACAAGATGGAAGGG - Intergenic
1121102237 14:91257782-91257804 GATGGTGCCACACGGTGGGACGG - Intergenic
1123034838 14:105467666-105467688 GAGGGTGCCCCAGGAAAGGAGGG - Intronic
1127539107 15:59919745-59919767 GAGGCTGTTACAAGAGAGGATGG - Intergenic
1128730786 15:70019518-70019540 GGAGGTGGCACAAGCTAGGAGGG + Intergenic
1129942273 15:79508819-79508841 GAGGATGCCAAGAGGTAGGAAGG - Intergenic
1130371025 15:83285074-83285096 GAGGGCGCCCCAGGGTAGGAGGG - Intergenic
1131844626 15:96476046-96476068 GTGGTTGCCACAAGCTAGAAGGG - Intergenic
1132785510 16:1655112-1655134 GAGGGTGCCAAAAGAGACAAGGG - Intronic
1133378285 16:5307736-5307758 GAGGTTGCCGTAAGATATGATGG - Intergenic
1133632060 16:7630778-7630800 GAGAGAGCCACAAGAGAGGGTGG - Intronic
1135567525 16:23523359-23523381 GAGAAAGCCACAAAATAGGAAGG + Exonic
1135605306 16:23819378-23819400 GAGGATGGCAGAAGATGGGAAGG - Intergenic
1137010319 16:35314543-35314565 CAGGGTCCCACAAGAGAGGCTGG - Intergenic
1137067617 16:35864581-35864603 GTGGTTGCCAGAGGATAGGAAGG - Intergenic
1138693965 16:58793929-58793951 GAGGGTTCCAAAAGATGGGAGGG - Intergenic
1139474632 16:67196903-67196925 GAGGATACCAGAGGATAGGAGGG - Intronic
1143415953 17:6750406-6750428 GAGGGTGGTATGAGATAGGAAGG - Intergenic
1145776872 17:27535177-27535199 GCTGGCGCCACAACATAGGATGG + Intronic
1148197776 17:45727075-45727097 CAGGATGCCACAAGATGGGTTGG + Intergenic
1153089764 18:1330521-1330543 GATGGTTCCACACGATAGGCAGG + Intergenic
1157090002 18:44625874-44625896 GAGGTTCACACAAGGTAGGAAGG + Intergenic
1157410804 18:47461473-47461495 GAGGCCACCAGAAGATAGGAAGG - Intergenic
1159895201 18:73989652-73989674 GAGGGTCCCATAAGATATGCAGG + Intergenic
1166197251 19:41215348-41215370 GAGGCTGCAACAAGCTATGATGG - Intergenic
1202700559 1_KI270712v1_random:160801-160823 AAGGGTGACACGAGACAGGAAGG + Intergenic
925449194 2:3953695-3953717 GATGGTCCCACAATGTAGGAAGG - Intergenic
928429293 2:31204661-31204683 GAGGGTGCCACAACCAGGGAGGG + Intronic
928568347 2:32577008-32577030 GGGGGGGCCACAAGATAGGAGGG - Intronic
930965539 2:57319605-57319627 GAGGGTGGAACATGAGAGGAGGG + Intergenic
933741295 2:85536392-85536414 GAGGGAGAGACAAGAAAGGAAGG - Intergenic
937845497 2:126574405-126574427 GAGGATCCCACAAGAGTGGAAGG - Intergenic
938505253 2:131873396-131873418 GATGGTGCCACATAACAGGAGGG - Intergenic
938777754 2:134556926-134556948 TTGGGTGCCACAGGAAAGGATGG + Intronic
939843261 2:147213964-147213986 AAGGGTTCCAAAACATAGGAAGG - Intergenic
940809874 2:158230450-158230472 GAGGGTGCAACAGCATTGGATGG + Intronic
945195632 2:207234879-207234901 GAGGGTCCCAGAAGAAAGCAGGG + Intergenic
945371116 2:209018974-209018996 GAGGGTGACAAAAGATAACAAGG - Intergenic
945998680 2:216462534-216462556 GAGCGTGATACAAAATAGGAGGG + Intronic
946890631 2:224272372-224272394 GAGGGTGCCACAAAGTAGCAGGG + Intergenic
947285355 2:228507804-228507826 GAGGGTGCCACAATTTCTGAAGG + Intergenic
947296556 2:228636781-228636803 GTGGGTCTCACAAGATACGATGG - Intergenic
947380818 2:229543729-229543751 GGAGGTGCCAGAAGAGAGGAAGG - Intronic
1174842173 20:53911003-53911025 GAGTGAGCCACCAGAAAGGAGGG + Intergenic
1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG + Intronic
1180024362 21:45150957-45150979 GAGGGTGCCATGAGTCAGGAGGG + Intronic
1181775318 22:25154963-25154985 GAGGGTGTGACAAGACAGGTGGG - Intronic
1181809163 22:25392977-25392999 GAGGATGGCTCACGATAGGAGGG - Intronic
1183242093 22:36665279-36665301 CAGGGTCACACAACATAGGAAGG - Intronic
1183378420 22:37478592-37478614 GAGGGTGCCCCAGGAGGGGAAGG + Intronic
949615654 3:5751305-5751327 GACCTTGCCACAAGAAAGGAGGG - Intergenic
949872871 3:8604200-8604222 GAGTGTGTCCCAAGGTAGGATGG - Intergenic
951849872 3:27127163-27127185 GAGAGTGAGACAAGGTAGGAAGG - Intronic
952845442 3:37684254-37684276 GAGGATTCCACAAGAGAGAAGGG - Intronic
956208030 3:66774023-66774045 GAGTGTGCCCCATGATGGGAAGG - Intergenic
956954670 3:74322969-74322991 GTGGTTGCCAGAAGTTAGGAGGG + Intronic
958525076 3:95246727-95246749 ATGGGTCTCACAAGATAGGACGG + Intergenic
959455582 3:106556936-106556958 GAGGTGGCCAGAAGATAGAAAGG - Intergenic
960884483 3:122380807-122380829 AAAAGTGCCAGAAGATAGGAAGG + Intronic
961210390 3:125120755-125120777 GAGGGTCCCGCAGGAGAGGAAGG - Intronic
961370343 3:126424788-126424810 GAGGGTGACAGCAGATGGGAGGG + Intronic
965585584 3:170314940-170314962 GAGGGAACCACTAGATAAGATGG - Intergenic
971267863 4:25110810-25110832 GAGGGAGTCAAAAGGTAGGAAGG + Intergenic
974180604 4:58379834-58379856 GTGGGGGCAACAAGATAGGCAGG + Intergenic
976266355 4:83189092-83189114 GAGGGTGGCAAAAGGAAGGAGGG + Intergenic
977077468 4:92474180-92474202 GATGGTACCAGGAGATAGGAGGG - Intronic
980786461 4:137562547-137562569 GAGGGTGCTGGAAGAGAGGATGG - Intergenic
986230571 5:5861004-5861026 GAGAGTCCCACAAGATCTGATGG + Intergenic
988288390 5:29251801-29251823 GAAGGAGGCACAAGAGAGGAGGG - Intergenic
988991641 5:36677257-36677279 GAAGGTGCCACGAGGCAGGATGG + Intronic
992175092 5:74142229-74142251 GAGTGTGCCCTGAGATAGGATGG - Intergenic
999126148 5:149247631-149247653 ATGGGTGCCACAAGGTGGGAGGG + Intronic
1000265646 5:159633692-159633714 GAGGGTGACAGAAGAAAGGCTGG - Intergenic
1000369278 5:160519462-160519484 GTGGGAGCCAGAAGAGAGGAAGG - Intergenic
1001368375 5:171168897-171168919 GAGGGTGACAGAAGGCAGGAAGG - Intronic
1002865764 6:1121103-1121125 GAGGCTGCCATAAGCTATGACGG + Intergenic
1004368333 6:15030748-15030770 GAGGGGGCCACAAGATCAGATGG + Intergenic
1008283401 6:49622194-49622216 GTGGGTGTCACAAGATCTGATGG + Intronic
1011381932 6:86751288-86751310 GAAGGTGCCAGAAGCTAAGATGG + Intergenic
1013023581 6:106245576-106245598 GAGGCTTCAACAAGATAAGATGG + Intronic
1015195174 6:130517841-130517863 GAGGGTGCCAGCAGGTAGGATGG + Intergenic
1019381809 7:727742-727764 GAGGATGGCACAGGATAGGCAGG - Intronic
1029927578 7:104333719-104333741 GAGGGTGCCACAAGATAGGATGG - Intronic
1030828315 7:114188652-114188674 GAGGCTGCCATAAGCCAGGATGG - Intronic
1031414635 7:121480740-121480762 GAGGCTGCCAGAAGCTAAGAGGG - Intergenic
1032322175 7:130895532-130895554 GGGGGTCCCACAAGGTGGGAAGG + Intergenic
1033543203 7:142376132-142376154 GAGGGTGACCCAGGAGAGGACGG + Intergenic
1033548087 7:142420781-142420803 GAGGGTGACCCAGGAGAGGAGGG + Intergenic
1033801501 7:144907479-144907501 GAAGGAGCCACGAGAGAGGAAGG - Intergenic
1034748672 7:153547670-153547692 GAGGGGGACAGAAGAGAGGATGG - Intergenic
1036757915 8:11483580-11483602 GAGGGTGCGATCAAATAGGATGG + Intergenic
1039960387 8:42242574-42242596 CAGGGTGGCAGAAGATAGCATGG - Intergenic
1044946709 8:97396376-97396398 TAGGGTGACATAAGATAGGATGG - Intergenic
1059525323 9:114986062-114986084 CAGGGTGCCCCAAGATAAGGTGG - Intergenic
1061724072 9:132571959-132571981 GTGGCTGCCACCAGAGAGGAGGG + Intronic
1062679625 9:137771773-137771795 GAGGGTGCCACTGGGAAGGAAGG + Intronic
1198518909 X:137433227-137433249 GAGGGTGAGCCAAGACAGGATGG + Intergenic