ID: 1029945037

View in Genome Browser
Species Human (GRCh38)
Location 7:104523840-104523862
Sequence CCTTCCTGAGGAGCATTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029945037_1029945040 -1 Left 1029945037 7:104523840-104523862 CCTGGCAATGCTCCTCAGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1029945040 7:104523862-104523884 GTTTAAAATACTCAGATTCATGG 0: 1
1: 0
2: 1
3: 32
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029945037 Original CRISPR CCTTCCTGAGGAGCATTGCC AGG (reversed) Intronic