ID: 1029935967

View in Genome Browser
Species Human (GRCh38)
Location 7:104424578-104424600
Sequence ACCAAAAATGTCTCCAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 24, 2: 70, 3: 109, 4: 294}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029935967_1029935969 -7 Left 1029935967 7:104424578-104424600 CCAGGTCTGGAGACATTTTTGGT 0: 1
1: 24
2: 70
3: 109
4: 294
Right 1029935969 7:104424594-104424616 TTTTGGTTGTCACAACTGGTTGG 0: 6
1: 71
2: 222
3: 455
4: 755
1029935967_1029935973 1 Left 1029935967 7:104424578-104424600 CCAGGTCTGGAGACATTTTTGGT 0: 1
1: 24
2: 70
3: 109
4: 294
Right 1029935973 7:104424602-104424624 GTCACAACTGGTTGGGGGAAAGG No data
1029935967_1029935971 -5 Left 1029935967 7:104424578-104424600 CCAGGTCTGGAGACATTTTTGGT 0: 1
1: 24
2: 70
3: 109
4: 294
Right 1029935971 7:104424596-104424618 TTGGTTGTCACAACTGGTTGGGG 0: 2
1: 9
2: 76
3: 206
4: 552
1029935967_1029935970 -6 Left 1029935967 7:104424578-104424600 CCAGGTCTGGAGACATTTTTGGT 0: 1
1: 24
2: 70
3: 109
4: 294
Right 1029935970 7:104424595-104424617 TTTGGTTGTCACAACTGGTTGGG 0: 2
1: 16
2: 108
3: 270
4: 640
1029935967_1029935972 -4 Left 1029935967 7:104424578-104424600 CCAGGTCTGGAGACATTTTTGGT 0: 1
1: 24
2: 70
3: 109
4: 294
Right 1029935972 7:104424597-104424619 TGGTTGTCACAACTGGTTGGGGG 0: 1
1: 7
2: 54
3: 148
4: 484
1029935967_1029935975 14 Left 1029935967 7:104424578-104424600 CCAGGTCTGGAGACATTTTTGGT 0: 1
1: 24
2: 70
3: 109
4: 294
Right 1029935975 7:104424615-104424637 GGGGGAAAGGCTACTCCAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 113
1029935967_1029935978 26 Left 1029935967 7:104424578-104424600 CCAGGTCTGGAGACATTTTTGGT 0: 1
1: 24
2: 70
3: 109
4: 294
Right 1029935978 7:104424627-104424649 ACTCCAGTGGGTAGAAGTCGGGG No data
1029935967_1029935977 25 Left 1029935967 7:104424578-104424600 CCAGGTCTGGAGACATTTTTGGT 0: 1
1: 24
2: 70
3: 109
4: 294
Right 1029935977 7:104424626-104424648 TACTCCAGTGGGTAGAAGTCGGG No data
1029935967_1029935976 24 Left 1029935967 7:104424578-104424600 CCAGGTCTGGAGACATTTTTGGT 0: 1
1: 24
2: 70
3: 109
4: 294
Right 1029935976 7:104424625-104424647 CTACTCCAGTGGGTAGAAGTCGG No data
1029935967_1029935974 13 Left 1029935967 7:104424578-104424600 CCAGGTCTGGAGACATTTTTGGT 0: 1
1: 24
2: 70
3: 109
4: 294
Right 1029935974 7:104424614-104424636 TGGGGGAAAGGCTACTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029935967 Original CRISPR ACCAAAAATGTCTCCAGACC TGG (reversed) Intronic
900195025 1:1371718-1371740 ACCACAGATGTCTCCAGATGCGG + Intergenic
900724764 1:4208688-4208710 ACAAAAAATGTCTCCAGGAGAGG + Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902039114 1:13480047-13480069 ATCAAAACTGTCTCCAGTCCGGG + Intronic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
904929656 1:34076522-34076544 ACCACAAATTTCTCCAGATGTGG + Intronic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907364616 1:53947576-53947598 ACCAAAAGTGTCTGCAGCCTTGG + Intronic
909779303 1:79522501-79522523 ACAAAAAATGTGTCCAGGCTGGG + Intergenic
910368952 1:86495916-86495938 ATCAAAAATGTCTCCATATGTGG + Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911505985 1:98752118-98752140 ACCAAAAAAATCTCAAAACCTGG - Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
911731170 1:101293814-101293836 ACCAAATATGACTCAAGACCAGG - Intergenic
911852251 1:102834717-102834739 ACAAGAAATGTGTGCAGACCAGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
914202256 1:145496064-145496086 ATCAAAAATGTCTACAGGCTGGG + Intergenic
914236186 1:145813979-145814001 ATCAAAAATGTCTACAGGCTGGG + Intronic
914424618 1:147563713-147563735 TCCAAAAATGACTTCAGACGTGG - Intronic
914481382 1:148069206-148069228 ATCAAAAATGTCTACAGGCTGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
917657185 1:177138071-177138093 ACCAAAACAAGCTCCAGACCTGG + Intronic
917891404 1:179441833-179441855 GCAAGAAATGTCTGCAGACCAGG - Intronic
918107335 1:181426099-181426121 GCCAACACTGTCTCCACACCAGG - Intronic
918308715 1:183270177-183270199 ACCAAAAAAGTTTCAAGGCCAGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
922965604 1:229688546-229688568 ACCAATAATGTCTCCAGCTCTGG + Intergenic
1063383857 10:5603734-5603756 ACCAATGTTGTCTCCAGAGCTGG - Intergenic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1069520660 10:69117570-69117592 ATCAAAACTGTCTCCAGGCCGGG + Intergenic
1070670788 10:78375910-78375932 CCAAATAATGTCTCAAGACCAGG - Intergenic
1071538681 10:86458306-86458328 CCCAAGTATGTCTCCAGTCCTGG - Intronic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1073795129 10:106979003-106979025 ACCACTTATGTCTCTAGACCAGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1074665626 10:115720013-115720035 ACAAAAAATATATCCAGGCCTGG - Intronic
1075170016 10:120104470-120104492 ACCAAAAATGTCTCTATCCCTGG - Intergenic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076570554 10:131429930-131429952 CCCAGAATTGTCTCCGGACCTGG - Intergenic
1076721078 10:132393552-132393574 ACCACAGATTTCTCCAGAGCTGG - Intergenic
1076740498 10:132480688-132480710 AGCAACAATGTTTCCTGACCAGG + Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077309962 11:1883933-1883955 ACCAGAAATGTCAGCAGCCCAGG + Exonic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1077592565 11:3503981-3504003 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1077991887 11:7419557-7419579 AACAAAAATGTCTCAAGGCGGGG + Intronic
1078122978 11:8529458-8529480 CCCATAAATCTCTCAAGACCAGG - Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1080322799 11:31033843-31033865 AGTAAAAATGTCTACAGGCCGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082933419 11:58632457-58632479 ACCAACAATGCCTACAGAACAGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084177469 11:67430727-67430749 ATCAAAAATGTGTCCATGCCAGG - Intronic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084248402 11:67876705-67876727 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084696351 11:70757855-70757877 ACAACAAATGACCCCAGACCAGG + Intronic
1084824420 11:71718776-71718798 GTCAAAGTTGTCTCCAGACCAGG + Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1084931281 11:72558195-72558217 ACCAAGAATGTGTCCCTACCTGG - Intergenic
1084966609 11:72747866-72747888 ACCAGCAATGTCACCTGACCAGG + Intronic
1085196206 11:74673302-74673324 ACCAAAAATTCCTCTTGACCTGG - Intergenic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086836668 11:91632650-91632672 ACCAAAAATGAATAAAGACCTGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1088531982 11:110820284-110820306 ACCTAGAATTTCTCCAGCCCAGG - Intergenic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092456181 12:8644890-8644912 AACAAAGATGGCACCAGACCAGG - Intronic
1092812334 12:12283593-12283615 ACCTAAAATGTCTCTGGACTTGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1097789915 12:63804146-63804168 ATCAAAAACGTCTCCAGGCCAGG - Intronic
1098311821 12:69156482-69156504 ACCAAAAATCTCTCCTGGCCAGG + Intergenic
1098714296 12:73810209-73810231 ACTAGGAATATCTCCAGACCTGG + Intergenic
1099561066 12:84174289-84174311 CCCAGCCATGTCTCCAGACCTGG - Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100400708 12:94226704-94226726 ACCAAAAATGTCACTTTACCTGG - Exonic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102295089 12:111730240-111730262 ACCAAAAATCTTCGCAGACCTGG + Intronic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102596502 12:113996821-113996843 ATAAAAAATGTCTCCAGGCCAGG + Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1103722861 12:122983884-122983906 ACCAAAAATGTTTACAGAGTTGG - Exonic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105412077 13:20178654-20178676 AACAAGTAAGTCTCCAGACCGGG - Intergenic
1106191444 13:27457150-27457172 ACCAAAAAATTAGCCAGACCTGG + Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1107245355 13:38287330-38287352 ACCAGAAATGTTTGCAGTCCAGG + Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109406709 13:61909718-61909740 ACCAAAAGTGTCACCAGCCTGGG - Intergenic
1111243638 13:85507871-85507893 CCCAACCATGGCTCCAGACCCGG + Intergenic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112501706 13:99947923-99947945 GTCAAAAATGTCTCCAGGCTGGG - Intergenic
1112614596 13:100990380-100990402 ACCAAACATATCTCCAGATGTGG - Intergenic
1114491776 14:23106881-23106903 ACCAAGAATGTAACCACACCTGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115439113 14:33411476-33411498 AACAAAAATGCCTCCAGGCCGGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116755790 14:48946441-48946463 ACCTAAAATTCCTCCAAACCAGG - Intergenic
1117983420 14:61364166-61364188 CCTAAAAGTGTCTCCAGGCCAGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120258704 14:82154808-82154830 ACCTAAAATTTCTACAGAGCAGG - Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1124783927 15:32661322-32661344 ACAGAAAATGTCTCCAGGCCAGG + Intronic
1125276417 15:37996773-37996795 GTCCAAAATGTCTTCAGACCTGG + Intergenic
1126022996 15:44420446-44420468 AGCAAGACTGTCTCCAGGCCGGG - Intergenic
1126793928 15:52244518-52244540 ACCAAAATTTTCTTCAGAGCAGG - Exonic
1129156676 15:73722462-73722484 ACCACACTTGTCACCAGACCTGG - Intergenic
1129422992 15:75444571-75444593 ACTAAAATTGAGTCCAGACCAGG + Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130191904 15:81745143-81745165 ACAAAAAGTATCTCCAGGCCAGG - Intergenic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131189487 15:90302214-90302236 AACAAAAATGTCTGCAAAACTGG + Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132874898 16:2132660-2132682 ACCAAAAATGTGAACACACCAGG + Intronic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133397877 16:5462766-5462788 ACCAAAAAGGACTCCAGAAGAGG - Intergenic
1133399790 16:5477222-5477244 ACCAAAAATATCTTCAGCCTGGG - Intergenic
1133605362 16:7381923-7381945 CCCAAAGATGTCTCTAGACTTGG + Intronic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133742794 16:8663986-8664008 ACCAAAACTGTCTCCAGCTGTGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134507002 16:14815849-14815871 AACGATAATATCTCCAGACCAGG - Intronic
1134520093 16:14914722-14914744 ACCAAAAATGTGAACACACCAGG - Intronic
1134553840 16:15151510-15151532 ACCAAAAATGTGAACACACCAGG + Intergenic
1134707767 16:16313376-16313398 ACCAAAAATGTGAACACACCAGG - Intergenic
1134805452 16:17120328-17120350 ACCAGAAAGGTCTCCAGGACAGG - Intronic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134839422 16:17389876-17389898 ACTAAAAATACCTCAAGACCTGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1134959776 16:18398749-18398771 ACCAAAAATGTGAACACACCAGG + Intergenic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135956044 16:26956933-26956955 ACCAATGAAGTCTCCATACCAGG - Intergenic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137952269 16:52794875-52794897 ACCAAAAGTGACTCCAGATGGGG + Intergenic
1138213324 16:55181169-55181191 ATGAAAAATGTTTCCAGGCCAGG + Intergenic
1139212256 16:65090882-65090904 ACTTAAAATATCTCCAAACCTGG - Intronic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141851433 16:86649048-86649070 ACCAAAAATGCCCCCAAAGCTGG + Intergenic
1141926860 16:87175417-87175439 ACCACAAAAGTGTCCTGACCGGG - Intronic
1142869966 17:2813664-2813686 AATGAAAATGTCTCCAGGCCAGG + Intronic
1143334048 17:6159210-6159232 TCTAAAGAGGTCTCCAGACCAGG + Intergenic
1143625525 17:8108496-8108518 AGCAAAAATCTCGCCAGTCCAGG + Exonic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145021242 17:19433028-19433050 ACCAAAAATGTCTCCCCAAGTGG - Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158867465 18:61651728-61651750 AACAAAAATATCCTCAGACCTGG + Intergenic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160864064 19:1249510-1249532 ACCAGACCCGTCTCCAGACCTGG + Intronic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161121215 19:2527810-2527832 AGCACAAATGTCCCCAGACTTGG + Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161279894 19:3440301-3440323 ACCGTAAATGTCCCCAGACCTGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161444056 19:4308112-4308134 ACCAAGAAAGTGTCCAGGCCGGG + Intronic
1161462427 19:4406278-4406300 ACCAAAAATATCTCTATACGTGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161878950 19:6933680-6933702 ACCAAAAATGTCTTCTGGTCGGG - Intronic
1161880665 19:6949470-6949492 ATCAAAAATGCCTCCAGAGGGGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166646370 19:44534746-44534768 ACAATAAATGCCTCCAGACTTGG + Intergenic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
926105151 2:10145223-10145245 ACTAAAAACCCCTCCAGACCTGG - Intronic
927250377 2:20990954-20990976 ACAAAGAATCTGTCCAGACCAGG - Intergenic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
929656916 2:43742295-43742317 AAAAAAAATGTCTTCAGGCCAGG - Intronic
930062954 2:47305998-47306020 ACAAAAAATTTCTTCAGGCCAGG + Intergenic
932580806 2:72991622-72991644 ACCCAAGATGGCTGCAGACCAGG + Intronic
933983895 2:87574934-87574956 ACCAAACATGCATCCAGCCCTGG - Intergenic
935671829 2:105562556-105562578 ATCAAAAATGTCTTCAGGCGGGG + Intergenic
936309960 2:111375860-111375882 ACCAAACATGCATCCAGCCCTGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937336301 2:121064415-121064437 ATCAAAACTGGCTCCAGACCAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
938828457 2:135030539-135030561 ACCAACAGTGTCTTCAGAGCTGG + Intronic
938941178 2:136170923-136170945 TTCAACAATGTCTCCAGTCCAGG + Intergenic
939200621 2:139030291-139030313 GCCACAAATGTCTACAGTCCAGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940630980 2:156238208-156238230 ACCAAAAAAATCTCTGGACCTGG + Intergenic
941650490 2:168087260-168087282 ACCAAATATGGCTCCAGGCAGGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
942821668 2:180122573-180122595 CCCAATAATGTCTCCACACTTGG - Intergenic
945997604 2:216451071-216451093 TCCAAATCTGTCTCCAGCCCTGG - Intronic
946763890 2:223022259-223022281 ACCAAACATGTCTCCAGGCCGGG + Intergenic
947041282 2:225923705-225923727 ACCCAAAATGTCTCCATCGCTGG + Intergenic
947071673 2:226294477-226294499 GCCAAAACTGTCTCCAGATTTGG - Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1169389896 20:5181385-5181407 ACCAGAAAGGGGTCCAGACCCGG + Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1173985078 20:47254829-47254851 AATAAAAATATCTCCAGGCCAGG + Intronic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1175629286 20:60519686-60519708 CCCAAATATGTCTCCAGCCTTGG + Intergenic
1175832414 20:61973403-61973425 AACAAACATGCCTGCAGACCCGG + Intronic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179058993 21:37962474-37962496 TCTAAAAATGTCTCCCGGCCAGG + Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1179446391 21:41433966-41433988 AACCAAGATGTCTCTAGACCTGG - Intronic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183564318 22:38602321-38602343 ACTAGAAATGTCTTCAGAGCTGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952186888 3:30979364-30979386 AGCAAAAATGTTTGTAGACCAGG - Intergenic
952852741 3:37742215-37742237 ACCAGATGTGTCTCCAGTCCTGG + Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953806072 3:46068301-46068323 ACCAAAAATGCTTTCAGACGTGG - Intergenic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956087947 3:65633248-65633270 ACCACACATGACTCCAGACACGG + Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
957987993 3:87595922-87595944 GCCAAAATTGCCTCCAGACTAGG + Intergenic
960086315 3:113595275-113595297 ACTAAAAATGCCTCCAGGCTTGG + Intronic
960414922 3:117372731-117372753 AAAAAAAATTTCTCCAGAACTGG + Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961739429 3:129023753-129023775 ACCAAAAATGTCTGCAGCTTAGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
961896362 3:130171328-130171350 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962461367 3:135616445-135616467 ACTAAAACTTTCTCCAGACCAGG + Intergenic
962676045 3:137759505-137759527 AGCAAAAAAGTCTCCTTACCTGG + Intergenic
962857758 3:139364372-139364394 AACTAAAGAGTCTCCAGACCAGG + Intronic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964302354 3:155302820-155302842 ACAAAAAATTTCTCCAAACTTGG + Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967764274 3:193261071-193261093 ACAAAAAGTGTATGCAGACCAGG + Intronic
967795053 3:193590937-193590959 ACAAAAAATGTCTCGGAACCAGG - Intronic
968954165 4:3709782-3709804 CCCCAAAATGCATCCAGACCTGG - Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969318710 4:6397315-6397337 ACCAAAAATCACCCCAGGCCAGG + Intronic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
974819991 4:67054159-67054181 AACAAATATGCCACCAGACCAGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978314715 4:107422871-107422893 ACCTAAAATTTCTCCACACCAGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
978957197 4:114628701-114628723 AATAAAAATGTCTCCACAACTGG - Intronic
980085605 4:128387207-128387229 ACCCAAACTGGCTCCACACCAGG - Intergenic
981538312 4:145823403-145823425 GCCAACAATGTTTCCATACCTGG + Exonic
982491849 4:156039332-156039354 ACCAGAAATGGATCCAAACCAGG + Intergenic
983221191 4:165045967-165045989 AGTAGAAATGTCTCCAGGCCTGG - Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983737270 4:171077543-171077565 ACCAGAGATGTCTCCACATCTGG + Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985987936 5:3533171-3533193 GGCCAAAGTGTCTCCAGACCTGG - Intergenic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990189262 5:53240377-53240399 ATGAAAAATGTTTCCATACCTGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
1000497238 5:162000013-162000035 ATCAAAATTGTCTCCAGAAGTGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003889216 6:10549050-10549072 ACCAAAAATGTCTTCACGCTGGG - Intronic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004338055 6:14782712-14782734 ACTAAAAATGTGTCCAGAATTGG + Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006705139 6:36013474-36013496 ATCAAAAATGTCTCCGGGCCAGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008807963 6:55454679-55454701 ACTAAGAATGTTTGCAGACCAGG + Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1012770497 6:103427239-103427261 ACCAAAAAAGGCCCTAGACCAGG + Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014790421 6:125666066-125666088 ACCAAATGTGTCCCCAGTCCAGG + Intergenic
1016421364 6:143886818-143886840 ACCCAAAATGTCTACACACCTGG - Exonic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020327066 7:6982964-6982986 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1020612120 7:10411475-10411497 ACCAAAAATATCACTAGACGGGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1023296518 7:38720730-38720752 ATTAAAAATGACTCCAGGCCTGG - Intergenic
1024035572 7:45505071-45505093 ACTAAAAATGGGGCCAGACCAGG + Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1026031984 7:66802187-66802209 TTTAAAAATGTCTCCAGGCCTGG - Intronic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030209029 7:106978267-106978289 ACCAAAAATGTCTCCTGGAGTGG - Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032023206 7:128421532-128421554 ACCAACAAGGTCTCAAGGCCTGG - Intergenic
1032151316 7:129432625-129432647 ACCAAAAATGTCTCGGGGCGGGG - Intergenic
1036369564 8:8151123-8151145 CTCAAAGTTGTCTCCAGACCAGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036384253 8:8264570-8264592 ACCAGAAATGTGTCCTGCCCAGG - Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1036881324 8:12514521-12514543 CTCAAAGTTGTCTCCAGACCAGG - Intergenic
1037279729 8:17225360-17225382 ACAAAAAATTCCTCCATACCAGG + Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1038387604 8:27163941-27163963 ACCAAAAATGTCTTCAAATCTGG + Intergenic
1039942395 8:42102372-42102394 ATAAGAAATGTCTCCAGGCCAGG + Intergenic
1040357615 8:46634876-46634898 ACCCAAAAAGTCTCAACACCTGG - Intergenic
1040562885 8:48540359-48540381 ACCAAAAAGGGCTGCAAACCAGG - Intergenic
1041299415 8:56395174-56395196 AACTAAAATGGCTCCAAACCTGG + Intergenic
1041820411 8:62025839-62025861 CCCATCAAAGTCTCCAGACCAGG - Intergenic
1043561966 8:81503470-81503492 ACCAAAAATGCCTCAAGATTTGG - Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1047872611 8:129101578-129101600 ACCAAAAATGTGTGGAAACCTGG - Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1049105326 8:140609017-140609039 CCGAAAAATGTCTGCAGATCTGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051083811 9:13323567-13323589 TCCAAAAAAGTCTCCAAGCCTGG + Intergenic
1052965746 9:34339308-34339330 ACATACAAGGTCTCCAGACCAGG + Intronic
1055461932 9:76527824-76527846 AGCAAAAATGTGTCCAGAATTGG + Intergenic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056417018 9:86386593-86386615 ATCAAATATGTCTCCAGATCTGG + Intergenic
1056967721 9:91178725-91178747 TCCTAAAATGTCCCCAGAGCGGG - Intergenic
1057636749 9:96776477-96776499 ATCAGAAACGTCTCCAGGCCGGG + Intronic
1060042310 9:120310115-120310137 ACTTAAAGTCTCTCCAGACCAGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060070990 9:120547306-120547328 AACAAAAATATTTCCAGGCCGGG + Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1062196318 9:135276176-135276198 TCTAAAAATGTCCCCAGCCCGGG + Intergenic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186077111 X:5892709-5892731 AGAAAGAAAGTCTCCAGACCAGG - Exonic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186714545 X:12236889-12236911 TCCAAAAGTATCTCCAGAACTGG - Intronic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190363548 X:49671093-49671115 ACCAAAAATGTCTCTACGCTGGG + Intergenic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1194498915 X:94655887-94655909 ACCAAGAATGTAATCAGACCTGG - Intergenic
1195012150 X:100743153-100743175 ACCAAAAATGTCCCCTGGGCAGG - Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195709842 X:107765065-107765087 ATCAAAAGTGTCCCCACACCAGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196124800 X:112085656-112085678 ACCAAAAATGCGTCCAGGCATGG + Intergenic
1196710310 X:118755242-118755264 TCAAAAAATGACTCCAGGCCAGG - Intronic
1198142522 X:133818943-133818965 ACCAAAAGGGTCTCCAGTCTAGG - Intronic
1198313715 X:135445529-135445551 ACTAAAAACGTCTCCAGATCTGG - Intergenic
1198391400 X:136178908-136178930 ACCAAAAAATTATCCAGGCCTGG - Intronic
1198536346 X:137590490-137590512 ACAAAAATTGTCTCAAGGCCAGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1199952610 X:152717388-152717410 GCCAAGAATGTTTCCCGACCTGG + Exonic
1199957073 X:152751060-152751082 GCCAAGAATGTTTCCCGACCTGG - Intronic
1200904241 Y:8465050-8465072 ATCCAAAATGTCTCAACACCTGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic
1202262634 Y:22985608-22985630 AACAAAAATGTCTCAACACTGGG - Intronic
1202415624 Y:24619349-24619371 AACAAAAATGTCTCAACACTGGG - Intronic
1202455163 Y:25050737-25050759 AACAAAAATGTCTCAACACTGGG + Intronic