ID: 1029939744

View in Genome Browser
Species Human (GRCh38)
Location 7:104467488-104467510
Sequence TTGTGAAGTGCAGGTTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029939744 Original CRISPR TTGTGAAGTGCAGGTTGTAC AGG Intronic
906928812 1:50148270-50148292 TTATGAAGTGCAGGTTAGGCAGG - Intronic
907605838 1:55816627-55816649 TGGTCAAGTGCAGTTTGTAGTGG + Intergenic
911563424 1:99434138-99434160 TTGGGAAGTGTAGGTGGGACAGG - Intergenic
913324664 1:117616285-117616307 TTGTGAAATGAAGGGTGTAGAGG - Intronic
914199471 1:145472051-145472073 TTGTGAACAGCTGGTTATACAGG + Intergenic
914478584 1:148045184-148045206 TTGTGAACAGCTGGTTATACAGG + Intergenic
917838723 1:178960687-178960709 GTCTGAAGTGCAGGCTGCACCGG - Intergenic
919441416 1:197638253-197638275 TTGTGTAGTGCATGTTGTTTTGG - Intronic
1063063765 10:2587745-2587767 TTGTAAAGTGTAGTTTGTTCAGG - Intergenic
1066276079 10:33870234-33870256 TTGTGTAGTGCAGTTTGGAGGGG + Intergenic
1069627998 10:69880257-69880279 TTGGGAAGGGCAGGTAGTAGGGG - Intronic
1070209611 10:74302471-74302493 TTTTGAAGTCCAGTTTGTACTGG + Intronic
1077174963 11:1184918-1184940 CTGTGGAGTGGAGGTTGTGCTGG - Intronic
1077175529 11:1188236-1188258 CTGTGGAGTGGAGGTTGTGCTGG - Intronic
1077175544 11:1188332-1188354 CTGTGGAGTGGAGGTTGTGCTGG - Intronic
1077175711 11:1189274-1189296 CTGTGGAGTGGAGGTTGTGCTGG - Intronic
1077175754 11:1189535-1189557 CTGTGGAGTGGAGGTTGTGCTGG - Intronic
1077175777 11:1189679-1189701 CTGTGGAGTGGAGGTTGTGCTGG - Intronic
1077175920 11:1190429-1190451 CTGTGGAGTGGAGGTTGTGCTGG - Intronic
1078525367 11:12096892-12096914 TTGTCAAGTGGAGGTTGTTAGGG - Intronic
1079476116 11:20831179-20831201 TTAAGATGTGCAGGTTGAACTGG - Intronic
1081610998 11:44563411-44563433 CTGTGGAATGCAGGGTGTACAGG - Intergenic
1081957346 11:47104965-47104987 TTGGGAACTGCAGGTTGACCTGG - Intronic
1081982640 11:47278215-47278237 TTTTGAAGTCCAGTTTGTAGAGG - Exonic
1082000807 11:47393013-47393035 TTGTGTAGTGCAGGGTGGGCCGG + Intergenic
1082381204 11:51945544-51945566 TTCTGAAGTGCTGGTATTACAGG + Intergenic
1083462396 11:62822938-62822960 TAGAGAAGTACAGGGTGTACTGG - Intronic
1085624873 11:78064214-78064236 TGGAGAAGTGCAGGTGGAACTGG - Exonic
1085690264 11:78658537-78658559 TGGTGAAGTGCAGGTTCTCTAGG + Exonic
1087619551 11:100526087-100526109 TTGTGCAGTGTAGCTTGTGCAGG + Intergenic
1093725075 12:22496963-22496985 TTCTGAAGTGCAGGTGAAACTGG + Intronic
1093859577 12:24147542-24147564 TTCTGCAGTGGAGGTTGTATGGG + Intergenic
1094070461 12:26407223-26407245 AGGTGAAGTGCAGGTTATAGAGG + Intronic
1095605104 12:44057931-44057953 TTGTGAATTGAAGCCTGTACGGG - Intronic
1095607626 12:44089004-44089026 TTTTGATGTACAGGGTGTACAGG - Intronic
1096120142 12:49083419-49083441 TGGTGAAATGCAGTCTGTACTGG + Intergenic
1100112204 12:91259512-91259534 GTGTCAAGTGAAGGTTGTACTGG - Intergenic
1101497333 12:105267243-105267265 TTGGGAAGTGCAGGGAATACTGG + Intronic
1101631273 12:106497344-106497366 TTGAGGAGTGCTGTTTGTACTGG + Intronic
1101903448 12:108808236-108808258 CTGAGAAGTGCAGTTTGTAAAGG + Intronic
1103182956 12:118930049-118930071 TTGAGAAGGGCAGGTTATTCTGG - Intergenic
1103304563 12:119953709-119953731 ATGAGAAGTGCAGGATGTAAGGG - Intergenic
1104207135 12:126650012-126650034 TTGTGAAAGGCAGGATGTAGAGG + Intergenic
1107508000 13:41054816-41054838 TAGTAACGTGCAGGTTGAACTGG - Intronic
1110502849 13:76249204-76249226 TTGTGAAGTTCAGGTCGGAATGG + Intergenic
1116084051 14:40212872-40212894 TTGTGAAGTCCAGTTTTTGCTGG + Intergenic
1118393986 14:65320137-65320159 TTCTGAAGTGCTGGTATTACAGG + Intergenic
1119476069 14:74929718-74929740 TTCTGATCTGCTGGTTGTACTGG + Intergenic
1121180694 14:91926349-91926371 TGGGGAAGTGCTGGTGGTACTGG - Intronic
1121425565 14:93848836-93848858 TTGTGAAGTGAAGCTTGTTATGG + Intergenic
1121801821 14:96780778-96780800 TGGTGAAGTGCAGGTAATAGAGG + Intergenic
1126662311 15:51045240-51045262 TTCTGAAGTGCTGGTGTTACAGG - Intergenic
1130675713 15:85950237-85950259 ATGTGAAGTGCAGGTGGTAATGG + Intergenic
1131545730 15:93314321-93314343 TTGTGACCTGCAGGATGTGCTGG + Intergenic
1132231394 15:100187122-100187144 ATGTGCAGTGCACCTTGTACCGG - Intronic
1134759179 16:16698406-16698428 TAGTGAAGATGAGGTTGTACTGG + Intergenic
1134986894 16:18660778-18660800 TAGTGAAGATGAGGTTGTACTGG - Intergenic
1135749373 16:25044638-25044660 TTGGGAGGTGGAGGTTGTAGTGG + Intergenic
1138269919 16:55688285-55688307 TTGGCAAGTGAAGGTTGTGCTGG + Intronic
1142850468 17:2702103-2702125 TTGTGCTGGGCAGGTTGTTCAGG - Intronic
1144390788 17:14791579-14791601 TTGTGAAGTGGACGTTGTTGGGG - Intergenic
1147269113 17:39254910-39254932 TTGTGAAGTTCAGTTTATAGAGG - Intergenic
1152082939 17:78199773-78199795 TTCTGAGATGCAGGTTCTACAGG + Intronic
1152213002 17:79013079-79013101 TTGTCAAGTGCACTTTGTTCTGG + Intergenic
1153507004 18:5810977-5810999 TTGTGGAATGGAGGCTGTACCGG - Intergenic
1153706621 18:7751939-7751961 ATGTGAAGTGCAAGTTTGACGGG + Intronic
1154187476 18:12198504-12198526 TTCTGTATTGCAGGTTGTGCAGG + Intergenic
1159258968 18:65986722-65986744 TTAGGAAGTGGAGGTTGTAGGGG - Intergenic
1159922981 18:74243040-74243062 TTGAGAACTGCAGGATGTCCAGG - Intergenic
1161767308 19:6214752-6214774 TTGTGAAGTGATGGTTGTCAGGG - Intronic
1167302367 19:48685631-48685653 TGGTTAAGTCCAGGTTATACTGG + Intergenic
925203948 2:1991009-1991031 ATGGGAAGTGCAGGTTGCAAGGG - Intronic
927279577 2:21292348-21292370 TTTTGAAAAGCAGGTTGTCCTGG + Intergenic
936593835 2:113829017-113829039 TTGGGCTCTGCAGGTTGTACAGG + Intergenic
936741645 2:115518979-115519001 ATGTGAAGTTCAGTTTGTGCTGG - Intronic
939467606 2:142579001-142579023 TTGGGATGTCCAGGTGGTACAGG - Intergenic
940590282 2:155715680-155715702 TTGTGAATTGCAGTTTGCAGGGG + Intergenic
947344965 2:229180982-229181004 TTGTGAAGGGCAGGGTGCCCTGG - Intronic
1171869478 20:30513807-30513829 TTGTGAAGGGCAGGATGCCCCGG - Intergenic
1172040840 20:32044330-32044352 CTGGGAAGTGGAGGTTGTAGTGG + Intergenic
1173473813 20:43344413-43344435 TTGGGAAGTAGAGGTTGTAGGGG - Intergenic
1174067474 20:47875646-47875668 CTGGGAAGTGCAGATTTTACCGG + Intergenic
1177383079 21:20370909-20370931 TCCTGAAGTGCTGGTTTTACAGG - Intergenic
1177855749 21:26398702-26398724 TAGTGTTCTGCAGGTTGTACAGG + Intergenic
1178956603 21:37028328-37028350 TTCTGAAGTGCTGGGAGTACAGG - Intergenic
1181991832 22:26842683-26842705 TTGCAAAGTGCTGGTTGTCCAGG - Intergenic
1185273681 22:49940569-49940591 TTTTTAAATGCAGGTTGTCCAGG - Intergenic
950656268 3:14438867-14438889 TTGAGAAGTGCAGGGTCTGCAGG + Intronic
950873110 3:16246191-16246213 GTGTGAAGAGGAGGTTGTAGGGG - Intergenic
953186441 3:40642354-40642376 TGCTGAGGTGCAGGTTGTTCTGG + Intergenic
953398863 3:42594475-42594497 TTTTGAAGTGCTGGTTGGACTGG - Exonic
955118991 3:56036751-56036773 TCCTGATTTGCAGGTTGTACAGG - Intronic
955437285 3:58915325-58915347 TGGTGAAATGCAGGTTATAGGGG + Intronic
956488457 3:69746231-69746253 TTCTGCAGTGCAGTTTGCACAGG + Intronic
957698268 3:83673037-83673059 TTGTGAAGAACAGATTGTAATGG + Intergenic
958692629 3:97487110-97487132 TTGTCAAGTGCAGGATATTCAGG + Intronic
959548701 3:107629187-107629209 TTGTGAAGAGGAGGTTCTAACGG - Intronic
966974157 3:185070284-185070306 TTGTGACGTGGAGGGTGTGCCGG + Intergenic
969651752 4:8472161-8472183 TTGTGATGTGCAGGGAGAACTGG + Intronic
970042824 4:11815600-11815622 TGGTGAAGGGAATGTTGTACAGG + Intergenic
971684615 4:29747961-29747983 TAGTGAAGTTCAGGCTGAACTGG - Intergenic
973900233 4:55461942-55461964 TAATGAAGTTGAGGTTGTACAGG - Intronic
974887634 4:67840071-67840093 ATGTTAAGTCTAGGTTGTACAGG + Intronic
981470391 4:145127401-145127423 ATGTGCAGAACAGGTTGTACAGG + Intronic
984698180 4:182799850-182799872 TGGTGAAGTGCAGGTTCTCCAGG - Exonic
984821841 4:183889219-183889241 TAGTTAAGAGGAGGTTGTACTGG + Intronic
985691817 5:1317313-1317335 TTTTGAAGTGCTGGGAGTACAGG - Intergenic
986048379 5:4063360-4063382 TATTGTTGTGCAGGTTGTACAGG - Intergenic
987171802 5:15267103-15267125 TTGTGAAATGCAGGCTGTACAGG + Intergenic
987821319 5:22970288-22970310 TGGTGAAGAGCTGGTTGTGCCGG + Intergenic
991089883 5:62684124-62684146 CTGTGAAGTCCAGGTTCTAATGG - Intergenic
994922537 5:106067576-106067598 TTGTGGAGAGCAGGTTGTTTTGG + Intergenic
995544844 5:113219811-113219833 TTCTGAAGGCCAGGTTGGACTGG - Intronic
996620516 5:125496583-125496605 TTGTTCAGTGCAGGATGTTCAGG + Intergenic
997039002 5:130229186-130229208 CTGGGAAGTGGAGGTTGTAGTGG + Intergenic
1000418496 5:161010098-161010120 TTGTGAAGTGCAGTATATAAAGG - Intergenic
1005026707 6:21469492-21469514 TTTTGAAATTCAGGGTGTACTGG + Intergenic
1007686697 6:43671408-43671430 TTGGGAAGTGCAGGGGGTCCTGG - Exonic
1009530746 6:64811202-64811224 TTGGGAGGTGCAGTTTCTACTGG - Intronic
1013198526 6:107867482-107867504 CTGTGGAGTGCAGGTGGTGCAGG - Intergenic
1017595760 6:156027112-156027134 GTTTGGAGTGCAGGTTCTACAGG + Intergenic
1018266406 6:162029128-162029150 TTCTGAAGTGCAGGGAGAACTGG - Intronic
1021352189 7:19608449-19608471 TTGTGTAGTGCTGGTTGGAATGG + Intergenic
1021360494 7:19707017-19707039 CTGTCAAGTGCAGGCAGTACTGG + Intronic
1021732053 7:23605296-23605318 TTGTGGATTGCATGTTGTAAAGG + Intronic
1022373985 7:29796449-29796471 TTGTTCAGTGCTGGTGGTACTGG + Intergenic
1023279153 7:38552256-38552278 TTCTGAAGTGCAGGGGGTCCTGG - Intronic
1023336831 7:39179362-39179384 TTGTAACATGCAGGTTGTAGTGG + Intronic
1024674969 7:51630123-51630145 TTCTGAGGTGCAGGATGTATTGG + Intergenic
1024775243 7:52777335-52777357 CTGTGAGGTGCAGGCTGCACTGG + Intergenic
1026068234 7:67094885-67094907 CTGTGGAATGCAGGTTGTACAGG + Intronic
1026708685 7:72717416-72717438 CTGTGGAATGCAGGTTGTACAGG - Intronic
1029939744 7:104467488-104467510 TTGTGAAGTGCAGGTTGTACAGG + Intronic
1030338771 7:108353577-108353599 TTCTGAAGTGCAGGGATTACAGG + Intronic
1030921404 7:115393124-115393146 TTCTGAAATGCAGATTGGACAGG + Intergenic
1031583951 7:123510927-123510949 TTGTGAAGTTCAGGAGGTAAAGG + Intronic
1034255181 7:149720845-149720867 CTGTGAGGTGCAGGCTGTGCCGG - Exonic
1034337811 7:150334694-150334716 ATGTGAAATGCAGGTGGGACAGG - Intronic
1034683213 7:152947075-152947097 TTGTGTCGTGCAGGTTGTCAGGG + Intergenic
1037167653 8:15850164-15850186 TTGGGAAAGGCAGGTTATACTGG - Intergenic
1038229113 8:25684349-25684371 TTGGGAAGTGCAGTTTGGGCAGG + Intergenic
1039803367 8:40978906-40978928 TTCTGAATTGCAGGTTGTAAGGG - Intergenic
1040051802 8:43022371-43022393 TTGTGCAGTGGAGCTTGTCCAGG + Exonic
1041695677 8:60733562-60733584 TTTTGAATTGCAGGGTGTAAAGG + Intronic
1042938508 8:74084426-74084448 CTCTGAAGTGCAGTTTGTACAGG + Intergenic
1043064187 8:75545569-75545591 TTTTGAAGCTCAGGTTGTGCTGG + Intronic
1043790441 8:84460360-84460382 TTGCAAAGTGAAGGCTGTACAGG + Intronic
1044345727 8:91102151-91102173 TATTTAAGTGCAGTTTGTACTGG + Intronic
1044840823 8:96335571-96335593 TTGTGAAGAGCAGGGTGCACAGG + Exonic
1046046111 8:108966764-108966786 TTATGATCTGCAGGCTGTACAGG - Intergenic
1048481116 8:134794502-134794524 TTATGCGGTCCAGGTTGTACAGG - Intergenic
1048788570 8:138078507-138078529 TTGTCAAGTAGAAGTTGTACAGG + Intergenic
1050474285 9:6023611-6023633 TTTTGAAATACAGTTTGTACAGG - Intergenic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1057854120 9:98589367-98589389 TTGTCAAGTGCAGCTTGAAGGGG - Intronic
1185652000 X:1654863-1654885 TTGGGAAGTGGAGGTTGGCCAGG - Intergenic
1185836540 X:3349681-3349703 TTTTGGGGTGCAGATTGTACAGG - Intergenic
1191100288 X:56719331-56719353 TTGTGTCATGCAGGTTGTCCAGG - Intergenic
1191888882 X:65920337-65920359 TTCTCAAGTGCTGGTTGTGCTGG + Intergenic
1195256466 X:103095787-103095809 ATGTGAAGTGGGGGTTGAACAGG + Intergenic
1199062669 X:143377109-143377131 CAGTGAAGTCCAGGTTGTAGTGG - Intergenic