ID: 1029943022

View in Genome Browser
Species Human (GRCh38)
Location 7:104500277-104500299
Sequence CAGTTGATTAGAAGGAATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029943022 Original CRISPR CAGTTGATTAGAAGGAATCA CGG (reversed) Intronic
901071381 1:6520679-6520701 GAGTGTATTAGAAGGAAACAGGG - Intergenic
902050380 1:13559771-13559793 CAGGTGATCAGAATGAGTCAGGG - Intergenic
902052199 1:13572839-13572861 CAGGTGATCAGAATGAGTCAGGG - Intergenic
905051839 1:35058479-35058501 CAGGTGATTGGAATGAGTCAGGG - Intergenic
906587514 1:46992429-46992451 AAGTTGATTAGAAATAACCAGGG - Intergenic
908514028 1:64873986-64874008 CAGTTGAATAGCAGCAATCTGGG - Intronic
908733706 1:67253857-67253879 CAGTTCATAACAAGGAATTAGGG + Intronic
909014375 1:70367221-70367243 CAGGTGATCAGAATGAGTCAGGG + Intronic
910607511 1:89103130-89103152 CAGTTTATTAGAAAGAATGTAGG + Intergenic
911104269 1:94117741-94117763 CCGTGGAGTAGAAGGAAACACGG - Intronic
911328458 1:96497575-96497597 CAAATGATTAGAAGAAATCAAGG + Intergenic
911609911 1:99949549-99949571 CAGTTGATTAAATAGGATCATGG + Intergenic
914202569 1:145499175-145499197 AAGTTGATTAGATTAAATCATGG + Intergenic
914236499 1:145817103-145817125 AAGTTGATTAGATTAAATCATGG + Intronic
914481692 1:148072326-148072348 AAGTTGATTAGATTAAATCATGG + Intergenic
916873601 1:168944216-168944238 CAGTAGATTAGATGGTAACATGG + Intergenic
917357230 1:174139342-174139364 CAGTTGATTAGATGTAGACATGG - Intergenic
919656222 1:200200041-200200063 AACTTGCTTAGAAGGAATGAAGG - Intergenic
919880990 1:201900494-201900516 CAGTGGATAAGAAGGAGGCAGGG - Exonic
919981631 1:202645562-202645584 CATTTTATCAGAAGGAACCATGG - Intronic
920335069 1:205239529-205239551 CAGTTCTTGAGAAGGAATCATGG + Intronic
920707427 1:208264411-208264433 CAGTTTATTGGAAGGAAAGATGG + Intergenic
922276789 1:224086677-224086699 CAGGTGATTGGAATGAGTCAGGG - Intergenic
922694413 1:227721174-227721196 CAGGTGATCAGAATGAGTCAGGG + Intergenic
922843981 1:228668374-228668396 CAGTTGATGAGAAGGATGGATGG + Intergenic
923367104 1:233273497-233273519 CAGTTGGATAGAAGGAAAGAAGG - Intronic
924540964 1:244980450-244980472 CAGTGGATTAGATGGACTCCAGG + Intronic
1064433088 10:15287928-15287950 CAGTGGATTTGGAGGACTCAGGG - Intronic
1065676856 10:28185536-28185558 AATTTGATGTGAAGGAATCATGG + Intronic
1065891161 10:30122472-30122494 TAGTTGTTTAGAAGCAAACATGG - Intergenic
1067452112 10:46388190-46388212 CAGTGGGTGAGAAGGAATTAAGG + Intronic
1067496315 10:46763362-46763384 CAGTTGCTTATCAGAAATCACGG - Intergenic
1067585125 10:47471565-47471587 CAGTGGGTGAGAAGGAATTAAGG - Intronic
1067598341 10:47577035-47577057 CAGTTGCTTATCAGAAATCACGG + Intergenic
1069733491 10:70634830-70634852 CAGGTGATCAGAATGAGTCAGGG + Intergenic
1071282734 10:84117342-84117364 CAGGTGATTGAAAGGAGTCAGGG - Intergenic
1071612722 10:87046227-87046249 CAGTTGCTTATCAGAAATCACGG - Intergenic
1072721829 10:97785897-97785919 CAGATGCCTAGAAGGTATCACGG - Intergenic
1073239006 10:102042279-102042301 CAGTTGATTAGCAGGAAGAGTGG + Intronic
1074614168 10:115049682-115049704 CAGTTGATTAGAACGTAGAAGGG - Intergenic
1076037718 10:127214828-127214850 GAGTGGCTGAGAAGGAATCACGG - Intronic
1076291029 10:129345826-129345848 CATTTGATTACAATGAATCTGGG + Intergenic
1078126967 11:8575564-8575586 CAGTAGATTAGAGGTTATCAGGG + Intronic
1079544510 11:21616337-21616359 TAGTTGAATATAAGGAGTCATGG - Intergenic
1079932614 11:26583991-26584013 TGGTTGATTAGAAGGGGTCAGGG - Intronic
1080103576 11:28487667-28487689 CAATTGCTTAGAAGGTATAAAGG + Intergenic
1084954121 11:72682486-72682508 CAGTTTCTGAGAAGGTATCATGG - Intergenic
1087174755 11:95086366-95086388 GAGTGGATTAGAAGGGATGACGG + Intergenic
1088997208 11:115011449-115011471 CAGTTGACTAGAAGAAAGAAAGG - Intergenic
1091316428 11:134617305-134617327 CAGTTGCCTAGAAGGACGCATGG + Intergenic
1091726121 12:2847725-2847747 AAGTTGAATAGAAGATATCAGGG - Intronic
1092620971 12:10268089-10268111 AAATCGATTAGAAAGAATCAAGG + Intergenic
1093356972 12:18178223-18178245 CAGGTGATCAGAATGAGTCAGGG - Intronic
1093600851 12:21020439-21020461 AAGAAGATTAGAAGGAATTATGG - Intronic
1093911917 12:24758089-24758111 CATTTTAGTAGAAGGAATGATGG - Intergenic
1093913979 12:24779654-24779676 CAGGTAAAAAGAAGGAATCACGG - Intergenic
1095485593 12:42681064-42681086 GAGTGGATTAGAAGGAACTAAGG - Intergenic
1098182180 12:67859640-67859662 CAGTTGATTAAAAGGTAATAAGG + Intergenic
1098683425 12:73387345-73387367 CAGTTTATTAGCAGTAATCCTGG + Intergenic
1098980250 12:76948147-76948169 TAGTAGGCTAGAAGGAATCAGGG + Intergenic
1099666336 12:85634273-85634295 CAGTTGTTTAGAACCAAACATGG + Intergenic
1101565222 12:105898482-105898504 CAGGTAATTAGAATGAGTCAGGG + Intergenic
1101645280 12:106625799-106625821 CAGAGGATTAAAAGAAATCATGG - Intronic
1102052426 12:109872397-109872419 CAGATGAGTGGAAGGAAACACGG - Intronic
1103065176 12:117891640-117891662 CAATTGCTCAGAAGGAAGCATGG + Intronic
1104247203 12:127055319-127055341 CAGTTGATTTAAAGGAATCATGG - Intergenic
1105569045 13:21582640-21582662 CAGGTAATTAGAATGAGTCAGGG - Intronic
1107229054 13:38086367-38086389 CAGTTGGATAAAAGGCATCAAGG - Intergenic
1107374669 13:39789491-39789513 CAGGTGATTGGAATGAGTCAGGG - Intronic
1107374674 13:39789519-39789541 CAGGTGATCAGAATGAGTCAGGG - Intronic
1107997612 13:45876227-45876249 CAGGTGATTGGAATGAGTCAGGG + Intergenic
1108184038 13:47871012-47871034 CTGTTGAGTAGAAGGAGTAAGGG + Intergenic
1109684280 13:65793350-65793372 AAGTAGATTAGAGGTAATCAAGG + Intergenic
1109909264 13:68889042-68889064 CAGGTGATCAGAATGAGTCAGGG + Intergenic
1109909268 13:68889070-68889092 CAGGTGATCAGAAAGATTCAGGG + Intergenic
1110281011 13:73694609-73694631 TATTTGATTACAAGGAACCAGGG - Exonic
1110756419 13:79179843-79179865 AAGGTGATTAGAATGAGTCAGGG + Intergenic
1110957467 13:81573405-81573427 CAGTATACTTGAAGGAATCATGG + Intergenic
1111801068 13:92981497-92981519 CACTGCATGAGAAGGAATCAAGG + Intergenic
1116163825 14:41307814-41307836 GAGTTGATTAAAATGATTCAAGG + Intergenic
1117055006 14:51902999-51903021 TAGTTTATTATAAGCAATCAGGG + Intronic
1117255319 14:53971421-53971443 GAGTGGTTTAGAAGGAGTCAAGG + Intergenic
1118542361 14:66842253-66842275 AAGTGGATGAGAAAGAATCAGGG - Intronic
1120395688 14:83964487-83964509 CAGGTGATTGGAATGAGTCAGGG - Intergenic
1120783156 14:88504537-88504559 CAATTTCTTAGAAGGAATCATGG + Intronic
1121481175 14:94276024-94276046 CAGCACATTAAAAGGAATCATGG - Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1123811628 15:23932496-23932518 CAGTTGATTGGAAGGATTTCTGG + Intergenic
1123898447 15:24851509-24851531 CAGTGGATTAGAAGGACTGCTGG + Intronic
1124497319 15:30194298-30194320 CATTTTATCAGAAGGAACCATGG - Intergenic
1124746255 15:32344349-32344371 CATTTTATCAGAAGGAACCATGG + Intergenic
1124888402 15:33708995-33709017 CAGGTGATCAGAATGAGTCAGGG + Intronic
1125162153 15:36657468-36657490 CAGTTGCATAGAAAGAAGCATGG + Intronic
1125690563 15:41592936-41592958 CAGGTGATCAGAATGATTCAGGG - Intergenic
1126737196 15:51742367-51742389 AAGTAGATTAGAAGTGATCAGGG - Intronic
1128602330 15:69007773-69007795 CAGGTGATTGGAATGAGTCAGGG - Intronic
1129534361 15:76299885-76299907 ATGTTGATGAGAAGGAACCAGGG - Intronic
1130294824 15:82638916-82638938 CACTTACTTAGCAGGAATCAGGG - Intronic
1133169122 16:3970102-3970124 CAGTTGATTTGATGCAATAATGG + Intronic
1135501149 16:22996910-22996932 CAGTTTATTAGAAGGTTCCAGGG - Intergenic
1135844325 16:25905029-25905051 CAGTTGATTTGACGGAGGCATGG + Intronic
1137533722 16:49301062-49301084 CAGATGCTTTGAAAGAATCAGGG - Intergenic
1138549337 16:57739035-57739057 CAGTGTATTGGAAGGACTCAAGG + Intronic
1140729917 16:77846701-77846723 TAGTTGGTTAAAAGGAATTATGG + Intronic
1141297820 16:82786125-82786147 CAGGTGATCAGAATGAGTCAGGG + Intronic
1141433354 16:83982436-83982458 CGGTGGATTAGAAGGTAGCATGG + Intronic
1144188709 17:12823154-12823176 AAGTTGATTAGAAGTATTAAGGG - Intronic
1144600579 17:16609063-16609085 CTGATGATTAGAAGGAAGTAGGG - Intergenic
1145000298 17:19300184-19300206 CAGTTTCTTAGAAAGAAACAGGG + Intronic
1148156007 17:45425572-45425594 CAGTGGAGGAGAAGGAATGAGGG + Exonic
1148318456 17:46725871-46725893 AAGTTGAATAGAAGTACTCAAGG - Intronic
1149412608 17:56424263-56424285 CAGTTGTAGAGAAGGAATCATGG - Intronic
1150055454 17:62010792-62010814 CATTGGTTTAGAAGGAACCAAGG + Exonic
1151256770 17:72883524-72883546 CAGTTAATTACACGGAATCTGGG + Intronic
1151894433 17:76970407-76970429 CAGGTGATCAGAATGAATCAGGG - Intergenic
1151894437 17:76970435-76970457 CAGGTGATCAGAATGAGTCAGGG - Intergenic
1157758432 18:50240210-50240232 CAGGTGATCAGAATGAGTCAGGG - Intronic
1159837041 18:73350575-73350597 CAGTGGATCACAAGGAATGAGGG + Intergenic
1160418819 18:78730359-78730381 CACTTGATTAGGAAGCATCATGG + Intergenic
1160671857 19:368932-368954 CAGTTGGTTTGGATGAATCAGGG - Intronic
1163050290 19:14678062-14678084 CAGGTGATCAGAATGAGTCAGGG + Intronic
1164291558 19:23873818-23873840 CAGTTGATTTGAAGGTATAAGGG - Intergenic
1165537967 19:36465977-36465999 CAGTTTAATAGAAGGAAAAAAGG + Intronic
1167907057 19:52670096-52670118 CAGGTGATTGGAATGAGTCAGGG - Intronic
1167907062 19:52670124-52670146 CAGGTGATCAGAATGAGTCAAGG - Intronic
1167907071 19:52670180-52670202 CAGGTGATCAGAATGAGTCAAGG - Intronic
925457566 2:4029039-4029061 CATTTGATTTGAAGGAGACATGG + Intergenic
926902115 2:17763519-17763541 CAGTGGATTAGGAGGAAGCAGGG - Intronic
927575568 2:24199347-24199369 CAGGTGATCAGAATGAGTCAGGG + Intronic
929527141 2:42715217-42715239 GAGTTGGTTAGAAGGAATGCTGG - Intronic
930506332 2:52286393-52286415 CAGTTCAATAGAAAAAATCAGGG + Intergenic
930882604 2:56289149-56289171 CAGCTGATAATAAGAAATCATGG - Intronic
931155073 2:59618885-59618907 AAGTAGATGAGAAGGACTCAGGG - Intergenic
931425775 2:62169735-62169757 TAGGTGATTAGAAAGAGTCAGGG - Intergenic
934230688 2:90179147-90179169 AAATTGACAAGAAGGAATCAAGG + Intergenic
935257879 2:101328475-101328497 CAGCTGAAGAGAAGGAACCAGGG + Intergenic
935430472 2:102970648-102970670 CATTTCATAAGAAGGAATCCTGG - Intergenic
936864973 2:117066975-117066997 AAGTTGATTACAAGGAAGGAAGG + Intergenic
939913247 2:148008561-148008583 CAGATGATCAGAATGAGTCAGGG - Intronic
941242874 2:163062805-163062827 CAGTTGTTTGGAAGGGAACAAGG - Intergenic
941283987 2:163586180-163586202 CAGTTGAGCAGAAGGAGTAAAGG + Intergenic
941876069 2:170434626-170434648 CAGGTGATCAGAATGAGTCAGGG + Intronic
943956427 2:194197535-194197557 CAGTTAAATAAGAGGAATCAAGG - Intergenic
946467150 2:219922007-219922029 AAGTTGATGAGAAGGAAACAGGG - Intergenic
947498000 2:230652821-230652843 CAGGTGATCAGAATGAGTCAGGG - Intergenic
948302878 2:236921341-236921363 CAGTGGATTAGGGGAAATCAAGG + Intergenic
948878510 2:240843020-240843042 CAGGTGATTGGAATGAGTCAGGG + Intergenic
948878531 2:240843128-240843150 CAGGTGATTGGAATGAGTCAGGG + Intergenic
948878577 2:240843371-240843393 CAGGTGATTGGAATGAGTCAGGG + Intergenic
1169756183 20:9045697-9045719 CAGTTGATTAAAAGACATCAAGG - Intergenic
1174355340 20:49994109-49994131 CAGTAAAGTAGAAGGAATGATGG - Intergenic
1179512942 21:41885867-41885889 CAGTTGGTCATAAGGGATCAGGG + Exonic
1183399286 22:37592360-37592382 AAGTAGATTAGAAGCTATCAGGG + Intergenic
949318525 3:2783483-2783505 CAATGGATCAGAAGGAATAAGGG + Intronic
949787352 3:7756834-7756856 CAGGTGATCAGAATGAGTCAGGG - Intergenic
950855593 3:16101690-16101712 CAGGTGATTGGAATGATTCAGGG + Intergenic
950855598 3:16101718-16101740 CAGTTGATGAGAATGAGTCTGGG + Intergenic
951571641 3:24070135-24070157 CAGTTGATTTGTTTGAATCAAGG - Intergenic
953780734 3:45867939-45867961 CTGGTGATGAGAAGGATTCAAGG + Intronic
953780741 3:45868055-45868077 CTGGTGATGAGAAGGATTCAAGG - Intronic
954243053 3:49309216-49309238 AATTTGTTTAGAAGGAGTCACGG - Intronic
954481019 3:50801435-50801457 CAGGTAATTGGAAGGAGTCAGGG + Intronic
954604112 3:51895410-51895432 CAGTTGCTGATAGGGAATCAGGG - Intronic
959175497 3:102904475-102904497 CAGGTGATCAGAATGAATCAGGG + Intergenic
962562185 3:136618145-136618167 CAGGTGATTGGAATGAGTCAGGG - Intronic
963226556 3:142868511-142868533 CAGGTGATCAGAATGAGTCAGGG - Intronic
963226560 3:142868539-142868561 CAGGTGATCAGAATGAGTCAGGG - Intronic
963711594 3:148753589-148753611 CAGGTGATTGGAATGAGTCAGGG + Intergenic
964656630 3:159073996-159074018 GAGGTGATTAGAAGGAATGGGGG + Intronic
964767673 3:160194266-160194288 GAGGTGATTAGAAGTAAGCAAGG - Intergenic
965164884 3:165185265-165185287 CAGATGATTAGAAAGAATAAAGG + Intergenic
966457111 3:180129439-180129461 CAGGTGATTGGAATGAGTCAGGG + Intergenic
966638439 3:182161469-182161491 CAGGTGCTTAGAAGAAAGCATGG + Intergenic
967771623 3:193340119-193340141 CAGTTGATTATGAGCAATGATGG - Intronic
969393027 4:6903243-6903265 TAATTGATTGGAAGAAATCAGGG - Intergenic
970810581 4:20088818-20088840 CAGATGATAAGAAGGAATTGAGG - Intergenic
971311936 4:25532412-25532434 CTGCTGATTTGAAGCAATCAAGG + Intergenic
972155195 4:36152621-36152643 TAGTAGATTAGAAGCATTCAAGG + Intronic
973728193 4:53796916-53796938 CAGTTGAATAGAAGGACATAAGG - Intronic
974078431 4:57189260-57189282 CAGTTGGTTAGATGACATCAGGG + Intergenic
975893135 4:79052865-79052887 GAGTTGATTAGAAGAAATTAAGG - Intergenic
975911952 4:79277633-79277655 CAGGTGATTGGAATGAGTCAGGG - Intronic
977739520 4:100461092-100461114 TGGTTGATTGGAAGGAATGAAGG - Intronic
978314404 4:107419588-107419610 CAGGTGATTGAAATGAATCAGGG - Intergenic
980167831 4:129250632-129250654 CAGTTGAATAGAAGGATTTGAGG - Intergenic
982399747 4:154953597-154953619 CGGTTTATTATAAGGAACCAGGG - Intergenic
982494917 4:156078219-156078241 CAATTGGCTAGAAGGCATCAAGG + Intergenic
982812692 4:159846249-159846271 CTATTGATTAGAAGTATTCATGG - Intergenic
982818346 4:159915246-159915268 CAGTTTCTTTGAAGGAATAAAGG - Intergenic
983583383 4:169330950-169330972 CAGGTGATTAGAATGAGTTAGGG - Intergenic
984208562 4:176817261-176817283 CATTTGATTTGAAGAGATCAGGG - Intergenic
992876196 5:81058425-81058447 CAGTTGATTTGATGCAATCCTGG + Intronic
992952630 5:81875626-81875648 CAGTAGATAGGAAGGAATAAAGG + Intergenic
993055637 5:82976112-82976134 CAGGTGATCAGAATGAGTCAGGG + Intergenic
993905292 5:93616372-93616394 AAGTTGCTTAGAAGGCCTCATGG + Intergenic
994695190 5:103065345-103065367 AAGTAGATTAGCAGTAATCAGGG - Intergenic
994739932 5:103605381-103605403 CACTTTATTAGTAGGAATGAGGG + Intergenic
995129013 5:108609967-108609989 CAGGTGATCAGAATGAGTCAAGG + Intergenic
996390456 5:122955134-122955156 CAGTGGAATGCAAGGAATCAAGG - Intronic
1001050427 5:168409588-168409610 CAGTTGGTGAGGAGGAAACAGGG - Intronic
1002291338 5:178203051-178203073 CATATGATTAAAAGGAATAACGG + Intergenic
1004521252 6:16362953-16362975 CATTTAATTAGATGGTATCATGG - Intronic
1004938033 6:20527317-20527339 CAGATAATTATAAGCAATCAGGG + Intergenic
1005853886 6:29845636-29845658 CAGGTGATCAGAATGAGTCAGGG - Intergenic
1006195791 6:32241383-32241405 CAGTTAACTAGAAGGATTGACGG - Intergenic
1007007805 6:38383475-38383497 CAGTTGAATAGAAGGAACAATGG - Intronic
1007868529 6:45004864-45004886 CAGCCGTTAAGAAGGAATCAGGG - Intronic
1008770163 6:54968600-54968622 CTGTTGATTAGAAGGCAGGAGGG + Intergenic
1008929436 6:56923106-56923128 AAGTTGATTCCAAGAAATCATGG + Intronic
1011561233 6:88618500-88618522 CAGTTGATTAGAAGACCTGATGG - Intronic
1011709761 6:90040854-90040876 CAGCTGATTAGAAGATATAATGG - Intronic
1013058906 6:106612666-106612688 CAGGTGATTGGAATGAGTCAGGG - Intronic
1014592560 6:123292044-123292066 AAGTTGCTTAGAAGGAATTTTGG + Intronic
1015818004 6:137230282-137230304 CAGTTGTTCAGAAGAAGTCAGGG + Intergenic
1016218769 6:141638633-141638655 CAGTTGATTTAATTGAATCAGGG + Intergenic
1016898073 6:149073772-149073794 CAGTAGCTTAGAAGGGATCCCGG - Intronic
1020505380 7:8980414-8980436 TAGTTGATTAAAATGAATCTTGG + Intergenic
1020655963 7:10928365-10928387 CAGGTAATTAGAATGAACCAGGG - Intergenic
1021031545 7:15743281-15743303 CAGTTTTTTAGAAAGAATTAAGG - Intergenic
1021664228 7:22958899-22958921 CAGTAGCTTAGAAGCAATTATGG + Intronic
1021686432 7:23191535-23191557 CAAGTCATTAGAAGGAATCCAGG + Intronic
1021822846 7:24515434-24515456 CAGTGGAATAGAAAGAACCAAGG + Intergenic
1021823260 7:24519076-24519098 CAGTGGAATAGAAAGAACCAAGG - Intergenic
1023443767 7:40210870-40210892 CAGGTGATCAGAATGAGTCAGGG + Intronic
1024147196 7:46529777-46529799 CAGTTGATTAACAGGATTCCTGG - Intergenic
1024297526 7:47857327-47857349 CAATGGATTAGAAGGCCTCAAGG + Intronic
1028573171 7:92314985-92315007 CAGTTGATAATAAGAAAGCAAGG + Intronic
1028793324 7:94877846-94877868 CAGGTGATCAGAATGAGTCAGGG - Intergenic
1028793336 7:94877935-94877957 CAGGTGATCAGAATGAGTCAGGG - Intergenic
1028814986 7:95133214-95133236 CAATTGGTTAAAAGGCATCAAGG + Intronic
1029943022 7:104500277-104500299 CAGTTGATTAGAAGGAATCACGG - Intronic
1033092891 7:138403314-138403336 CAGGTGATCAGAATGAGTCAGGG - Intergenic
1033270572 7:139929481-139929503 CAGGTGATTGGAATGAGTCAGGG + Intronic
1033665919 7:143440390-143440412 CAGTTGAGTAGAAGGGATAGAGG - Intergenic
1033953892 7:146819809-146819831 CAAGTGAAAAGAAGGAATCAAGG - Intronic
1033969678 7:147024772-147024794 CAGTGGATGAAGAGGAATCATGG + Intronic
1033991460 7:147292586-147292608 CTGATGATTTGGAGGAATCAGGG + Intronic
1036467304 8:9012590-9012612 CAGTAAATTAGAAGGAAAAATGG + Intronic
1037412685 8:18615187-18615209 CAGGTGATCAGAATGAGTCAGGG - Intronic
1038525739 8:28271583-28271605 CAGTTGAAATGAATGAATCAGGG - Intergenic
1039563061 8:38528579-38528601 GAGTTGATTAGAAGCAATCTTGG - Exonic
1040829739 8:51663467-51663489 CAGTTCATTAGAGGAAATAAAGG - Intronic
1042087022 8:65120535-65120557 CAGGTGATCAGAATGAGTCAGGG + Intergenic
1044709926 8:95047381-95047403 CAGTTGTTTGGAAGGGAGCAAGG - Intronic
1045520616 8:102899924-102899946 CAGCTGATGAGTAGGAATCTGGG + Intronic
1046940096 8:119922504-119922526 GAATTAATTAGAAGGATTCATGG + Intronic
1047811240 8:128411550-128411572 CAGCTGATAATAAGAAATCAAGG - Intergenic
1048066776 8:130977913-130977935 CAATAGATTAGATGGAATCATGG - Intronic
1050909599 9:11052092-11052114 GAGTTAATTAGAAGGATTCCTGG - Intergenic
1052648768 9:31273018-31273040 CAGGTGATTGGAATGAGTCAGGG - Intergenic
1052648773 9:31273046-31273068 CAGATGATTGGAATGAGTCAGGG - Intergenic
1052648777 9:31273074-31273096 CAGGTGATTGGAATGAGTCAGGG - Intergenic
1053110521 9:35455777-35455799 CAGGTGATCAGAATGAGTCAGGG + Intergenic
1053111310 9:35461946-35461968 CAGGTGATCAGAATGAGTCAGGG + Intergenic
1053218757 9:36294122-36294144 CAGGTCATTTGAAGGAATCTGGG - Intronic
1055681134 9:78716732-78716754 TGGTTGACTAGAAGGAATCTAGG + Intergenic
1056414256 9:86361027-86361049 CAGGTGATTGGAATGAGTCAGGG + Intergenic
1056656111 9:88510677-88510699 CAGGTGATTGGAATGAGTCAGGG - Intergenic
1056801577 9:89695752-89695774 CAGCTGAATCAAAGGAATCATGG - Intergenic
1186831845 X:13398611-13398633 CAGTTGATTGAAATGACTCAGGG + Intergenic
1187457404 X:19454499-19454521 CAGTGGAGTGGAAGGTATCAGGG + Intronic
1189034786 X:37484429-37484451 CAGGTGATTGAAATGAATCAGGG - Intronic
1189955536 X:46273753-46273775 CAGGTGATCAGAATGAGTCAGGG - Intergenic
1190623566 X:52313644-52313666 CTGTTGATCAGCAGGAAACATGG - Intergenic
1190770152 X:53507522-53507544 CAGTTGATTAACAGGAAAAAAGG + Intergenic
1192090841 X:68153802-68153824 AAATTTACTAGAAGGAATCACGG - Intronic
1195019099 X:100808486-100808508 CAGGTGATCAGAATGAGTCAGGG + Intergenic
1197213846 X:123850031-123850053 CAGGTGATTGAAAGGAGTCAGGG - Intergenic
1198112431 X:133513687-133513709 CCTTGGATTAGAAGCAATCATGG - Intergenic
1198868893 X:141155352-141155374 CAGGTGATCAGAATGAGTCAGGG - Intergenic
1198948546 X:142042263-142042285 CAGGTGATCAGAATGAGTCAGGG + Intergenic
1199637172 X:149825157-149825179 CAGGTGATTGGAATGAGTCAGGG - Intergenic
1199638521 X:149836735-149836757 CAGGTGATCAGAATGAGTCAAGG - Intergenic
1201368233 Y:13232478-13232500 TAGTTTATTTGAAGGAATCATGG - Intergenic
1201724325 Y:17136579-17136601 CACTTGATTAGGATGAACCAGGG + Intergenic